Top Banner
2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base. DNA has a sugar–phosphate backbone, complementary base pairing — adenine with thymine and guanine with cytosine. The two DNA strands are held together by hydrogen bonds and have an antiparallel structure, with deoxyribose and phosphate at 3' and 5' ends of each strand. (ii) Chromosomes consist of tightly coiled DNA and are packaged with associated proteins.
156

2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Dec 22, 2015

Download

Documents

Linda Dixon
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• 2 Structure and function of DNA (a) Structure and replication of DNA

• (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base. DNA has a sugar–phosphate backbone, complementary base pairing — adenine with thymine and guanine with cytosine. The two DNA strands are held together by hydrogen bonds and have an antiparallel structure, with deoxyribose and phosphate at 3' and 5' ends of each strand.

• (ii) Chromosomes consist of tightly coiled DNA and are packaged with associated proteins.

Page 2: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.
Page 4: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

•Chromosomes are thread-like structures found in the nucleus of the cell.

•They are made up of tightly coiled DNA (deoxyribonucleic acid) along with associated proteins

•A molecule of DNA consists of two strands of repeating units called NUCLEOTIDES.

CHROMOSOMES

Page 5: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• http://biomodel.uah.es/en/model3/adn.htm

Page 6: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Videos of discoverers of DNA structure

• http://www.dnai.org/a/index.html

Page 7: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

PHOSPHATE

BASE

DEOXYRIBOSE SUGAR

A DNA NUCLEOTIDEA DNA NUCLEOTIDE

Page 8: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

CHAIN OF NUCLEOTIDES

Page 9: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

THE DOUBLE HELIX

Page 11: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

DNA structure

• The basic units of DNA are called nucleotides. They contain deoxyribose sugar, phosphate and a base. The sugar and phosphate join together to form the DNA’s backbone.

• There are four possible bases which join in complementary base pairs: adenine (A) always joins with thymine (T) and guanine (G) always joins with cytosine (C). The two DNA strands are held together by weak hydrogen bonds between the bases.

Page 12: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Antiparallel patterns

Page 13: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.
Page 14: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• At one end of the chain, called the 5‘ end is a phosphate

• At the other end of the chain, called the 3'end,is a deoxyribose sugar

• The reason for this antiparallel arrangement is that this is the only way in which the two strands can fit together.

Page 15: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• The two strands stand alongside each other but run in antiparallel directions, i.e. they run in opposite directions.

• At the end of one strand, the end finishes with a phosphate molecule and is named the 5-prime (5’) end.

• At the end of the other strand, the end finishes with a deoxyribose sugar molecule and is named 3-prime (3’) end.

• (d rhymes with 3!)

Page 16: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Describe the location and structure of DNA. (8 marks)

Describe the location and structure of DNA. (maximum of 8 marks):

– DNA is located on chromosomes in the nucleus.– A DNA molecule consists of two strands wound in a double helix.– Each strand consists of subunits called nucleotides.– A nucleotide consists of a deoxyribose sugar molecule, a phosphate

group and an organic / nitrogenous base.– The deoxyribose and phosphate are linked to their neighbours to form

a sugar-phosphate backbone.– There are four organic bases: adenine (A), thymine (T), guanine (G)

and cytosine (C).– Bases are linked in complementary pairs A-T and G-C.– Bases link the two DNA strands by hydrogen bonds.– The two DNA strands have an antiparallel structure / explanation.– Deoxyribose is found at the 3  end of each strand and phosphate is

found at the 5  end.

Page 17: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• (iii) Replication of DNA by DNA polymerase and primer. DNA is unwound and unzipped to form two template strands. DNA polymerase needs a primer to start replication and can only add complementary DNA nucleotides to the deoxyribose (3') end of a DNA strand. This results in one strand being replicated continuously and the other strand replicated in fragments which are joined together by ligase.

Page 18: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.
Page 19: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

3 proposed theories of how DNA replicates....

Take an educated guess of which model and WHY!

Page 22: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

DNA REPLICATION

• DNA replication takes place prior to cell division (mitosis and meiosis)

Requirements:-• DNA to act as a

template• Primer • Enzymes: DNA

polymerase and ligase• Free nucleotides• ATP for energy

TT

GG

AA

CC

AA

CC

TT

GG

Page 23: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• DNA Helicase untwists the helix at locations called replication origins. The replication origin forms a Y shape, and is called a replication fork.

Page 24: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

DNA Replication

• Before replication can occur, the length of DNA to be copied must be unwound to form two separate template strands. 

• The two strands must be

separated by breaking the weak hydrogen bonds that link the paired bases. 

Page 25: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.
Page 26: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• DNA polymerase requires the assistance of a primer, a previously existing short strand of RNA that is complementary to the first part of the DNA segment being copied. 

• This small strand of nucleotides binds by complementary base pairing to the beginning of the area being copied. 

• With the primer in place, DNA polymerase is then able to continue adding the rest of the pairs of the segment until a new double strand of DNA is completed. 

Page 27: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

The leading strand

• Since DNA replication moves along the parent strand in the 5' to 3' direction, replication can occur very easily on the leading strand.

• The DNA polymerase simply sits near the replication fork, moving as the fork does, adding nucleotides one after the other.

• This sort of replication, since it involves one nucleotide being placed right after another in a series, is called continuous.

• http://www.nobel.se/medicine/educational/dna/a/replication/replication_ani.html

Page 28: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

The lagging strand

• Synthesis on the lagging strand is slightly delayed in relation to synthesis on the leading strand.

• http://www.nobel.se/medicine/educational/dna/a/replication/lagging_ani.html

Page 29: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

What you should knowDNA Replication

• DNA polymerase – the enzyme that carries out replication - needs a primer to start replication.

• DNA polymerase only functions in the 5’ to 3’ direction as it can only add complementary DNA nucleotides to the deoxyribose sugar (3') end of a DNA strand, so a DNA strand is always synthesized in the 5’ to 3’ direction.

• This results in one strand being replicated continuously and the other strand replicated in fragments which are joined together by the enzyme ligase.

Page 30: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

DNA Polymerase

DNA Ligase

Primer

Okazaki Fragments

DNA PolymeraseHelicases

Page 31: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• As the replication is completed, the two new strands, each consisting of one new strand bonded to one from the original molecule, now fall away from each other and form two separate identical DNA strands. They each coil into their helical shape and the process is complete.

Page 32: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Give an account of the replication of DNA. (maximum of 7 marks):

– DNA is unwound and unzipped…– …by the enzyme helicase…– …to form two template strands.– DNA polymerase is the enzyme which adds nucleotides to the

new DNA strand.– DNA polymerase needs a primer to start replication.– DNA polymerase can only add complementary nucleotides to

the deoxyribose / 3  end of the DNA strand.– This results in one strand / the leading strand being

continuously replicated,– and the other strand / the lagging strand being replicated in

fragments,– which are joined together (by the enzyme ligase).

Page 33: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.
Page 34: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• (b) Gene expression. Phenotype is determined by the proteins produced as the result of gene expression. Only a fraction of the genes in a cell are expressed.

• Gene expression is influenced by intra- and extra-cellular environmental factors. Gene expression is controlled by the regulation of both transcription and translation.

Page 35: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.
Page 36: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Big Question

Page 37: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Gene Expression; On and Off

Once a cell becomes differentiated – the genes that code for only specific proteins to the workings of that cell are turned on. Only 3-5% of genes expressed in a typical human cell

Page 38: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Gene expression

• A cell’s genotype is determined by the sequence of DNA bases in its genes

• An organism’s phenotype is determined by the proteins produced as the result of genes being switched on.

Page 39: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Although a specialised cell has a complete set of the organism's genes, only those needed for its specialised functions are switched on. All other genes are switched off.

Page 40: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Gene expression in specialised cells

Cell type Activity of genes coding for production of:

  antibodies lysosome enzymes

enzymes for synthesis of urea

pepsin

phagocyte off on off off

liver off off on off

stomach lining

off off off on

lymphocyte on off off off

Page 41: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Gene expressionAlthough a specialised cell has a complete set of theorganism's genes, only those genes needed for itsspecialised functions are switched on. All other areswitched off.

Gene expression is the activation of a gene that resultsin the formation of a protein. Gene expression isinfluenced by intra- and extra-cellular environmentalfactors. Gene expression is controlled by the regulationof both transcription and translation.

Only a fraction of the genes in a cell are expressed. Anorganism’s appearance - its phenotype – is determinedby the proteins produced.

Page 42: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• (i) Structure and functions of RNA. • RNA is single stranded, contains uracil

instead of thymine and ribose instead of deoxyribose sugar. mRNA carries a copy of the DNA code from the nucleus to the ribosome. Ribosomal RNA (rRNA) and proteins form the ribosome. Each transfer RNA (tRNA) carries a specific amino acid.

Page 43: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.
Page 44: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

DNA to Protein

Page 45: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

RNA Structure

Page 46: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

RNA

• RNA is single stranded, contains the base uracil (U) instead of thymine (T) and a ribose instead of a deoxyribose sugar.

Page 47: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Types of RNA

• Messenger RNA (mRNA) – carries the genetic information from the nucleus to the ribosome for protein synthesis

• Ribosomal RNA (rRNA) – along with proteins, form the ribosome

• Transfer RNA (tRNA) – Carries specific amino acids to the ribosome to build into proteins

Page 48: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Venn diagram

DNA both RNA

Page 49: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• (ii) Transcription of DNA into primary and mature RNA transcripts to include the role of RNA polymerase and complementary base pairing.

• The introns of the primary transcript of mRNA are non-coding and are removed in RNA splicing. The exons are coding regions and are joined together to form mature transcript. This process is called RNA splicing.

Page 50: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.
Page 51: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• How does DNA make protein?: http://www.twigonglow.com/mind-map/#205/dna?&_suid=134632521778107492246938636337

• DNA transcription and translation – Bozemanbiology• http://www.youtube.com/watch?

v=h3b9ArupXZg&list=UUEik-U3T6u6JA0XiHLbNbOw&index=27&feature=plpp_video

• • DNA RNA• http://www.youtube.com/watch?

v=xZaMi6OhsSU&feature=plcp

Page 52: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

DNA to protein

www.yourgenome.org/downloads/animations.shtml

Page 53: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Overview of Protein Synthesis

NUCLEUS

RIBOSOME

Page 54: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Protein synthesis stage 1: TRANSCRIPTION

• As DNA is too large to leave the nucleus through pores in the nucleus, a copy of it is made by producing a similar molecule called mRNA. This process is called transcription and requires:

• DNA to act as template• Free RNA nucleotides• Enzymes including RNA polymerase• ATP for energy

Page 55: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Transcription

• http://courses.scholar.hw.ac.uk/vle/scholar/session.controller?action=viewContent&back=topic&contentGUID=16a5d6c5-d575-1e21-9bb0-f2454c2547c3

• http://www.carolina.com/teacher-resources/Video/dna-transcription-video/tr28274.tr

Page 56: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

TRANSCRIPTION

Page 57: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• RNA polymerase unwinds the DNA and breaks hydrogen bonds between bases to separate the strands and expose the gene required.

• Free RNA nucleotides match up along the strand by complementary base pairings:

DNA A G T C A G T CmRNA U C A G U C A G

codon

Each triplet of 3 bases on mRNA is called a codon.

Page 58: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• RNA polymerase then joins up the sugar phosphate backbone to form what is called the primary transcript of mRNA.

• The hydrogen bonds between bases then reform and the DNA coils back up into a double helix.

Page 59: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

RNA splicing

• JUHTHEHFGBOYHSKYRSATANDLETHJDFKETHEJKFICATUFNAPDFGFORSDSTHEDAY

• You have been given a strip of paper containing a sentence interspersed with letters.

• Cut the nonsense sections out and stick together the words to make a sentence.

Page 60: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

It should read:-

THE BOY SAT AND LET THE CAT NAP FOR THE DAY

But you may also have come up with:-

• THE BOY SAT FOR THE DAY• THE BOY LET THE CAT NAP• THE BOY LET THE CAT NAP FOR THE DAY

Page 61: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Introns and exons

• The primary transcript of mRNA is composed of introns and exons.

Non coding region Coding region

Page 62: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

RNA splicing

Page 63: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• The introns of the primary transcript of mRNA are non-coding regions of the gene and are removed in RNA splicing. The exons are coding regions of the gene and are joined together to form the mature transcript of mRNA. This process is called RNA splicing.

Page 64: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• (iii) Translation of mRNA into a polypeptide by tRNA at the ribosome.

• tRNA folds due to base pairing to form a triplet anticodon site and an attachment site for a specific amino acid. Triplet codons on mRNA and anticodons translate the genetic code into a sequence of amino acids. Start and stop codons exist. Codon recognition of incoming tRNA, peptide bond formation and exit of tRNA from the ribosome as polypeptide is formed.

Page 65: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.
Page 66: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Protein synthesis stage 2: TRANSLATION

Changing the code on mRNA into a sequence of amino acids to form a

specific protein.

Page 67: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Tranlasation film

• http://www.carolina.com/teacher-resources/Video/mrna-translation-video/tr28275.tr

Page 68: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

tRNAtRNA amino acid attachment site

tRNA carries a specific amino acid to the ribosome

Page 69: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• tRNA required for translation are found in the cytoplasm. They contain an attachment site to carry a specific amino acid to the ribosome. As there are 20 different amino acids, 20 different tRNA molecules exist.

• They also have a site where a triplet of 3 bases are exposed, called an anti-codon.

Page 70: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• http://courses.scholar.hw.ac.uk/vle/scholar/session.controller?action=viewContent&back=topic&contentGUID=ec041196-3cb0-c55a-f4fe-e839978b92dc

Page 71: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

TRANSLATION

A G C UA AU CG CC U A AG GG

U C G

mRNA

tRNA

ANTI-CODON

RIBOSOME

AMINO ACID

CODON

START CODON!

Page 72: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

TRANSLATION

A G C UA AU CG CC U A AG GG

U C G

U A A

Page 73: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

TRANSLATION

U A A

A G C UA AU CG CC U A AG GG

U C G

PEPTIDE BOND

Page 74: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

TRANSLATION

A G C UA AU CG CC U A AG GGU C G

U A A

U C G

Page 75: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

TRANSLATION

A G C UA AU CG CC U A AG GG

U C G

U A A

U C G

G G A

Page 76: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

TRANSLATION

A G C UA AU CG CC U A AG GG

U C G

G G A

U A A

U C U

Page 77: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

TRANSLATION

A G C UA AU CG CC U A AG GG

G G A

U C U

POLYPEPTIDE CHAIN

STOP CODON!

Page 78: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.
Page 79: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.
Page 80: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Translation • During translation, the mRNA strand passes through

the ribosome which ‘reads’ the mRNA as it goes through.

• Certain mRNA codons act as ‘start’ codons to tell the ribosome where to start and stop reading the strand.

• The ribosome identifies each mRNA codon and then matches it up with the correct tRNA anticodon according to complementary base pairs (A-U, C-G)

• The appropriate tRNA brings its amino acid to the ribosome as it moves along the mRNA.

• Adjacent amino acids then join with a peptide bond to form a polypeptide.

• Each tRNA then leaves the ribosome. • This process continues until a stop ‘codon’ is

reached which tells the ribosome where to end the polypeptide.

• The polypeptide is finally released.

Page 81: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

DNA – mRNA – tRNA - Protein

DNA - TTACGGCAATGCGGTACCGTTGGGGGCAG

mRNA -

Codons (set of 3 bases)

tRNA -

Anti-codons (set of 3 matching bases)

Page 82: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

DNA – mRNA – tRNA - Protein

DNA - TTACGGCAATGCGGTACCGTTGGGGGCAG

mRNA - AAUGCCGUUACGCCAUGGCAACCCCCGUC

Codons (set of 3 bases)

tRNA - UUACGGCAAUGCGGUACCGUUGGGGGCAG

Anti-codons (set of 3 matching bases)

Amino - aspn– ala – val – thr – pro – try – glu – pro – pro

acid

Page 83: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Protein synthesis animation!

• Have a go yourself:

• http://www.zerobio.com/drag_oa/protein/translation.htm

• Google ‘transcription and translation activity’ – look for zerobio.com

• http://learn.genetics.utah.edu/content/begin/dna/transcribe/• Google ‘transcribe and translate a gene’

Page 84: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• (iv) One gene, many proteins as a result of RNA splicing and post-translational modification. Different mRNA molecules are produced from the same primary transcript depending on which RNA segments are treated as exons and introns. Post-translation protein structure modification by cutting and combining polypeptide chains or by adding phosphate or carbohydrate groups to the protein.

Page 85: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.
Page 86: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

One gene, many proteins

Page 87: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

One gene, many proteins

Page 88: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Golgi body animation

• http://www.kscience.co.uk/animations/golgi.htm

Page 89: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Post-translational modification of

insulinThe hormone insulin consists of two polypeptide chains that originate as one chain.

Disulphide bridges form in the original polypeptide chain, known as pro-insulin.

A protease enzyme (an enzyme which cuts protein at a peptide bond) cuts the polypeptide chain in two places.

The middle section of the protein is then removed.

Page 90: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• Mucus adheres to many epithelial surfaces, where it serves as a diffusion barrier against contact with noxious substances and as a lubricant

• Mucus is a glycoprotein consisting of protein and an added carbohydrate

Modification by the addition of a carbohydrate

Page 91: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

From one gene, many different proteins may be produced. This is due to:

1. RNA splicing Different mature transcripts of mRNA may produced from the same primary transcript of mRNA depending on which RNA segments are treated as exons and introns.

2. Post-translational modification The protein may be further cut, combined with other polypeptide chains or have phosphate or carbohydrate groups added to the protein. This will occur in the Golgi body.

Page 92: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• Give an account of gene expression under the following headings.

• Transcription (6 marks)

• Post-translational modification (PTM) (4 marks)

Page 93: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• Transcription (maximum of 6 marks):– Transcription is the formation of a mRNA molecule on a DNA

template.– DNA unwinds, and strands separate by the action of helicase.– RNA nucleotides attach to exposed bases of DNA.– DNA A pairs with RNA U, DNA T - RNA A, DNA G - RNA C and

DNAC - RNA G.– RNA polymerase joins nucleotides (to each other).– This produces the primary transcript.– Which contains introns and exons.– Exons are protein coding sections of mRNA and introns are non-

coding sections.• Post-translational modification (PTM) (maximum of 4 marks):

– It takes place after the polypeptide has been completed on the ribosome.

– It allows several proteins to be formed from one gene.– It may involve enzyme cutting and combining of polypeptide chains.– e.g. insulin from pro-insulin.– It may involve adding of phosphate or carbohydrate groups.– Addition of phosphate enables enzymes / receptors to be switched

'on' and 'off'.

Page 94: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Protein synthesis storyboard

Page 95: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• c) Genes and proteins in health and disease.

• (i) Proteins are held in a three dimensional shape by peptide bonds, hydrogen bonds, interactions between individual amino acids.

• Polypeptide chains fold to form the three dimensional shape of the protein.

Page 96: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.
Page 97: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Protein function

• You will have come across many proteins before and covered some of the many roles they undertake in living organisms.

• Research one of the proteins listed below and complete its ID, which will be used to create a classroom display.

keratin

tubulin

insulin

porin

pepsin

catalase

amylase

haemoglobin

antibody

myosin

actinelastin

phosphorylase

oxytocin

cytochromes

collagen

helicase

integrins polymerase

kinase

Page 98: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Structure:

__(globular/fibrous)__

Location: _____where it is found!_______

Function: ______what it does!_________

_____________________________

______________________________

Protein name

Simple diagram of the protein itself or showing what it does.

Page 99: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Structure: _____________________________

Location: _____________________________

Function: _____________________________

_____________________________

_____________________________

Page 100: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• http://courses.scholar.hw.ac.uk/vle/scholar/session.controller?action=viewContent&back=topic&contentGUID=9df68c88-6cf3-866f-f253-96ce94e448ac

Page 101: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

PROTEIN PRIMARY STRUCTURE

• The primary structure of a protein is the polypeptide chain of amino acids

Page 102: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

PROTEIN SECONDARY STRUCTURE

• Weak hydrogen bonds form between various amino acids.

• This causes the polypeptide chain to become coiled into an helix (coiled) or folded into a pleated sheet (folded)

Page 103: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

PROTEIN TERTIARY STRUCTURE

• The tertiary structure is the final structure of the protein due to hydrogen bonding and sulphide bonding between amino acids.

• tertiary structure can form either fibrous proteins or globular proteins.

Page 104: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

PROTEIN QUARTERNARY STRUCTURE

• Quarternary structure is formed when several polypeptides become bonded together

Page 105: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

FIBROUS PROTEIN

• Formed when several polypeptide chains are bonded together in long parallel strands

• examples include collagen (skin), keratin (hair) and actin and myosin (muscle)

Page 106: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

GLOBULAR PROTEINS

• Look like a tangled ball of string

• Enzymes, hormones and antibodies are all globular proteins

Page 107: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• http://courses.scholar.hw.ac.uk/vle/scholar/session.controller?action=viewContent&back=topic&contentGUID=2ce36382-0b0b-5ccc-ac7c-dcdd0e2453d4

Page 108: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

CONJUGATED PROTEIN

• Contains polypeptide chains and a non-protein part

• E.g. haemoglobin consists of 4 polypeptide chains and 4 iron atoms

Page 109: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Proteins

• Proteins are long polypeptide chains, folded to form a specific three dimensional shape.

• These chains of amino acids are held in a three dimensional shape by peptide bonds, hydrogen bonds and sometimes additional bonds with other non protein molecules.

Page 110: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• Do protein power electrophoresis protocol

Page 111: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• (ii) Mutations result in no protein or a faulty protein being expressed.

• Single gene mutations involve the alteration of a DNA nucleotide sequence as a result of the substitution, insertion or deletion of nucleotides. Single-nucleotide substitutions include: missense, nonsense and splice-site mutations. Nucleotide insertions or deletions result in frame-shift mutations or an expansion of a nucleotide sequence repeat.

• The effect of these mutations on the structure and function of the protein synthesised and the resulting effects on health.

Page 112: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.
Page 113: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

What is a mutation?What is a mutation?• It’s a change in the DNA sequence.

Page 114: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Gene MutationsGene Mutations• Changes in one or more nucleotides

in the DNA of the cell

Page 115: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

MUTATIONS

• Occur naturally in every population• They can occur spontaneously (at

random)• An individual with a mutation is

termed a mutant

Page 116: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

EXAMPLES

• Polydactyly – presence of extra finger or toes

• Liam Gallagher and Marilyn Monroe!!

Page 117: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

LIAM’S EXTRA TOE!

Page 118: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

MARILYN’S EXTRA TOE!

Page 119: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Mutations

• Mutations are random changes to the DNA’s normal nucleotide base sequence.

• This causes the section (gene) involved to produce either a faulty protein or not to produce any protein at all.

Page 120: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• http://courses.scholar.hw.ac.uk/vle/scholar/session.controller?action=viewContent&back=topic&contentGUID=f0af9519-17b3-a64f-e476-23cff5db50e6

Page 121: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

SubstitutionSubstitution Mutations Mutations

Only this amino acid altered

Page 122: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Mutations

• Mutations involving only one gene are called single gene mutations. There are three different types of single gene mutations:

• 1. Substitution mutations An individual nucleotide is replaced by a different nucleotide. This changes the bases in an mRNA codon.

Page 123: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Single nucleotide substitution mutations

• There are different types of substitution mutations, depending on where the substitution occurs:– Nonsense– Missense– Splice site

Page 124: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Non sense mutationsNon sense mutations

•Substitution of a single nucleotide that leads to the appearance of a stop codon where previously there was a codon specifying an amino acid. A much shortened protein is produced eg sickle cell anaemia.

Page 125: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Nonsense mutations

• Duchenne muscular dystrophy:• https://www.youtube.com/watch?

v=CQPLxNsN1J0&list=UUhUIp7xnLfBcNKTTjHdypfQ

• Sickle cell anaemia: • https://www.youtube.com/watch?

v=LlF_8oRs6Bw&list=UUhUIp7xnLfBcNKTTjHdypfQ

Page 126: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Missense mutations• Substitution of a single

nucleotide causes the formation of a different amino acid in the resulting protein.

• This amino acid substitution may have no effect, or it may render the protein non-functional.

• E.g. Duchenne muscular dystrophy.

Page 127: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.
Page 128: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• Alters the specific sequence which identifies the site at which the splicing of mRNA occurs

• May lead to retention of large segments of introns, or the incorrect removal of exons from the mRNA.

• May result in production of a non-functional protein e.g. beta thalassemia.

Beta thalassemia: •Reduces the production of hemoglobin. •Shortage of red blood cells (anaemia), which can cause pale skin, weakness, fatigue, and more serious complications.

Splice site mutations

Page 129: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Substitutions mutations

Different types of substitution mutations occur, depending on where

the substitution occurs:

a) Missense – a nucleotide in a codon is substituted, causing a different amino acid to be produced. This may lead to the final protein not functioning e.g. Duchenne muscular dystrophy

b) Nonsense –a nucleotide in a codon is substitutes, changing it from coding for an amino acid coding for a stop codon. This causes a shorter (usually non functioning) protein e.g. sickle cell anaemia

c) Splice-site- the nucleotide at which mRNA splicing occurs is substituted, causing the location of the splice site to change. This leaves non coding regions (introns) left in and coding regions (extrons) removed from the mature mRNA, thus producing non functioning proteins e.g. beta thalassemia

Page 130: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

InsertionInsertion Mutations Mutations

All amino acids altered

Page 131: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Mutations

2. Insertion mutations

A nucleotide is added to the DNA

Nucleotide insertions cause a frame-shift mutation. This is where adding a nucleotide causes that mRNA codon and all of the codons that follow on the mRNA to change and thus produce the wrong amino acids. This leads to a very different and generally non-functional protein product. E.g. Tay-Sachs syndrome

Page 132: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.
Page 133: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• Expansion of a nucleotide repeat:

• http://www.hhmi.org/biointeractive/tri-nucleotide-repeat

• E.g. Huntingdon’s disease:

• https://www.youtube.com/watch?v=xguyxdmeUK8&list=UUhUIp7xnLfBcNKTTjHdypfQ

Page 134: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Repeated nucleotide insertions may also cause many of the same codons to be copied, resulting in many extra copies of a single amino acid being produced . This is called a nucleotide sequence repeat expansion. E.g. Huntingdon’s disease.

Page 135: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

DeletionA

B

C

G

H

New chromosome

A

B

C

D

E

F

G

H

BREAK

Original chromosome

D

E

F

Deleted genes

Page 136: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

DeletionDeletion Mutations Mutations

All amino acids altered

Page 137: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• Called frame shift mutations

Single nucleotide deletions

Page 138: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Cystic Fibrosis

Page 139: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Mutations

3. Deletion mutations

A nucleotide is removed from the DNA

Nucleotide deletions also cause frame shift mutations.

Page 140: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• Experiments investigating the effects of UV radiation on UV sensitive yeast.

Page 141: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Definition;

Genetic disorders are caused by changes to genes or chromosomes that result in the proteins not being expressed or the proteins expressed not functioning correctly.

Examples;Sickle cell anaemia

Duchenne muscular dystrophy

Tay-Sachs syndrome

Cystic fibrosis

Huntingdons

Fragile X syndrome

Beta thalassemia

PKU

Cri-du-chat syndrome

Chronic myeloid leukaemia

Down’s syndrome

Genetic Disorders

Page 142: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Single gene mutation case studies:

• • Huntingdon's disease (nucleotide sequence repeat expansion) - Individuals with large numbers of repeats show progressive degeneration of the nervous system, affecting muscle coordination and cognitive ability. It typically only becomes noticeable in mid-adult life.

• • Fragile X syndrome (nucleotide sequence repeat expansion) - leads to autism and intellectual disability. As with any condition controlled by genes on the X-chromosome, it affects males at a higher rate than females.

• • Sickle-cell disease (missense) – leads to the production of abnormally rigid and sickle cell haemoglobin causing obstructions in small vessels as well as a wide range of other serious effects.

• • Phenylketonuria (PKU) (missense) - causes the production of an inactive form of an enzyme, resulting in a range of symptoms including impaired brain function.

• • Beta (β) thalassaemia (splice-site) - causes reduced, or no, production of one of the polypeptide chains which make up haemoglobin. The symptoms range from none to severe anaemia.

• • Duchenne muscular dystrophy (DMD) (nonsense) – caused by mutation to a gene on the X chromosome, resulting in failure to produce an important structural protein in muscle. It causes muscle degeneration and early death.

• • Tay-Sachs syndrome (frameshift insertion) - results in progressive destruction of the central nervous system and early death.

• • Cystic fibrosis (frameshift deletion) - results in the secretory glands of the lungs producing very sticky mucus, poor growth and frequent chest infections. Untreated, it leads to death in infancy.

Page 143: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Give an account of gene mutation. (9 marks)

• Give an account of gene mutation. (maximum of 9 marks)– A gene mutation is a change in the base type or sequence in a gene.– In a substitution (mutation) one base is replaced by another.– If substitution produces a new stop codon it is a nonsense mutation.– If substitution affects introns and exons it is a splice-site mutation.– If substitution changes one mRNA codon it is a missense mutation.– In a deletion (mutation) a base is removed.– In an insertion (mutation) a base is added.– A change to a single nucleotide / base is a point mutation.– Insertion and deletion (mutations) can potentially cause frameshift

mutation.– A frameshift mutation alters all the triplets following it.– If any of these mutations occurs in a protein-coding gene, then the

protein produced may be altered (or not produced at all).

Page 144: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

• Chromosome structure mutations — deletion; duplication; translocation.

• The substantial changes in chromosome mutations often make them lethal.

Page 145: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Chromosome structure mutations

• There are different types of chromosome mutations, depending on how the chromosome is altered, including:

– Deletion– Duplication– Translocation

Page 146: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Chromosome deletion

Page 147: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Deletion

• The structure of a chromosome can be altered by:– Deletion resulting in the

loss of a segment of the chromosome

– Can result in Cri-du-chat syndrome (deletion of part of the short arm of chromosome 5)

The name of this syndrome is French for "cry of the cat," referring to the distinctive cry of children with this disorder.

Page 148: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Chromosome duplication

Page 149: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Translocation

U

V

A

B

C

D

E

S

T

Translocated

genes

A

B

C

D

E

S

T

U

V

Chromosome 1

Chromosome 2

BREAK

Page 150: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Chromosome translocation

Part of chromosome 22 has been translocated

to chromosome

9

Page 151: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

This karyotype is from a woman with 45 chromosomes and a translocation

between chromosomes 13 and 14

No abnormal symptoms detected!

Page 152: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Translocation sufferer film

• http://www.youtube.com/watch?v=8FGYzZOZxMw

Page 153: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Familial Down’s syndrome

• The vast majority of Down’s syndrome cases results from an extra copy of chromosome 21, however in about 5% of cases one parent has the majority of chromosome 21 translocated to chromosome 14 resulting in Familial Down’s syndrome

Page 154: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Chronic Myeloid LeukaemiaForm of cancer that affects stem cells that give rise to white blood cellsThese stem cells are affected by reciprocal translocation of chromosomes 9 and 22The translocation results in what is called a cancer causing oncogeneAn oncogene encodes for a protein that promotes uncontrolled cell growth, cancer

Page 155: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Chromosome structure mutations• There are different types of chromosome

mutations. The substantial changes which occur often make them lethal.

1. Duplication – a part / whole chromosome is duplicated (copied) e.g. common cancers

2. Translocation a part / whole chromosome is moved to another chromosome e.g. Chronic myeloid leukaemia (CML)

3. Deletion – a part / whole chromosome is deleted E.g.Cri-du-chat syndrome

Page 156: 2 Structure and function of DNA (a) Structure and replication of DNA (i) Structure of DNA — nucleotides contain deoxyribose sugar, phosphate and base.

Chromosome mutation case studies:

• Cri-du-chat syndrome (deletion of part of the short arm of chromosome 5)

• Chronic myeloid leukaemia (CML) (reciprocal translocation of a gene from chromosome 22 fused with a gene on chromosome 9)

• Familial Down’s syndrome (in 5% of cases one parent has the majority of chromosome 21 translocated to chromosome 14).