1 Title Page Topotecan triggers apoptosis in p53-deficient ...jpet.aspetjournals.org/content/jpet/early/2009/10/07/jpet.109.159962.full.pdf · (Tomicic et al., 2005b). Since TPT-triggered

JPET#159962

1

Title Page

Topotecan triggers apoptosis in p53-deficient cells by forcing degradation of XIAP and

survivin thereby activating caspase-3 mediated Bid cleavage

Maja T. Tomicic, Markus Christmann and Bernd Kaina

Department of Toxicology, University Medical Center of the Johannes Gutenberg

University of Mainz, Germany (MTT, MC, BK)

JPET Fast Forward. Published on October 7, 2009 as DOI:10.1124/jpet.109.159962

Copyright 2009 by the American Society for Pharmacology and Experimental Therapeutics.

This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on October 7, 2009 as DOI: 10.1124/jpet.109.159962

at ASPE

T Journals on February 14, 2020

jpet.aspetjournals.orgD

ownloaded from

http://jpet.aspetjournals.org/

JPET#159962

2

Running Title Page

Running title

Topotecan-triggered apoptosis in p53-deficient cells

Corresponding author

Bernd Kaina

Department of Toxicology

University Medical Center of the Johannes Gutenberg University of Mainz

Obere Zahlbacher Str. 67

D-55131 Mainz

Germany

Tel.: 0049-6131-393-3246

Fax: 0049-6131-239596

E-mail: [email protected]

Document statistics

Number of text pages - 27

Number of tables - 0

Number of figures - 6

Number of references - 40

Number of words in the Abstract - 250

Number of words in the introduction - 532

Number of words in the discussion – 982

Non-standard abbreviations

ATM, Ataxia telangiectasia mutated; ATR, Ataxia telangiectasia and Rad3 related; CARD,

caspase activation and recruitment domain; IAP, inhibitor of apoptosis protein; ECL,

enhanced chemical luminescence; mAb, monoclonal antibody; pAb, polyclonal antibody;

PIDD, p53-induced protein with a death domain; XIAP, X-chromosome linked inhibitor of

apoptosis; zVAD-fmk; benzyloxy-carbonyl-Val-Ala-Asp-fluoromethylketone; zDEVD-fmk,

benzyloxy-carbonyl-Asp-Glu-Val-Asp-fluoromethylketone; zLEHD-fmk, benzyloxy-carbonyl-

Leu-Glu-His-Asp-fluoromethylketone


at ASPE



ownloaded from


JPET#159962

3

Abstract

The topoisomerase I inhibitor topotecan (TPT) is used in the therapy of different tumors

including high-grade gliomas. We previously showed that TPT-induced apoptosis depends

on p53 with p53 wild-type (wt) cells being more resistant due to p53-controlled degradation of

topoisomerase I. Here we show that p53-deficient (p53-/-) fibroblasts undergo excessive

mitochondrial apoptosis featured by H2AX phosphorylation, Bcl-xL decline, cytochrome c

release, caspase-9/-3/-2 activation and cleavage of Bid. In wt and apaf-1-/- cells neither

caspase-2 became activated nor Bid was cleaved. Also, p53-/- cells co-treated with TPT and

caspase-3 inhibitor showed neither caspase-2 activation nor Bid cleavage, implying that

caspase-2 is processed downstream of the apoptosome by caspase-3. Although processing

of caspase-9/-3 was similar in wt and p53-/- cells, only p53-/- cells displayed active caspase-3.

This was due to proteasomal degradation of XIAP and survivin that inhibit caspase-3 activity.

Accordingly, TPT-induced apoptosis in wt cells was increased following XIAP/survivin

knockdown. Silencing of Bid led to reduction of TPT-triggered apoptosis. Data obtained with

mouse fibroblasts could be extended to human glioma cells. In U87MG (p53wt) cells co-

treated with TPT and pifithrin-α or transfected with p53-siRNA caspase-2 and Bid were

significantly cleaved and XIAP/survivin degraded. Furthermore, the knockdown of XIAP and

survivin led to increased TPT-triggered apoptosis. Overall, the data show that p53-

deficient/depleted cells are hypersensitive to TPT because they down-regulate XIAP and

survivin and thus amplify the intrinsic apoptotic pathway via caspase-3-mediated Bid

cleavage. Therefore, in gliomas harboring wild-type p53 TPT-based therapy might be

improved by targeted down-regulation of XIAP and survivin.


at ASPE



ownloaded from


JPET#159962

4

Introduction

Topotecan (TPT) is a camptothecin derivative that belongs to the class of topoisomerase I

(topoI) inhibitors. It is used in the therapy of different types of cancer including pediatric high-

grade gliomas. After the formation of a DNA single-strand break (SSB), topoI remains

covalently bound to the 3’-end of the DNA phosphodiester backbone forming the topoI-DNA

cleavable complex (Nitiss and Wang, 1996), which is a reversible intermediate catalyzing the

cleavage-religation reaction of the enzyme (Porter and Champoux, 1989). TopoI inhibitors

such as TPT stabilize this complex preventing the religation of topoI-mediated SSBs

(Hertzberg et al., 1989). The cytotoxicity of topoI inhibitors is limited to the S-phase of the cell

cycle and is triggered by a collision of the replication fork with the inhibitor-stabilized

cleavable complex. This results in blockage of fork movement and finally the formation of

toxic DNA double-strand breaks (DSBs) (Hsiang et al., 1989; Goldwasser et al., 1996).

These DSBs induce a checkpoint response by activation of upstream kinases like ATM, ATR

and DNA-PK and subsequent phosphorylation of the histone variant H2AX. The

phosphorylated H2AX (γH2AX) recruits different repair proteins to the site of DNA damage,

like the Mre11/Rad50/Nbs1 complex, thereby activating DSB repair (Furuta et al., 2003).

Different parameters such as drug accumulation, the level of topoI-DNA complex formation,

the expression and activity of topoI and the level of Mdr-1, Bcl-2 and Bax were not found to

be predictive for the sensitivity to topoI inhibitors or were controversially discussed

(Goldwasser et al., 1995; Davis et al., 1998; Schmidt et al., 2001; Blumenthal et al., 2004).

This also applies to p53, for which we showed that it determines the sensitivity of glioma

cells to TPT (Tomicic et al., 2005b).

In many cell systems p53 has been identified as a pro-apoptotic player, stimulating either the

death receptor (Muller et al., 1998) or the mitochondrial apoptotic pathway (Miyashita and

Reed, 1995). However, in some cell types, including MEFs, p53 preferentially acts in an anti-

apoptotic manner (Lackinger and Kaina, 2000; Christmann et al., 2005; Tomicic et al.,

2005a). This is explained by a predominant role of p53 in DNA repair (Christmann et al.,

2003). Using non-transformed MEFs and glioblastoma cell lines proficient or deficient for


at ASPE



ownloaded from


JPET#159962

5

p53, we showed that cells lacking p53 are significantly more sensitive to TPT than their p53-

proficient counterpart, indicating that lack of functional p53 sensitizes cells to topoI poisons

(Tomicic et al., 2005b). Since TPT-triggered sensitivity strongly differed between p53-

proficient and p53-deficient cell lines, we hypothesized that p53 not only mediates the topoI

degradation in the cleavable complex (Tomicic et al., 2005b) but may also be responsible for

differential activation of the apoptotic machinery in p53wt versus p53 mutated/deficient cells.

Therefore, we extended our previous study by dissecting the TPT-induced apoptotic

response in p53 wt and deficient cells. Notably, we addressed the issues of caspase-2

processing, Bid cleavage and cellular caspase inhibitors (IAPs). Data were obtained with

MEFs and human glioma cells. Since TPT is used in clinical trials of pediatric high-grade

gliomas that have a poor prognosis (Wagner et al., 2008), novel insights into the network of

pro-survival and pro-apoptotic factors evoked by the drug might help understanding the

mechanism of drug resistance that limits the success of therapy.

Methods

Cell lines

Mouse embryonic fibroblasts (MEFs) knockout for Apaf-1 were kindly provided by Dr. Schuler

(Department of Medicine III, University Medical Center Mainz, Germany) at passage 15. The

wild-type (wt) cell line was a littermate to the apaf-1 null cell line (apaf-1-/-), both proficient for

p53 (Milosevic et al., 2003). The p53-deficient cell line used (p53-/-2-98M=p53-/-) was

generated from p53 knockout mouse embryos (C57BL, the Jackson Laboratories) as

previously described (Lackinger and Kaina, 2000). Cells were grown in Dulbecco’s minimal

essential medium (DMEM) with high glucose and glutamine at 37°C in an atmosphere

containing 7% CO2. The wt MEFs were grown in medium containing 15% fetal bovine serum

(FBS), whereas apaf-1-/- and p53-/- cells were grown in the same medium with 10% FBS.

Caspase-2-/- MEFs were kindly provided by Dr. Du (The University of Cincinnati, OH, USA).

They were immortalized by transformation with SV40 large T-antigen (Shi et al., 2009) and

were grown in DMEM with 10% FBS. U87MG human glioma cell line was provided by Dr.


at ASPE



ownloaded from


JPET#159962

6

Weller (Department of Neurology, Medical School, University of Tübingen, Germany;

(Wischhusen et al., 2003)) and cultivated in DMEM with 10% FBS. Cells were mycoplasma-

free and tested for their origin by RT-PCR.

Reagents, drug treatment and caspase activity assay

Topotecan hydrochloride (Hycamtin, SmithKline Beecham, Brentford, Middlesex, UK) was

obtained from and prepared to stock solution (1 mg/mL) by the pharmacy of the University

Medical Center (Mainz, Germany). In all experiments cells were continuously exposed to

TPT. zVAD, zDEVD, zLEHD were irreversible cell permeable caspase inhibitors

(Calbiochem, La Jolla, CA, USA). Pifithrin-α (Sigma-Aldrich, Munich, Germany) was applied

at working concentration of 30 µM. The Caspase Colorimetric Assay was conducted

according to the manufacturer (R&D Systems, Wiesbaden, Germany).

Flow cytometry

For monitoring drug-induced apoptosis and necrosis, annexin V-FITC/propidium iodide (PI)

double-staining combined with flow cytometry was performed. Exponentially growing cells

were treated with different concentrations of TPT for 48 or 96 h and thereafter subjected to

analysis as previously described (Tomicic et al., 2002a). In brief, cells were fixed in ethanol,

treated with 0.1 mg/mL RNase in PBS and stained with PI, for flow cytometric determination

of subG1 fraction.

Preparation of cell extracts and western blot analysis

Whole-cell extracts for H2AX phosphorylation were prepared by direct lysis of the cells in

pre-heated 1x loading buffer (Roti-Load 1, Roth, Karlsruhe, Germany), sonified and

separated by 10% SDS-PAGE and electro-blotted onto nitrocellulose membranes, which

were then incubated with mouse anti-γH2AX mAb (Upstate, Lake Placid, NY, USA), diluted

1:500 in 5% non-fat dry milk, 0.2% Tween-TBS, and incubated overnight at 4°C. For western

blot analysis with mouse anti-p53 mAb (Dianova, Hamburg, Germany) and anti-p21 mAb


at ASPE



ownloaded from


JPET#159962

7

(Calbiochem, La Jolla, CA, USA), nuclear extracts were prepared. Whole-cell extracts for

western blot analysis with rabbit anti-Bid pAb, anti-Bcl-xL pAb (BD PharMingen, Heidelberg,

Germany), mouse anti-Bcl-2 mAb, rabbit ant-Bax pAb, anti-ERK2 pAb (Santa Cruz

Biotechnology, Heidelberg, Germany), rabbit anti-Caspase-2 pAb (NeoMarkers, Fremont,

USA) were prepared by lysis in ice-cold sample buffer (25 mM Tris-HCl, pH 6.8, 1 mM EDTA,

5% glycerol, 2.5% 2-mercaptoethanol; 1 mM PMSF was added freshly), followed by

sonificatin on ice. For western blot analysis with anti-caspase-9/-3 antibodies, rabbit anti-

XIAP pAb, anti-survivin mAb, human-specific mouse anti-caspase-2 mAb and rabbit anti-

ERK1/2 pAb protein extracts were prepared according to the manufacturer (Cell Signaling

Technology, Beverly, MA, USA). Preparation of cytosolic extracts for immunoblotting with

anti-cyt c pAb (Santa Cruz Biotechnology) was described (Tomicic et al., 2002b). Protein-

antibody complexes were detected by ECL (Amersham, Uppsala, Sweden).

siRNA transfection

Human double-stranded p53-siRNA and the control nonsense siRNA (NON-siRNA) were

ready-to-use (Qiagen, Hilden, Germany), identical to mouse sequence. XIAP/survivin-siRNAs

suitable for knockdown experiments in mouse and human cell lines and mouse-specific Bid-

siRNA were synthesized as single-stranded oligonucleotides (MWG Biotech, Munich,

Germany), with the following sequence: XIAP-si-up, aagugcuuucacuguggagga; XIAP-si-low,

uccuccacagugaaagcacuu; survivin-si-up, ggcuggcuucauccacugctt; survivin-si-low,

gcaguggaugaagccagccagcctt. The sequence for Bid-siRNA was as published (Ziporen et al.,

2009). Single-stranded siRNAs were annealed according to the protocol (Metabion,

Martinsried, Germany). Annealed siRNA oligonucleotides were transfected into wild-type or

p53-deficient MEFs, or glioma cells depending on the experimental design using HiPerFect

Transfection Reagent (Qiagen, Hilden, Germany) according to a protocol for primary MEFs.

For 6-well plates, the concentration of transfected siRNA was 20 nM. Gene silencing was

verified 24-72 h after transfection.


at ASPE



ownloaded from


JPET#159962

8

Statistical analysis

Statistical significance was verified by unpaired Student’s t-test or, in case of significant

differences between the standard deviations (SDs) of the comparing variants, by alternate

(Welch) t-test of the statistical software GraphPadInStat v2.04a (copyright Dr. F. Gotz, TSE

GmbH). The probability values were defined as follows: ∗p<0.05 (significant difference);

∗∗p<0.01 (very significant difference); ∗∗∗p<0.001 (extremely significant difference).

Results

Cellular sensitivity to TPT

First, we compared MEFs wild-type for p53 (wt), knockout for p53 (p53-/-) and knockout for

Apaf-1 (apaf-1-/-, proven to be p53-proficient; Supplemental Figure 1) as to their killing

response to TPT. To this end, we determined the level of apoptosis and necrosis by annexin

V/PI flow cytometry. Cells were exposed to increasing concentrations of the drug and

harvested 48 and 96 h later. In all experiments, necrosis (annexin V plus PI stained cells)

was marginal (<5%, data not shown), indicating apoptosis is the main route of cell death

(Figure 1A). p53 wt cells were quite resistant, showing at maximum 10% apoptosis in the

dose range used. Even more resistant to TPT were apaf-1-/- cells, displaying <4% apoptosis

(similar to untreated controls) for the whole dose range tested. In contrast, p53-/- MEFs were

highly sensitive to TPT. They underwent excessive apoptosis, culminating in 80% after 96 h-

exposure to 5 µg/mL of the drug (Figure 1A, right panel).

H2AX phosphorylation and induction of DNA double-strand breaks

Since TPT bound to topoisomerase I collides with the replication machinery, we determined

the phosphorylation level of histone H2AX. As shown in Figure 1B, in p53-/- cells we

observed strong phosphorylation of H2AX (γH2AX) already 4 h after addition of the drug, that

still increased up to 20 h after TPT exposure. In contrast, wt and apaf-1-/- cells showed only


at ASPE



ownloaded from


JPET#159962

9

weak H2AX phophorylation, indicating their ability to repair TPT-induced DNA damage and

thereby preventing from DSB formation. To substantiate that H2AX phosphorylation reflects

DSB formation, we conducted neutral single cell gel electrophoresis (“comet assay”)

experiments. A significant induction of DSBs was observed only in p53-/- fibroblasts, as

determined 24 h after addition of the drug (Figure 1C). We should note there were only a few

apoptotic cells (tail separated from the head of the comet) in the samples, which were

excluded from the analysis. From the data we infer that the high level of γH2AX in p53-

deficient cells is very likely due to the accumulation of DSBs.

Caspase-2 activation in p53-deficient cells is mediated by caspase-3

Caspase-2 can also be located in the nucleus and is supposed to be involved in the DNA

damage response (Norbury and Zhivotovsky, 2004). Therefore, we elucidated whether

caspase-2 was differently activated in p53-deficient cells, compared to the wt. Indeed, in the

TPT-sensitive p53-deficient cells caspase-2 was significantly processed: the small active

cleavage fragment (p12) appeared 16 h after addition of TPT to the medium, and further

accumulated up to 24 h, whereas it was only borderline detectable in wt cells (Figure 2A).

During apoptosis, caspase-2 is generally activated by autoprocessing (CARD-mediated,

dimerization-induced intrasubunit cleavage) but it can also be cleaved by caspase-3

(Krumschnabel et al., 2009). Since caspase-2 cleavage was not observed in apaf-1-/- cells

(Figure 2A), we inferred that caspase-2 is presumably processed downstream of caspase-9

in the TPT-triggered apoptotic pathway and hypothesized that caspase-3 might be involved.

To analyze whether caspase-3 plays a role in caspase-2 processing, we treated p53-/- cells

with TPT and made use of a specific inhibitor of caspase-3, zDEVD (DEVD). As shown in

Figure 2B (upper panel), in the presence of zDEVD the active caspase-2 fragment (p12) was

not formed, both in wt and p53-deficient cells, indicating that caspase-2 is cleaved by

caspase-3 upon TPT treatment.

Topotecan-triggered cleavage of Bid is mediated by caspase-3


at ASPE



ownloaded from


JPET#159962

10

Next we determined whether the TPT-induced processing of caspase-2 results in activation

of the pro-apoptotic BH3-only protein Bid, originally found to be a substrate of caspase-8 (Li

et al., 1998b), which was, however, not activated by TPT (Figure 4A and Supplemental

Figure 2). As shown in Figure 2A, 24 h after addition of TPT the pro-form of the Bid protein

(22 kDa) almost completely disappeared in p53-/- but not in wt and apaf-1-/- cells, indicating

possible cleavage of Bid by other caspases, e.g. by caspase-2 (Guo et al., 2002) or

caspase-3 (Slee et al., 2000). The cleavage of Bid was abrogated in the presence of zDEVD

(Figure 2B, upper panel). In addition to these inhibitor experiments we transfected p53-

deficient cells with a dominant-negative mutant of caspase-3 that yielded similar results, i.e.

abrogation of Bid cleavage (Figure 2B, lower panel). Since caspase-3 inhibition also

prevented caspase-2 activation, the obtained data could still not rule out the possibility that

caspase-2 was involved in Bid cleavage.

To determine whether Bid can be cleaved in the absence of caspase-2, we made use of

caspase-2-/- MEFs. As shown in Figure 2C, Bid was cleaved in caspase-2-/- cells (partial p53

inactivation) treated with TPT (lane 3). Moreover, in caspase-2-/- cells Bid cleavage was

significantly inhibited by co-treatment with zDEVD (DEVD; lanes 5 and 8), indicating that

caspase-3 is indeed involved in Bid cleavage. Since we learned from the above experiments

that Bid was much more effectively cleaved in cells deficient for p53, we additionally blocked

the p53 trans-activating activity in caspase-2-/- MEFs by using a transcriptional inhibitor of

p53, pifithrin-α (Pth), or knocked down p53 by transfection with p53-siRNA. In both cases

cleavage of Bid in caspase-2-/- cells could be enhanced (Figure 2C, lanes 4 and 7) compared

to MEFs treated with nonsense-siRNA (non-si) plus TPT (lane 6). We also determined the

enzymatic activity of important caspases in crude cytoplasmic extracts of caspase-2-/- cells

after treatment with TPT. As shown in Figure 2D, not caspase-8, but caspase-9 and

caspase-3 were clearly activated in caspase-2-/- cells upon TPT exposure. Also, similar to

Bid cleavage in caspase-2-/- MEFs, caspase-3 was already significantly active in cells treated

only with TPT. Its activity was significantly enhanced after co-treatment of cells with pifithrin-α


at ASPE



ownloaded from


JPET#159962

11

and was completely inhibited by zDEVD. Overall, the data suggest that in response to TPT

Bid is cleaved by activated caspase-3.

To find out whether Bid is involved in a late amplification loop of the killing response

triggered by TPT, we silenced Bid in p53-deficient MEFs by using mouse-specific Bid-siRNA.

Thereafter, cells were treated with TPT. As shown in Figure 2E (left panel), Bid was down-

regulated on protein level by ∼80% 24-72 h after Bid-siRNA transfection. Down-regulation of

Bid led to significant reduction in TPT-induced apoptosis, determined as subG1 fraction 72 h

after drug addition (Figure 2E, right panel). From this we conclude that Bid cleavage is part

of an intrinsic amplification loop in TPT-induced apoptosis.

Signaling to mitochondrial pro- and anti-apoptotic factors is p53 dependent

To elucidate the role of additional factors involved in mitochondrial apoptosis upon TPT, we

checked players known to be involved in mitochondrial permeabilization (MOMP). As shown

in Figure 3A, we observed a clear stabilization of Bax in TPT-treated p53-proficient (wt and

apaf-1-/-) MEFs and a decline in Bcl-xL in TPT-treated p53-deficient MEFs. The reduction in

Bcl-xL expression was not abrogated by the pan-caspase inhibitor zVAD (Figure 3B, upper

panel), indicating that it occurs upstream of caspase activation. Degradation of Bcl-xL was

blocked by the 26S proteasomal inhibitor MG132 (Figure 3B, lower panel). We could also

show that Bcl-2 remained unchanged in all cell lines (Supplemental Figure 3). Collectively,

the data indicate that upon TPT treatment in p53-proficient cells Bax stabilization and in p53-

deficient cells Bcl-xL degradation is responsible for MOMP induction.

Cytochrome c release and caspase activation

Next we determined cytochrome c release from mitochondria into the cytosol using purified

ultracentrifuged cytosolic extracts. As measured 16 h after addition of TPT, cytochrome c

was released in all cell lines (Figure 3C). Caspase-9 was cleaved to a similar extent in both

wt and p53-deficient cells (Figure 3D, upper panel), which coincides with the similar early

cytochrome c release observed in these cells. As expected, in TPT-treated apaf-1-/- cells

caspase-9 activation was completely abrogated. Interestingly, despite great sensitivity


at ASPE



ownloaded from


JPET#159962

12

differences towards TPT, caspase-3 was processed almost to the same extent in wt and

p53-deficient cells, although the processing occurred somewhat faster in p53-/- cells (Figure

3D, lower panel). No cleavage products of caspase-3 were observed in apaf-1-/- cells,

supporting a key role of the apoptosome in caspase-3 activation. The similar level of

cytochrome c release, caspase-9 and caspase-3 cleavage in the resistant and sensitive wt

and p53-deficient cells prompted us to determine the activity of caspases. We did not

observe any caspase-8 activity in the cell lines used with and without TPT treatment and

determined only slightly but insignificantly less activity of caspase-9 in the wt compared to

p53-/- cells (Figure 4A). A remarkable difference, however, was found for caspase-3, whose

activity was low in wt and high in p53-deficient cells (Figure 4A). From this we infer that,

although caspase-3 was well-processed in wt cells, it was not significantly active. The low

caspase-3 activity in wt cells is in line with the low killing response of these cells.

XIAP and survivin in fibroblasts and effect of their down-modulation via siRNA

It is known that caspase-3 activity can be inhibited by a group of proteins that are collectively

termed “inhibitors of apoptosis proteins” (IAPs). Therefore, we considered the hypothesis that

the enzymatic activity of caspase-3 observed in wt cells was blocked by these factors. We

determined the expression of XIAP and survivin because both were shown to directly bind

and inhibit caspase-3 (Deveraux et al., 1997; Deveraux et al., 1998; Li et al., 1998a; Li et al.,

1999). The protein level of XIAP and survivin in TPT-treated wt cells did not change,

whereas in p53-/- cells it almost completely vanished 16-48 h of treatment with the drug

(Figure 4B, left panel). We should note that the basal level of XIAP and survivin in p53-

deficient cells was even higher than in the wt. The data support the hypothesis that XIAP and

survivin inhibit caspase-3 activity in wt cells, which implicates a p53-dependent involvement

of XIAP and survivin in apoptosis regulation upon TPT. The TPT-triggered reduction in the

protein level of XIAP and survivin in p53-/- cells was due to proteasomal degradation since

the effect was reversed by MG132 (Figure 4B, right panel).


at ASPE



ownloaded from


JPET#159962

13

To determine whether down-modulation of XIAP and survivin in wt MEFs bears biological

consequences as to the end point cell death, we transfected cells with corresponding siRNA

and checked the protein expression 24 and 48 h after transfection. As shown in Figure 4C,

48 h after transfection both proteins were clearly down-regulated. Under the same

conditions, we treated cells with TPT and determined the frequency of apoptosis. As shown

in Figure 4D, transfection of either XIAP or survivin siRNA elevated the apoptotic fraction by

~50%. This supports that XIAP and survivin block TPT-induced apoptosis in p53 wt cells,

whereas their degradation in p53-deficient cells allows caspase-3 to be active executing

apoptosis.

p53, caspase-2 and Bid in human glioma cells treated with TPT

To ascertain whether the findings obtained with MEFs can be extended to human glioma

cells, for which TPT is being used in therapy, key experiments were repeated with U87MG

cells that are wt for p53. As expected, significant stabilization of p53 was observed after

exposure to TPT (Figure 5A). The experiment also shows that p53 protein can be down-

regulated by transfection with p53-siRNA; this approach was used in further experiments.

As shown in Figure 5B (upper panel), TPT treatment resulted in processing of caspase-2.

Similar to MEFs, caspase-2 processing was more efficient when p53 activity was inhibited,

which occurred by co-exposure to pifithrin-α (Pth) or by transfection with p53-siRNA.

Caspase-2 processing was completely abrogated by zDEVD, indicating that also in glioma

cells caspase-2 is cleaved by caspase-3. Further, Bid was significantly cleaved only in cells

in which p53 was inhibited or down-regulated. Bid cleavage was also inhibited by zDEVD

(Figure 5B, lower panel). Accordingly, caspase-3 activity in U87MG cells was relative

moderate. It could be significantly enhanced, however, by co-treatment with pifithrin-α or by

p53-siRNA transfection (Figure 5C). Co-treatment of p53-depleted cells with zDEVD reduced

caspase-3 activity, showing the effects are specific for caspase-3.

To determine whether the observed events bear relevance for the end point cell death, we

determined the apoptotic fraction of U87MG cells after exposure to TPT with and without


at ASPE



ownloaded from


JPET#159962

14

pifithrin-α treatment or p53-siRNA transfection. Both approaches resulted in a 50-80%

increase in the fraction of apoptotic cells (Figure 5D), confirming that p53 protects glioma

cells against TPT-induced cytotoxicity.

XIAP and survivin in p53-depleted glioma cells

To clarify whether the low caspase-3 activity and moderate apoptotic frequency in U87MG

cells exposed to TPT is related to XIAP and survivin, we determined their expression level

(Figure 6A). Similar to p53 wt MEFs, the expression of these proteins in p53-proficient

U87MG cells did not change when they were treated with TPT. It was, however, reduced

after co-treatment with pifithrin-α and when the cells were transfected with p53-siRNA,

indicating that in a p53-inactivated background XIAP and survivin become degraded in

response to the drug. This degradation was abrogated by MG132, indicating that in glioma

cells proteasomal degradation is also involved. Under p53-depleted conditions, caspase-3

activation was fully achieved (see Figure 5C). Collectively the data show that TPT-triggered

degradation of XIAP and survivin in a p53-inactivated background is a phenomenon that can

be extended to human glioma cells.

Knockdown of XIAP / survivin supports cell death of TPT-treated U87MG glioma cells

To examine whether the above described events influence TPT-triggered cytotoxicity, we

silenced XIAP and survivin in U87MG glioma cells. 48 h after siRNA transfection both

proteins were almost completely down-regulated (Figure 6B). Under the same conditions, we

treated cells with TPT and determined the apoptotic frequency. As shown in Figure 6C,

transfection of XIAP or survivin siRNA elevated the subG1 fraction of cells by ~80% in case

of XIAP siRNA, and ~60% in case of survivin siRNA (last two columns). This suggests that

XIAP and survivin are key pro-survival factors in p53 wt glioma cells, whereas their

degradation in glioma cells harboring inactive p53 supports TPT-induced apoptosis.


at ASPE



ownloaded from


JPET#159962

15

Discussion

Previously, we showed that cells expressing p53 wt are more resistant to TPT than p53-

deficient and mutated cells, which corresponded with the fate of the topo I cleavable complex

(Tomicic et al., 2005b). Here, we extended this study assessing downstream pathways of

apoptosis activated by TPT. First, we addressed caspase-2, which is the only caspase found

in the nucleus. Its function has been controversially discussed for almost a decade

(Krumschnabel et al., 2009). We show that after TPT treatment caspase-2 is processed

downstream of the apoptosome. It is more efficiently processed in p53-deficient than in

proficient cells. This implicates that it can be processed without p53-regulated PIDD

induction (Lin et al., 2000) and probably without being in the PIDDosome (Tinel and

Tschopp, 2004). The data indicate that caspase-2 cleavage occurs independent of p53 and

probably independent of the PIDD protein. This is supported by a recent finding

demonstrating that caspase-2 processing occurs without functional PIDD (Manzl et al.,

2009). We also show that inhibition of caspase-3 by zDEVD blocks caspase-2 processing

and Bid cleavage. Similar results were obtained upon transfection of a dominant-negative

mutant of caspase-3. TPT-triggered activation of caspase-2 in p53-deficient, but not in p53-

proficient cells can be explained by the finding that caspase-2 is processed by caspase-3,

which is activated only in p53-deficient cells due to down-regulation of XIAP and survivin.

The data obtained with MEFs were extended to human glioma cells that also display

caspase-3-mediated processing of caspase-2. Collectively, the results implicate a direct

involvement of caspase-3 in caspase-2 processing.

Bid is a pro-apoptotic protein that, upon activation by cleavage, translocates to mitochondria

and binds there as truncated Bid (Esposti, 2002). It can be cleaved by caspase-8 (Li et al.,

1998b), caspase-2 (Guo et al., 2002) and caspase-3 (Slee et al., 2000). We demonstrate, by

means of caspase-2-/- cells and caspase-3 inhibition, that upon TPT treatment caspase-3,

rather than caspase-2, is involved in cleavage of Bid. Caspase-8 does not participate in our

cell system in Bid cleavage since it was not active in TPT-treated cells. Thus, TPT appears


at ASPE



ownloaded from


JPET#159962

16

not to activate the caspase-8 driven pathway. Similar was reported for the topoisomerase II

inhibitor etoposide (Franklin and Robertson, 2007).

Since TPT has the ability to activate caspase-2, one might speculate that caspase-2 is

required for triggering apoptosis. This would implicate that caspase-2 lacking cells are more

resistant to TPT. This was however not the case. Caspase-2-/- MEFs (Shi et al., 2009) were

even more sensitive to TPT than the wt (data not shown). A large number of studies in

knockout and knockdown cells and with other DNA damaging agents (for review see

(Krumschnabel et al., 2009)) show that caspase-2 is not an apical caspase after DNA

damage. Recently, caspase-2 was shown to interact with DNA-PK and be involved in the

maintenance of a G2/M DNA damage checkpoint that facilitates non-homologous end joining

(Shi et al., 2009). The relevance of this finding for topoisomerase inhibitor-induced

cytotoxicity remains to be established. Nevertheless, the experiments with caspase inhibitors

and transfection of dominant-negative mutants of caspase-9 and caspase-3 in p53-/- cells,

which resulted in reduced TPT-induced apoptosis (Supplemental Figure 4), suggest that the

mitochondrial damage pathway involving caspase-9 and caspase-3, but not caspase-2 are

crucially involved in TPT-induced apoptosis.

Another part of this work focused on the regulation of the mitochondrial damage pathway in

TPT-treated cells. An unexpected finding was that in spite of a great sensitivity difference

between wt and p53-deficient cells and a high level of DNA damage (as determined by

γH2AX) in p53-deficient cells the TPT-triggered cytochrome c release and caspase-9

cleavage were nearly the same in these cells. This might be explained by upstream events:

p53-regulated stabilization of Bax in wt cells on one side, and Bcl-xL degradation in p53-/-

cells on the other, leading to a similar Bcl-xL/Bax ratio and comparable cytochrome c release.

Accordingly, the cells showed similar caspase-9 and caspase-3 processing. Despite similar

cleavage of caspase-9 and caspase-3 we found, however, only in p53-deficient cells (both

MEFs and glioma cells) caspase-3 enzyme activity. This prompted us to study in more detail

a possible involvement of IAPs in TPT-triggered apoptosis, which are known to act as

caspase-3 inhibitors. Key IAPs are XIAP and survivin that directly bind and inhibit caspase-3


at ASPE



ownloaded from


JPET#159962

17

(Deveraux et al., 1997; Deveraux et al., 1998; Li et al., 1998a; Li et al., 1999). Thus we

considered the idea that the expression of these anti-apoptotic factors could be changed

upon TPT treatment in a p53-dependent fashion. Indeed, expression of XIAP and survivin

was observed in p53 wt cells, which corresponded to a lack of caspase-3 activity. In contrast,

in p53-deficient cells XIAP and survivin became degraded upon TPT. Degradation was

blocked by proteasomal inhibitor. This was found for TPT-treated p53-/- MEFs and p53-

depleted U87MG glioma cells. The data suggest that proteasomal degradation of XIAP and

survivin results in activation of caspase-3 enzyme activity and execution of apoptosis. As a

by-product, caspase-2 becomes processed. We should note that survivin, although it can act

as IAP, also plays a role in controlling a checkpoint in the G2/M-phase thus promoting cell

division as a centromer-bound protein (Uren et al., 2000). Nevertheless, down-regulation of

XIAP and survivin in p53 MEFs and U87MG cells enhances TPT-triggered apoptosis, which

clearly indicates that TPT-induced degradation of XIAP and survivin is a key event

contributing to TPT sensitivity.

Several questions are still open and will be subject of future investigations. Thus it remains

unclear how p53 or one of its target proteins can stabilize XIAP, as a recent publication

attempted to explain (Gu et al., 2009). Apart from this, the data reported here indicate a

critical role of p53, caspase-3, Bid, XIAP and survivin in TPT-induced cell death. They

suggest a benefit of p53 mutated tumors if therapy is based on topoI inhibitors. They further

suggest that in gliomas harboring wild-type p53 TPT-based therapy might be improved by

targeted down-regulation of XIAP and survivin.

Acknowledgements

We thank Dr. Schuler (University Essen, Germany) for providing wt and apaf-1 null MEFs,

and Dr. Du (The University of Cincinnati, OH, USA) for sending us caspase-2-/- MEFs. We

also thank Dr. T. Nikolova for help with statistical analysis and Dr. W. P. Roos for critical

reading and suggestions.


at ASPE



ownloaded from


JPET#159962

18

References

Blumenthal RD, Leone E, Goldenberg DM, Rodriguez M and Modrak D (2004) An in vitro

model to optimize dose scheduling of multimodal radioimmunotherapy and

chemotherapy: effects of p53 expression. Int J Cancer 108:293-300.

Christmann M, Tomicic MT, Origer J and Kaina B (2005) Fen1 is induced p53 dependently

and involved in the recovery from UV-light-induced replication inhibition. Oncogene

24:8304-8313.

Christmann M, Tomicic MT, Roos WP and Kaina B (2003) Mechanisms of human DNA

repair: an update. Toxicology 193:3-34.

Davis PL, Shaiu WL, Scott GL, Iglehart JD, Hsieh TS and Marks JR (1998) Complex

response of breast epithelial cell lines to topoisomerase inhibitors. Anticancer Res

18:2919-2932.

Deveraux QL, Roy N, Stennicke HR, Van Arsdale T, Zhou Q, Srinivasula SM, Alnemri ES,

Salvesen GS and Reed JC (1998) IAPs block apoptotic events induced by caspase-8

and cytochrome c by direct inhibition of distinct caspases. Embo J 17:2215-2223.

Deveraux QL, Takahashi R, Salvesen GS and Reed JC (1997) X-linked IAP is a direct

inhibitor of cell-death proteases. Nature 388:300-304.

Esposti MD (2002) The roles of Bid. Apoptosis 7:433-440.

Franklin EE and Robertson JD (2007) Requirement of Apaf-1 for mitochondrial events and

the cleavage or activation of all procaspases during genotoxic stress-induced

apoptosis. Biochem J 405:115-122.

Furuta T, Takemura H, Liao ZY, Aune GJ, Redon C, Sedelnikova OA, Pilch DR, Rogakou

EP, Celeste A, Chen HT, Nussenzweig A, Aladjem MI, Bonner WM and Pommier Y

(2003) Phosphorylation of histone H2AX and activation of Mre11, Rad50, and Nbs1 in

response to replication-dependent DNA double-strand breaks induced by mammalian

DNA topoisomerase I cleavage complexes. J Biol Chem 278:20303-20312.


at ASPE



ownloaded from


JPET#159962

19

Goldwasser F, Bae I, Valenti M, Torres K and Pommier Y (1995) Topoisomerase I-related

parameters and camptothecin activity in the colon carcinoma cell lines from the

National Cancer Institute anticancer screen. Cancer Res 55:2116-2121.

Goldwasser F, Shimizu T, Jackman J, Hoki Y, O'Connor PM, Kohn KW and Pommier Y

(1996) Correlations between S and G2 arrest and the cytotoxicity of camptothecin in

human colon carcinoma cells. Cancer Res 56:4430-4437.

Gu L, Zhu N, Zhang H, Durden DL, Feng Y and Zhou M (2009) Regulation of XIAP

translation and induction by MDM2 following irradiation. Cancer Cell 15:363-375.

Guo Y, Srinivasula SM, Druilhe A, Fernandes-Alnemri T and Alnemri ES (2002) Caspase-2

induces apoptosis by releasing proapoptotic proteins from mitochondria. J Biol Chem

277:13430-13437.

Hertzberg RP, Caranfa MJ and Hecht SM (1989) On the mechanism of topoisomerase I

inhibition by camptothecin: evidence for binding to an enzyme-DNA complex.

Biochemistry 28:4629-4638.

Hsiang YH, Lihou MG and Liu LF (1989) Arrest of replication forks by drug-stabilized

topoisomerase I-DNA cleavable complexes as a mechanism of cell killing by

camptothecin. Cancer Res 49:5077-5082.

Krumschnabel G, Sohm B, Bock F, Manzl C and Villunger A (2009) The enigma of caspase-

2: the laymen's view. Cell Death Differ 16:195-207.

Lackinger D and Kaina B (2000) Primary mouse fibroblasts deficient for c-Fos, p53 or for

both proteins are hypersensitive to UV light and alkylating agent-induced

chromosomal breakage and apoptosis. Mutat Res 457:113-123.

Li F, Ackermann EJ, Bennett CF, Rothermel AL, Plescia J, Tognin S, Villa A, Marchisio PC

and Altieri DC (1999) Pleiotropic cell-division defects and apoptosis induced by

interference with survivin function. Nat Cell Biol 1:461-466.

Li F, Ambrosini G, Chu EY, Plescia J, Tognin S, Marchisio PC and Altieri DC (1998a) Control

of apoptosis and mitotic spindle checkpoint by survivin. Nature 396:580-584.


at ASPE



ownloaded from


JPET#159962

20

Li H, Zhu H, Xu CJ and Yuan J (1998b) Cleavage of BID by caspase 8 mediates the

mitochondrial damage in the Fas pathway of apoptosis. Cell 94:491-501.

Lin Y, Ma W and Benchimol S (2000) Pidd, a new death-domain-containing protein, is

induced by p53 and promotes apoptosis. Nat Genet 26:122-127.

Manzl C, Krumschnabel G, Bock F, Sohm B, Labi V, Baumgartner F, Logette E, Tschopp J

and Villunger A (2009) Caspase-2 activation in the absence of PIDDosome formation.

J Cell Biol 185:291-303.

Milosevic J, Hoffarth S, Huber C and Schuler M (2003) The DNA damage-induced decrease

of Bcl-2 is secondary to the activation of apoptotic effector caspases. Oncogene

22:6852-6856.

Miyashita T and Reed JC (1995) Tumor suppressor p53 is a direct transcriptional activator of

the human bax gene. Cell 80:293-299.

Muller M, Wilder S, Bannasch D, Israeli D, Lehlbach K, Li-Weber M, Friedman SL, Galle PR,

Stremmel W, Oren M and Krammer PH (1998) p53 activates the CD95 (APO-1/Fas)

gene in response to DNA damage by anticancer drugs. J Exp Med 188:2033-2045.

Nitiss JL and Wang JC (1996) Mechanisms of cell killing by drugs that trap covalent

complexes between DNA topoisomerases and DNA. Mol Pharmacol 50:1095-1102.

Norbury CJ and Zhivotovsky B (2004) DNA damage-induced apoptosis. Oncogene 23:2797-

2808.

Porter SE and Champoux JJ (1989) The basis for camptothecin enhancement of DNA

breakage by eukaryotic topoisomerase I. Nucleic Acids Res 17:8521-8532.

Schmidt F, Rieger J, Wischhusen J, Naumann U and Weller M (2001) Glioma cell sensitivity

to topotecan: the role of p53 and topotecan-induced DNA damage. Eur J Pharmacol

412:21-25.

Shi M, Vivian CJ, Lee KJ, Ge C, Morotomi-Yano K, Manzl C, Bock F, Sato S, Tomomori-Sato

C, Zhu R, Haug JS, Swanson SK, Washburn MP, Chen DJ, Chen BP, Villunger A,


at ASPE



ownloaded from


JPET#159962

21

Florens L and Du C (2009) DNA-PKcs-PIDDosome: a nuclear caspase-2-activating

complex with role in G2/M checkpoint maintenance. Cell 136:508-520.

Slee EA, Keogh SA and Martin SJ (2000) Cleavage of BID during cytotoxic drug and UV

radiation-induced apoptosis occurs downstream of the point of Bcl-2 action and is

catalysed by caspase-3: a potential feedback loop for amplification of apoptosis-

associated mitochondrial cytochrome c release. Cell Death Differ 7:556-565.

Tinel A and Tschopp J (2004) The PIDDosome, a protein complex implicated in activation of

caspase-2 in response to genotoxic stress. Science 304:843-846.

Tomicic MT, Bey E, Wutzler P, Thust R and Kaina B (2002a) Comparative analysis of DNA

breakage, chromosomal aberrations and apoptosis induced by the anti-herpes purine

nucleoside analogues aciclovir, ganciclovir and penciclovir. Mutat Res 505:1-11.

Tomicic MT, Christmann M and Kaina B (2005a) Apoptosis in UV-C light irradiated p53 wild-

type, apaf-1 and p53 knockout mouse embryonic fibroblasts: Interplay of receptor and

mitochondrial pathway. Apoptosis 10:1295-1304.

Tomicic MT, Christmann M and Kaina B (2005b) Topotecan-triggered degradation of

topoisomerase I is p53-dependent and impacts cell survival. Cancer Res 65:8920-

8926.

Tomicic MT, Thust R and Kaina B (2002b) Ganciclovir-induced apoptosis in HSV-1

thymidine kinase expressing cells: critical role of DNA breaks, Bcl-2 decline and

caspase-9 activation. Oncogene 21:2141-2153.

Uren AG, Wong L, Pakusch M, Fowler KJ, Burrows FJ, Vaux DL and Choo KH (2000)

Survivin and the inner centromere protein INCENP show similar cell-cycle localization

and gene knockout phenotype. Curr Biol 10:1319-1328.

Wagner S, Peters O, Fels C, Janssen G, Liebeskind AK, Sauerbrey A, Suttorp M, Hau P and

Wolff JE (2008) Pegylated-liposomal doxorubicin and oral topotecan in eight children

with relapsed high-grade malignant brain tumors. J Neurooncol 86:175-181.


at ASPE



ownloaded from


JPET#159962

22

Wischhusen J, Naumann U, Ohgaki H, Rastinejad F and Weller M (2003) CP-31398, a novel

p53-stabilizing agent, induces p53-dependent and p53-independent glioma cell

death. Oncogene 22:8233-8245.

Ziporen L, Donin N, Shmushkovich T, Gross A and Fishelson Z (2009) Programmed necrotic

cell death induced by complement involves a Bid-dependent pathway. J Immunol

182:515-521.


at ASPE



ownloaded from


JPET#159962

23

Footnotes

The work was supported by the German Research Foundation [DFG KA724] and [DFG

CH665/2-1].

Legends for Figures

Figure 1

Induction of apoptosis, H2AX phosphorylation and DNA double-strand breaks.

(A) Exponentially growing cells were exposed for 48 or 96 h to TPT. Apoptosis (% annexin V

positive cells) was determined using annexin V-FITC/PI staining combined with flow

cytometry. Necrosis (annexin V plus PI positive cells) was <5% and is not shown. Data are

the mean of three independent experiments +/- SD. (B) Cells were exposed to 1 µg/mL TPT

for 4 or 20 h, lysed in 1xSDS denaturing buffer and incubated with phosphospecific anti-

γH2AX antibody. (C) Cells were treated for 2 and 24 h with 1 µg/mL TPT and neutral comet

assay for determination of DSBs was performed. The data are the mean of three

independent experiments +/- SD. 50 randomly appearing nuclei were counted pro

experiment. ∗ p<0.05.

Figure 2

Caspase-2 processing, Bid cleavage and caspase activity.

(A, upper panel) MEFs were exposed to 1 µg/mL TPT for 16 and 24 h, whole-cell extracts

were prepared and subjected to western blot analysis with anti-caspase-2 antibody. The 12-

kDa-cleavage fragment (p12) shows a complete processing of caspase-2. (A, lower panel)

MEFs were exposed to 1 µg/mL TPT for 16 and 24h, whole-cell extracts were prepared and

subjected to western blot analysis with anti-Bid antibody. A 22-kDa protein (p22) represents

the full-length Bid. (B, upper panel) Inhibition of caspase-2 processing and abrogation of Bid

cleavage after co-treatment of wt and p53-/- cells for 24 h with TPT and a caspase-3 inhibitor

(20 µM DEVD). ERK2, loading control. C, untreated control. (B, lower panel) Abrogation of


at ASPE



ownloaded from


JPET#159962

24

Bid cleavage by transient transfection of dominant-negative caspase-3. Wt and p53-/- MEFs

were transfected with a dominant-negative mutant of caspase-3 (DN-Csp3) and 24 h later

exposed to 1 µg/mL TPT for another 24 h. Whole-cell extracts were isolated and subjected to

western blot analysis with anti-Bid antibody. A 22-kDa protein (p22) represents the full-length

Bid. ERK2, loading control. (C) Cleavage of Bid in caspase-2-/- MEFs after exposure to 1

µg/mL TPT and in combination with a p53 inhibitor, pifithrin-α (Pth), or after transfection with

p53-siRNA (p53-si); non-si, nonsense siRNA; ERK2, loading control. (D) Caspase-2-/- MEFs

were exposed to 1 µg/mL TPT for 48 h and thereafter collected for caspase activity assay.

Casp-3, caspase-3, Casp-8, caspase-8, Casp-9, caspase-9, DEVD, caspase-3 inhibitor,

LEHD, caspase-9 inhibitor, Pth, Pifithrin-α. The data are the mean of two experiments in

triplicates +/- SD. ∗p<0.05, ∗∗p<0.01, ∗∗∗p<0.001. (E, left panel) p53-/- cells were transfected

with mouse-specific Bid-siRNA, and the silencing was monitored by western blot analysis in

the subsequent 24-72 h. (E, right panel) 24 h after Bid-siRNA transfection cells were

exposed to 1 µg/mL TPT for 72 h. subG1 fraction (%) represents apoptosis. The data are the

mean of three independent experiments +/- SD. ∗∗∗p<0.001.

Figure 3

Expression of Bcl-xL, cytochrome c release and processing of caspase-9 and -3.

(A) MEFs were exposed to 1 µg/mL TPT for indicated time points. Total cell extracts were

isolated and subjected to western blot analysis with anti-Bcl-xL antibody. (B) p53-deficient

(p53-/-) MEFs were exposed to 1 µg/mL TPT for indicated time points and co-treated or not

with a pan-caspase inhibitor, 20 µM zVAD (upper panel), and a proteasomal inhibitor, 10 µM

MG132 (lower panel), respectively. Total cell extracts were isolated and subjected to western

blot analysis with anti-Bcl-xL antibody. ERK2, loading control. (C) Cytochrome c release was

determined by western blot analysis 16 h after exposure of MEFs to 1 µg/mL TPT. ERK2,

loading control; C, untreated control. (D) MEFs were exposed to 1 µg/mL TPT for indicated

times (16, 24 and 48 h). Anti-caspase-9 antibody recognizes the pro-caspase-9 (p49) and

the cleaved fragment (p39) and anti-caspase-3 antibody only the cleaved fragments (p19


at ASPE



ownloaded from


JPET#159962

25

and p17). ERK2, loading control; C, untreated control.

Figure 4

Caspase activity and modulation of apoptosis by XIAP and survivin siRNA.

(A) Exponentially growing MEFs were exposed to 1 µg/mL TPT, and 48 h later crude

cytoplasmic extracts for determination of colorimetric enzymatic activity of caspases 9, 8 and

3 were prepared. The data are the mean of three independent experiments +/- SD. ∗p<0.05,

∗∗p<0.01. (B, left panel) Cells were exposed to 1 µg/mL TPT for 16 and 48 h. Expression of

XIAP and survivin was determined by incubation with anti-XIAP and anti-survivin antibody,

respectively. ERK2, loading control; C, untreated control. (B, right panel) wt and p53-/- MEFs

were exposed to 1 µg/mL TPT for 24 h in absence or presence of a proteasomal inhibitor (10

µM MG132). Expression of XIAP and survivin was determined by incubation with anti-XIAP

and anti-survivin antibody, respectively. ERK2, loading control; C, untreated control. (C) p53

wt cells were transfected with specific siRNA oligonucleotides against XIAP and survivin,

respectively, using HiPerFect Reagent (see Methods). ERK2, loading control; C, untreated

control; non-si, nonsense siRNA. (D) Wt cells were transfected with XIAP or survivin-siRNA

and 24 h later exposed to 1 µg/mL TPT for 48 h. Annexin V positive cells (%) represent

apoptosis. The data are the mean of three independent experiments +/- SD. ∗∗p<0.01,

∗∗∗p<0.001.

Figure 5

Caspase-2 processing, cleavage of Bid, caspase activity and induction of apoptosis in

human glioma cells. (A) Exponentially growing U87MG cells were exposed for 2 h to 2 µg/mL

TPT without or with prior transfection with p53-siRNA or nonsense siRNA (non-si). Nuclear

extracts were incubated with anti-p53 mAb. ß-Actin, loading control. (B) Exponentially

growing U87MG cells were not exposed or exposed to 1 µg/mL TPT and 32 h later directly

lyzed in 1xSDS loading buffer and subjected to western blot analysis with anti-caspase-2


at ASPE



ownloaded from


JPET#159962

26

mAb (upper panel) or with anti-Bid pAb (lower panel). Casp-2 p14 (14 kDa) represents a

completely processed caspase-2. Bid p22 (22 kDa) represents the full-length protein. In

some settings cells were co-treated with 30 µM pifithrin-α (Pth) or transfected with p53-

siRNA and then exposed to 1 µg/ml TPT, or co-treated with a caspase-3 inhibitor (20 µM

zDEVD). non-si, nonsense siRNA. (C) U87MG cells were exposed to 1 µg/mL TPT for 60 h,

without or with prior p53-siRNA transfection, or co-exposed to 30 µM pifithrin-α (Pth), or co-

treated with a caspase-3 inhibitor (20 µM zDEVD). Crude cytoplasmic extracts for

determination of caspase-3 activity were prepared. The data are the mean of two

experiments in triplicates +/- SD. ∗p<0.05, ∗∗p<0.01, ∗∗∗p<0.001. (D) subG1 fraction (%

apoptotic cells) was determined by flow cytometry under the same conditions described in C.

Pth, pifithrin-α; non-si, nonsense siRNA, p53-si, p53-siRNA; DEVD, caspase-3 inhibitor. The

data are the mean of three independent experiments +/- SD. ∗∗p<0.01, ∗∗∗p<0.001.

Figure 6

Expression of XIAP and survivin, their knockdown and cell death in TPT-exposed U87MG

cells. (A) Cells were treated with 1 µg/mL TPT for 32 h and expression of XIAP and survivin

was determined using anti-XIAP and anti-survivin antibody, respectively. ß-Actin, loading

control. Where indicated, cells were co-treated with 30 µM pifithrin-α (Pth) or transfected with

p53-siRNA (p53-si), or exposed to TPT in the presence of a proteasomal inhibitor (10 µM

MG132). non-si, nonsense siRNA. (B) Exponentially growing U87MG cells were transfected

with XIAP-siRNA or survivin-siRNA using HiPerFect Reagent. ERK1/2, loading control; C,

untreated control; non-si, nonsense siRNA. (C) U87MG cells were transfected with XIAP-

siRNA or survivin-siRNA and 24 h later exposed to 1 µg/mL TPT for 48 h. Cells were

collected for subG1 flow cytometry to determine the level of apoptosis. Data are the mean of

three independent experiments +/- SD. ∗∗p<0.01, ∗∗∗p<0.001.


at ASPE



ownloaded from


Figure 1

0

20

40

60

80

100

0 1 2 3 4 5

wt

apaf-1-/-

p53-/-

TPT (µg/ml)

0

5

10

15

20

25

30

35

0 1 2 3 4 5

wt

apaf-1-/-

p53-/-

An

nex

in V

fra

ctio

n (

%)

TPT (µg/ml)

A48h 96h

H2AX

C 4 20 C 4 20 C 4 20

ERK2

TPT (h)

B C

0

5

10

15

wt con wt 2hTPT

wt 24hTPT

p53-/-con

p53-/-2h TPT

p53-/-24hTPT

apaf1-/-con

apaf1-/-2h TPT

apaf1-/-24hTPT

Oliv

e T

ail M

om

ent

wt apaf-1 -/- p53 -/-

γ

*


at ASPE



ownloaded from


Figure 2

C 24 24 C 24 24 TPT (h)

Casp2 p12

ERK2

wt p53 -/-

DEVD- - + - - +

Bid p22

ERK2

A B

CBid

Caspase-2 -/-

- - + + + + + + - + - + + - - -- - - - + - - + - - - - - + - -- - - - - - + +

ERK2

C 16 24 C 16 24 C 16 24

Casp2 p12

ERK2

Bid p22

ERK2

TPT (h)

wt apaf-1 -/- p53 -/-

TPT PthDEVD

p53-sinon-si

E

Bid p22

ERK2

wt p53 -/-

TPT- + + - + +DN-Csp3

Bid p22

ERK2

p53 -/-

C non-si 24 48 72

Su

bG

1 fr

acti

on

(%)

0

10

20

30

40

50

60

con non-si Bid-si TPT non-si+TPT

Bid-si+TPT

***p53 -/-, 72h

0

1

2

3

4

5

6

7

con TPT con TPT TPT +DEVD

TPT +Pth

con TPT TPT +LEHD

Casp-8 Casp-9Casp-3

Act

ivit

y (x

-fo

ld o

f co

ntr

ol)

Caspase-2 -/- , 48hD*

***

**

- - + - - +


at ASPE



ownloaded from


Figure 3

A

C

Bcl-xL

wt apaf-1 -/- p53 -/-

C 8 24 C 8 24 C 8 24

ERK2

TPT (h)

wt apaf-1 -/- p53 -/-

C 16 C 16 C 16

ERK2

TPT (h)

Cyt c

D

B p53 -/-

Bcl-xL

ERK2

- 8 24 8 24

- - - + +

- 4 4 8 8

- - + - +

Pro-casp9 p49Casp9 p39

ERK2

C 16 24 48 C 16 24 48 C 8 16 24 48

Casp3 p19Casp3 p17

ERK2

wt apaf-1 -/- p53 -/-

TPT (h)

TPT (h)

wt apaf-1 -/- p53 -/-

C 16 24 48 C 16 24 48 C 8 16 24 48

Bax

ERK2

TPTzVAD

MG132TPT

Bcl-xL

ERK2


at ASPE



ownloaded from


Figure 4

A

survivin

XIAP

C 16 48 C 16 48 C 16 48

wt apaf-1 -/- p53 -/-B

ERK2

TPT (h)

wt p53 -/-

C 24 24 C 24 24

MG132 - - + - - +

ann

exin

V f

ract

ion

(%

)

C survivin XIAP

ERK2

C non-si 24 48C non-si 24 48

con TPT non-si non-si XIAP-si XIAP-si Surv-si Surv-siTPT TPT

p53 wt

0

5

10

15

20

25

TPT

D

48h

*

**

*

0

1

2

3

4

5

wt con

wtTPT

apaf-1-/-con

apaf-1-/-TPT

p53-/-con

p53-/-TPT

Act

ivit

y (x

-fo

ld o

f co

ntr

ol) caspase-3

caspase-8caspase-9

*****

**


at ASPE



ownloaded from


Figure 5

0

5

10

15

20

con Pth non-si TPT TPT +Pth

TPT +p53-si

TPT +DEVD

TPT +non-si

TPT +Pth +DEVD

TPT +p53-si+ DEVD

Su

bG

1 fr

acti

on

(%

)

D

48h

p53

ß-Actin

con

TP

T

P53

-si

no

n-s

i

U87MG

0

2

4

6

8

10

con TPT TPT +DEVD

TPT +Pth

TPT +Pth +DEVD

TPT +p53-si

TPT +p53-si +

DEVD

Act

ivit

y (x

-fo

ld o

f co

ntr

ol)

A

C

60h

Pro-casp2 p48

Bid p22

ERK1/2

B

Casp2p14

U87MG

- + + - + + + + + -- - + - - + - + - -- - - + + + - - - -- - - - - - + + - -- - - - - - - - + +

U87MG

- + + - + + + + +- - + - - + - + -- - - + + + - - -- - - - - - + + -- - - - - - - - +

TPT DEVDPth

non-sip53-si

TPT DEVDPth

non-sip53-si

**

*

** * ******

*** ***

******

**

***


at ASPE



ownloaded from


Figure 6

XIAP

survivin

U87MG

ß-Actin

A

0

5

10

15

20

con non-si XIAP-si Surv-si TPT TPT +non-si

TPT +XIAP-si

TPT +Surv-si

Su

bG

1 fr

acti

on

(%

)

- + - + - + + + + +- - + + - - + - + -- - - - + + + - - -- - - - - - - + + -- - - - - - - - - +

C

ERK1/2

XIAP survivin

C non-si 24h 48h C non-si 24h 48h

B U87MG

48h

TPT MG132Pth

non-sip53-si

*****


at ASPE



ownloaded from


1 Title Page Topotecan triggers apoptosis in p53-deficient ...jpet.aspetjournals.org/content/jpet/early/2009/10/07/jpet.109.159962.full.pdf · (Tomicic et al., 2005b). Since TPT-triggered

Documents