1 Characterization of the urease operon of 2 3 4 5 6 ACCEPTED2 1 ABSTRACT 2 3 Most members of the genus Brucella show a strong urease activity. However, the 4 role of the enzyme in

Characterization of the urease operon of Brucella abortus, and assessment of its 1

role in the virulence of the bacteria. 2

3

Félix J. Sangari1, Asunción Seoane

1, María Cruz Rodríguez

1, Jesús Agüero

1,2 and Juan 4

Mª García Lobo1* 5

6

1. Departamento de Biología Molecular, Facultad de Medicina.Universidad

de Cantabria.

c/Cardenal Herrera Oria s/n, 39011 Santander, Spain.

7

2. Servicio de Microbiología. Hospital Universitario Marqués de Valdecilla 8

9

Running Title: Urease and virulence in B. abortus 10

11

12

13

14

* Correspondent footnote: 15

Dr. Juan Mª García Lobo 16

Departamento de Biología Molecular, Universidad de Cantabria. 17

C/Cardenal Herrera Oria s/n, 39011 Santander, Spain. 18

Phone: 34-942201948 19

Fax: 34-942201945 20

E-mail: [email protected] 21

ACCEPTED

Copyright © 2006, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Infect. Immun. doi:10.1128/IAI.01244-06 IAI Accepts, published online ahead of print on 13 November 2006

on July 25, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

http://iai.asm.org/

2

ABSTRACT 1

2

Most members of the genus Brucella show a strong urease activity. However, the 3

role of the enzyme in the pathogenesis of Brucella infection is poorly understood. We 4

have isolated several Tn5 insertion mutants deficient in urease activity from the B. 5

abortus strain 2308. Most of them mapped into a 5.7 Kbp DNA region essential for 6

urease activity. Sequencing of this region called ure1, revealed the presence of 7 ORFs 7

corresponding to the urease structural proteins (UreA, UreB and UreC) and the 8

accessory proteins (UreD, UreE, UreF, and UreG). In addition to the urease genes, other 9

gene (cobT) has been identified whose inactivation affected urease activity in Brucella. 10

Subsequent analysis of the published sequence of the genomes of Brucella spp 11

revealed the presence in all them of a second urease cluster, ure2. The ure2 locus was 12

apparently inactive in Brucella abortus 2308. 13

Urease deficient mutants were used to evaluate the role of urease in Brucella 14

pathogenesis. The urease producing strains were found to be resistant in vitro to strong 15

acid conditions in the presence of urea, while urease negative mutants were susceptible 16

to the acid treatment. Similarly, the urease negative mutants were killed during the 17

stomachal transit more efficiently than the urease producing strains. These results 18

suggested that urease has the role to protect Brucellae in their passage through the 19

stomach when acquired by the oral route, which is the major way of infection in human 20

brucellosis. 21 ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

3

INTRODUCTION 1

2

Brucellosis is the most common zoonosis in humans. Transmission of the disease 3

occurs mainly by inhalation of infected aerosols, animal contact and conjunctival and 4

gastrointestinal routes. The gastrointestinal route is the most common portal of entry of 5

Brucella organisms in humans through ingestion of raw milk or its products and raw 6

liver or meat (8). Transmission of Brucella melitensis, B. abortus, B. suis, and B. canis 7

among animals, also occurs by ingestion of contaminated abortions, discharge materials, 8

or contaminated pastures. On the contrary gastrointestinal transmission is not important 9

under natural conditions for B. ovis, where the sexual route of infection seems to be 10

most probable (21). Most isolates of B. ovis are urease negative (10) . 11

Urease is a multi-subunit, nickel-containing enzyme that catalyzes the hydrolysis of 12

urea to yield ammonia and carbon dioxide. The released ammonia is used by many 13

bacteria as a source of nitrogen, and even for the generation of ATP from a strong 14

ammonia gradient in the case of Ureaplasma urealyticum (38). Moreover, urease is a 15

virulence factor for several human pathogens, playing a major role in both urinary and 16

gastrointestinal tract infections, although through different mechanisms (9). In urinary 17

tract infections by Proteus mirabilis, urease promotes direct toxicity to renal epithelium 18

cells and kidney stone formation (16, 24). In gastrointestinal tract infections, urease 19

allows Helicobacter pylori colonization of the acidic environment of the stomach (23), 20

and also allows that pathogens such as Klebsiella or Yersinia enterocolitica survive 21

passage through the stomach (22 , 43). The acidic environment of the stomach caused 22

by the hydrochloric acid present in gastric secretions is known to form a barrier to 23

intestinal infection. Ingested bacteria that are able to tolerate the acidic pH typical of the 24

stomach have a better chance to survive and colonize the host. The low oral infectious 25

dose of Shigella, for example, has been related to its natural resistance to low pH (13). 26

In addition urease has been identified as an immunogenic modulator in several 27

pathogen induced inflammatory reactions (3 , 37), suggesting a role in pathogenesis 28

independent of its intrinsic enzymatic activity. 29

Bacterial ureases are usually encoded in a single operon containing the genes for the 30

three urease structural subunits (ureABC), linked to accessory genes (ureDEFG) 31

encoding proteins involved in the assembly of native urease. Genes encoding for 32

transcription regulators and urea transporters may also be part of bacterial urease 33

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

4

operons (25). Incorporation of nickel into urease is a complex process involving several 1

proteins. At the same time, the metal transporters and chelating proteins involved in 2

nickel homeostasis may affect urease activity. As a consequence, mutations in many 3

genes outside the urease operon may result in urease deficient phenotypes (17, 18). 4

Bacteria of the genus Brucella (except B. ovis) usually exhibit a characteristic strong 5

urease activity (8). The properties of this enzyme, as well as its significance in Brucella 6

metabolism or pathogenicity, remain basically unexplored. In this work, we have 7

obtained urease-deficient mutants of B. abortus, cloned the urease genes, constructed 8

urease negative mutants, and analyzed the role of urease in B. abortus infection. 9

10

11

MATERIALS AND METHODS 12

13

14

Bacterial strains and growth conditions. The bacterial strains and plasmids used in 15

this study are listed in Table 1. B. abortus strains were grown in Brucella broth (BB) or 16

Brucella agar (BA) plates (Pronadisa, Spain). Escherichia coli strains were grown in 17

Luria-Bertani broth (LB) or plates (LA). When required, media were supplemented with 18

the following antibiotics: kanamycin 50 µg/ml, ampicillin 100 µg/m, nalidixic acid 15 19

µg/ml. Intestinal homogenates were plated in BA plates made selective with Brucella 20

Selectavial (MAST Diagnostics, UK), (BAF). 21

To determine its effect on urease production BB was supplemented with ammonium 22

chloride up to 200 mM or urea up to 5 mM. 23

24

Random transposon mutagenesis and isolation of urease mutants. Transposon 25

mutagenesis was performed as previously described (34). Urease mutants were selected 26

using the Urea-indole medium (Institut Pasteur Production, France). The wild type strain 27

2308, used as a control, turned the medium from orange to pink in just 15 min at room 28

temperature. Mutants that failed to turn the color of the medium in that time frame were 29

selected for further analysis. 30

31

Recombinant DNA techniques and sequencing. Chromosomal DNA from B. abortus 32

strains was purified by the guanidinium thiocyanate method of Pitcher et al. (29). 33

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

5

Construction of plasmids, restriction enzyme analysis, agarose gel electrophoresis, and 1

Southern hybridizations were carried out by standard molecular biology protocols (33). 2

Chromosomal DNA PCR templates were obtained from single colonies by using 3

InstaGene matrix as described by the supplier (Bio-Rad Laboratories, United Kingdom). 4

2 µl of the resulting solution were used in 50 µl PCR reactions, including 0.5 u of Taq 5

DNA polymerase, 10 pmol of each primer, and 10 pmol of each deoxynucleoside

6

triphosphate. The PCR conditions used were 30 cycles of denaturation at 94°C for 30 s, 7

annealing at 55°C for 30 s, and elongation at 72°C for 2 min. 8

DNA sequencing data were obtained in an automatic Vistra DNA sequencer 725. 9

Database searches and sequence alignments were performed at the National Center for 10

Biotechnology Information (NCBI), using the BLAST network service. 11

12

Construction of mutants by homologous recombination. In order to construct a 13

stable urease mutant, oligonucleotides UreC#1.F: CTCAACCATCCCGAAGCCATCG 14

and UreC#1.R: CCGTTTTCCAGCGTGATGGC were used to amplify a region of 2,556 15

bp comprising the complete ureC1 gene. A PCR fragment of the expected size from the 16

B. abortus strain 2308 was gel-purified and cloned into pGEM®-T Easy (Promega, 17

Madison,WI) resulting in plasmid pFJS110. An internal Eco RV fragment of 732 bp 18

from ureC1 was removed giving plasmid pFJS111. The deleted region includes the 19

sequence that codifies for the substrate binding site, and most of the residues putatively 20

involved in the nickel metallocenter (28). The insert contained in pFJS111 was 21

sequenced to verify that no extra mutation was present, and that the deletion had taken 22

place keeping the reading frame. A 1,858 bp NotI fragment, containing ∆ureC1, was 23

extracted from pFJS111 and subcloned into pJQ200uc1, producing pFJS112. The B. 24

abortus mutant strain carrying the deleted ureC1 gene was obtained in a two step 25

process, as described (28). In a first step pFJS112 was mobilized to B. abortus strain 26

2308 from E. coli strain S17-1 ( -pir), and transconjugants selected in BAF 27

supplemented with gentamycin. Colonies growing in this medium represented single 28

cross-over events. Five of these colonies were pooled and grown in BB. 108 cfu were 29

plated in BA plus 5% sucrose. Sucrose resistant colonies were selected and analyzed by 30

PCR with the primers UreC#1.F and UreC#1.R to detect the deletion of the internal 31

EcoRV fragment within ureC1. A smooth colony with the deletion (2308∆ureC1) was 32

selected for further work. 33

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

6

Similarly, oligonucleotides UreC#2.F :CGACATTCCCGCCAATACCG and 1

UreC#2.R: GGTCGAGCACAAGCCAATCG were used to clone a 2,131 bp fragment 2

including the ureC2 gene, producing plasmid pFJS113. The resulting insert was 3

completely sequenced to verify the construction as mentioned above. An internal NcoI 4

fragment was deleted to produce plasmid pFJS114. The mutated ureC2 fragment was 5

cloned as a PstI/XhoI insert into pJQ200SK, producing pFJS115, that was used to 6

mutate the gene ureC2 as described above. 7

8

Measurement and characterization of urease activity. Urease activity was 9

determined by measuring the amount of ammonia released from urea per unit of time. 10

Crude extracts containing urease were prepared as follows: Exponential cultures of 11

bacteria were recovered by centrifugation, washed and resuspended in PBS to a 12

concentration of 108 CFU/ml. They were lysed for 3 cycles of 10 s in a FastPrep System 13

(BIO101, Vista, CA, USA) at the maximum setting, cooled on ice, and centrifuged for 5 14

minutes at 14,000 rpm at 4oC to remove cell debris. Crude extracts were aliquoted and 15

stored at –80°C until used. For standard urease reactions 5-10 µl of the extracts were 16

added to a tube containing 200 µl of 50 mM urea in PBS, and incubated for 5 min at 37º 17

C. The amount of ammonia released from urea hydrolysis was determined 18

colorimetrically by the modified Berthelot reaction (35).The ODs of the samples were 19

determined at 595 nm. The amount of ammonia present was then inferred from a

20

standard NH4Cl concentration curve. Total protein concentration was measured by a 21

Bradford assay (6). 22

Urea Km of B. abortus urease was calculated from a Lineweaver-Burk plot of the 23

initial reaction rates obtained in standard assays with urea concentrations ranging 24

between 0.5 and 50 mM. To determine urease optimal pH, phosphate buffer at pHs 25

varying from 5.5 to 8.0 were used. Urease activity was expressed in µmol of urea 26

hydrolyzed per minute per milligram of protein. 27

28

In vitro susceptibility of Brucella to acid pH. B. abortus strains were grown in BB 29

until the end of the exponential phase, washed in sterile water and resuspended at a 30

concentration of 109 CFU/ml in citrate buffer pH 2.0 or phosphate-buffer pH 4.0 for 30 31

min in the presence or absence of different concentrations of urea. Bacteria were washed 32

three times in normal PBS, and survivors counted after dilution and plating (20). 33

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

7

Competitive mice infection assay. Balb/c mice (CRIFA, Spain) were infected with a 1

1:1 mixture of B. abortus 2308 (wild type) and the mutants, to minimize animal to 2

animal variation. 200 µl of a suspension containing approximately 1010

bacteria were 3

administered orally to groups (n=5) of 5-6 week-old female Balb/c mice that were 4

previously fasted for 6 hours. Mice were sacrificed 90 minutes after inoculation, and the 5

terminal ileum (around 15 cm) was removed aseptically and homogenized with 5 ml of 6

BB containing 20% glycerol. Samples were serially diluted and plated by triplicate in 7

BAF plates supplemented and not with the appropriate antibiotic. 8

9

Nucleotide sequence accession number. The nucleotide sequence data reported in this 10

paper have been submitted to GenBank and assigned accession number AF361941. 11

12

Statistical analysis. Statistical analysis was performed using Prism3, version 3.0 13

(GraphPad Software, San Diego, CA). Statistical significance was calculated using 14

either a nonparametric Mann-Whitney test or an unpaired t test. A P value <0.05 was 15

considered statistically significant. 16

17

18

RESULTS 19

20

21

Characterization and regulation of urease activity. Crude cell extracts of B. abortus 22

2308 were used to determine the urease kinetic parameters. Km for urea was found to be 23

13.44 ± 0.8 mM (mean value of 5 determinations ± standard deviation) and the activity 24

was found to be maximal at pH 7.3 (Fig. 1). To determine the factors that control urease 25

expression in B. abortus, we analyzed the effect of nitrogen availability on urease 26

production by adding increasing concentrations of ammonium chloride to bacteria 27

growing in BB medium. Urease activity decreased along with the increase in added 28

ammonium chloride (Fig. 2). Furthermore, urease production was found to be 29

independent on the presence of urea in the culture medium. 30

31

Production of transposon mutants in B. abortus 2308. The initial screening of B. 32

abortus 2308 carrying transposon insertions identified 7 mutants with different levels of 33

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

8

urease activity. Six mutants were negative after one week incubation and one of them 1

sowed some activity in one week (the control 2308 was positive in 15 min at room 2

temperature). Southern hybridization of the genomic DNA of the mutants indicated that 3

they contained a single copy of the Tn5 and that all but one clustered in the same 4

chromosomal region (Fig. 3). 5

One of the mutants that remained negative after 1 week incubation, BAM723, was 6

selected to clone and sequence the affected genes. 7

8

Subcloning and sequencing of a B. abortus urease gene cluster. The kanamycin 9

resistance encoded by Tn5 was used to clone the transposon and flanking DNA from the 10

urease negative mutant BAM723 into plasmid pBluescript SKII. A large EcoRI 11

fragment around 35 kb long containing Tn5 was obtained in the recombinant plasmid 12

pCRIS that was further subcloned to facilitate DNA sequence analysis. 13

A total of 5.7- Kbp of DNA was sequenced which revealed 7 potential open reading 14

frames (ORFs) after translation of both strands. They corresponded to the conserved 15

structural proteins UreA, UreB and UreC, as well as the accessory proteins UreD, UreE, 16

UreF and UreG (Fig. 3). The genes encoding these proteins were all transcribed in the 17

same direction and they were each preceded by sites similar to the E. coli consensus 18

ribosome-binding (Shine-Dalgarno) sequence. Furthermore, a sequence 19

(TGTcGGgACtctcgTTGCAgcG) similar to the consensus σ54

promoter 20

(NrYTGGCACG[N4]TTGCWNNw) (2) was found (nucleotides 220 to 241) upstream 21

of the ureD ATG start codon. This could be the promoter for the urease operon. A 22

putative transcriptional terminator was found between ureA and ureB (nucleotides 1,508 23

to 1,537), although no sequence resembling a promoter could be found in that region. 24

This structure points out to the existence of two possible transcriptional units, ureDA 25

and ureBCEFG, although this would need further analysis. Shortly after the stop codon 26

for ureG there is a sequence corresponding to a half copy of the palindromic repeated 27

DNA element of Brucella Bru-RS2 (14), and a putative Arg t-RNA(ACG) gene (5,631-28

5,700). Both features will give a strong secondary structure in the mRNA that could 29

serve as a transcriptional termination signal. 30

The nucleotide sequence of the cloned genome segment containing Tn5 from mutant 31

BAM723, showed that the transposon was inserted at nucleotide position 280 of the 32

determined sequence (Fig. 3). This position corresponded to the 5’ untranslated 33

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

9

sequence upstream of ureD. This insertion completely abolished the formation of active 1

urease in mutant BAM723. 2

The only Tn5 insertion with the urease activity affected that mapped out of this ure1 3

region was localized in the cobT gene by sequencing of the neighboring DNA. 4

Nicotinate mononucleotide (NaMN):5,6-dimethylbenzimidazole (DMB) 5

phosphoribosyltransferase (CobT) plays a central role in the synthesis of -ribazole-5'-6

phosphate, an intermediate for the lower ligand of cobalamin (40).The cobalamin is the 7

largest and most complex cofactor found in biological systems. 8

9

Construction of urease deletion mutants of B. abortus 2308 by gene replacement. 10

A stable mutant carrying a deletion in the gene ureC1, was constructed as described in 11

the Methods section. This mutant, 2308∆ureC1, carried an in frame deletion affecting 12

to 244 aminoacids of the UreC1 polypeptide. 13

2308∆ureC1 showed a stable urease negative phenotype. Both, the mutant and the 14

parental strain, showed identical growth patterns, indicating that the disrupted gene was 15

not required for normal cell functions. 16

During this study the complete sequence of Brucella melitensis strain 16M was 17

published (12) and it was followed by the sequences of B. suis (27) and B. abortus 18

strains 9-941 (15) and 2308 (7) . The published sequences confirmed our findings and 19

showed the presence of a second urease locus (ure2) in the large chromosomes of the 20

three species. To determine the functionality of ure2 we constructed a mutant from 21

strain 2308 carrying a deletion in the ureC2 gene. 2308∆ureC2 had the same urease 22

activity than the parental strain. This result, altogether with the complete lack of urease 23

activity in the ureC1 mutants, clearly indicated that the ure2 locus locus did not show 24

any measurable phenotype under these experimental conditions. 25

26

In vitro Susceptibility to acid of the urease mutants. Since during gastrointestinal 27

infection Brucella spp must be able to survive the passage through the stomach before 28

invading the host, the ability of B. abortus to survive exposure to acid was investigated 29

in the presence or absence of urea. B. abortus 2308 (urease-positive strain) and the 30

urease mutants BAM723, 2308∆ureC1 and 2308∆ureC2 were exposed to different 31

acid conditions in the presence or absence of urea. As shown in Figure 4, B. abortus 32

2308 strain and all the mutants tested survived equally well the exposure to pH 4.0 for 33

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

10

30 minutes, independently of the presence or absence of urea. However, they showed a 1

marked decrease in survival when they were exposed to pH 2.0. When urea was 2

incorporated in the assay buffer, the wild type strain and the 2308∆ureC2 mutant 3

showed a dose dependent increase in survival as compared to the urease negative 4

strains. At the end of the assays, buffer pH values were determined, remaining in all 5

cases very close to the initial values (data not shown). 6

7

Virulence analysis. The virulence of the urease mutants was compared to the parental 8

strain in a macrophage survival assay and by intraperitoneal injection of the bacteria in 9

mice. The urease mutants showed the same behavior than the parental strain in the two 10

models (data not shown). Based on these data, we concluded that urease does not play 11

any role in these models of infection. 12

To investigate if urease could play a role in establishment of the infection by B. 13

abortus when the bacteria were administered by the oral route we determined the level 14

of survival after transit though the stomach. The assay was made on BAM723 mutant 15

and the 2308∆ureC1 and 2308∆ureC2 mutants. In the case of BAM723, we used Km as 16

selection. In order to have a selectable marker for the deletion mutants, we introduced 17

first the plasmid pBBR1MCS (19) by conjugation from S17-1 (pBBR1MCS). The 18

transconjugants were selected in BAF Cm plates. A 1:1 mixture of B. abortus 2308 and 19

each urease mutant was given orally to mice. 20

In order to allow bacterial passage through the stomach, mice were sacrificed 90 21

minutes after infection and bacteria from the terminal ileum were plated on media with 22

or without antibiotic to compare the numbers of urease negative mutants (antibiotic 23

resistant) and parental bacteria (antibiotic susceptible). 24

In vitro competitive growth experiments were carried out first to verify that strains 25

did not have defects in growth under normal laboratory conditions. The mutants did not 26

show any deficiency when grown in vitro in the presence of the wild-type strain. The 27

competitive index (CI) was calculated as the output ratio of mutant to wild type bacteria 28

divided by the input ratio of mutant to wild type. In general terms, bacterial mixtures 29

recovered after stomach passage were enriched around ten times in urease producing 30

bacteria (Figure 5). In other words, greater than 90% of the Brucella colonies which 31

survived stomachal transit were identified as B. abortus 2308. 32

Southern blot analysis of DNA of bacteria surviving transit through the stomach 33

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

11

provided further confirmation of the correct identification of the mutants (data not 1

shown). 2

3

4

DISCUSSION 5

6

7

Most Brucella isolates show a potent urease activity that has been hypothesized to 8

play a role in the pathogenesis of the disease (39). However, the role of this enzyme in 9

virulence has not yet been explained. Furthermore some isolates as the well known 10

laboratory strain B. abortus 544 are urease negative, while they seem to retain most of 11

their pathogenic potential. In order to gain insight in the function of Brucella urease, we 12

first determined the Km for urea and optimal pH of the urease enzyme. The 13.4 mM 13

value observed for the urea Km did not fit neither with the low Km observed in ureases 14

with a role in nitrogen assimilation nor with the high Km values often displayed by 15

uropathogens. However, urease activity in Brucella was dependent on the nitrogen 16

(ammonium chloride) availability in the culture medium, being maximal in the absence 17

of added ammonium chloride and practically disappeared when the concentration of 18

ammonium was above 100 mM. This down regulation of urease expression by high-19

quality nitrogen sources such as ammonia is found in other bacteria, like Klebsiella 20

aerogenes, and suggests a role for the urease in the assimilation of nitrogen (25) from 21

urea or at least some dependence with the nitrogen metabolism in Brucella. 22

Regarding the pH, urease activity of B. abortus was optimal near neutrality (pH 7,3). 23

The urease produced by H. pylori has also a neutral pH optimum and this 24

urease activity is essential for survival at the extreme pH of the stomach. The neutral pH 25

optimum of ureases indicate that even when they have to deal with extreme pH values, 26

the bacterial cytoplasm does not vary its pH, remaining in the neutral physiological 27

values required for most bacterial processes. 28

The Tn5 insertion mutants affected in urease activity allowed us the cloning and 29

sequencing of an urease operon from B. abortus. Our data, later confirmed by whole 30

genome sequencing, revealed an operon with the organization ureDABCEFG common 31

to many bacteria (25). We have predicted the presence of a promoter of the σ54 type for 32

the Brucella urease operon. This could indicate that urease expression in Brucella is 33

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

12

under the control of a system analog to the Ntr of the enteric bacteria that responds to 1

nitrogen availability and takes advantage of the alternative sigma factor σ54 (32). This 2

type of regulation would also explain the observed dependency of urease expression on 3

ammonium concentration in the growth medium. 4

Whole genome sequencing revealed the presence of a second urease operon (ure2) 5

with all their genes potentially active in B. suis and B. melitensis. On the other hand , B. 6

abortus presented two -1 frameshifting deletions in ureE2 and B. ovis presented 7

deletions in ureG2 and ureT. These data would support our results indicating that ure2 8

did not contribute towards the urease activity of B. abortus 2308. Unpublished work 9

from our laboratory showed that ureC1 mutants of other Brucella strains were also 10

urease negative, suggesting additional reasons for the lack of urease activity from the 11

ure2 locus in Brucella. 12

Sequence comparison and phylogenetic analysis of Brucella ure genes indicated that 13

the ure2 operon clustered with the ure genes from Yersinia rather than with Brucella 14

ure1 or ure genes from other α-proteobacteria. The differences between Brucella ure1 15

and ure2 not only affected nucleotide sequence, gene order was also different and a 16

putative urea transporter was additionally present in ure2. These differences argue 17

against a duplication as the origin of ure2, and rather suggest that this locus may have 18

been acquired via a lateral transfer event. ureC2 was expressed under normal growth 19

conditions, as seen by real time RT-PCR (data not shown), and although no contribution 20

towards urease activity could be measured in this study, we can not discard the 21

possibility that it carries out some function that grants its maintenance in the Brucella 22

genome. 23

Urease is a complex enzyme that requires an elaborated pathway to assemble in its 24

active form. It was then not surprising to find mutations producing an urease deficient 25

phenotype that mapped outside the ure genes. It has been already reported that 26

mutations in a nickel transport system in B. suis and Actinobacillus pleuropneumoniae 27

produced an urease deficient phenotype (4, 17). In this report, we found an additional 28

locus, cobT , which was required for maintaining the urease-positive phenotype in B. 29

abortus. Until now, we ignore the reason for the lack of urease activity of this mutant. 30

One of the proposed roles of Brucella urease in pathogenicity was thought to be the 31

inhibition of phagosome acidification by ammonia release. However, we did not 32

observe any difference between the wild type and urease mutant strains when compared 33

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

13

in a macrophage survival assay or after intraperitoneal infection in mice. Moreover, 1

Porte et al. (30) have shown that at the early stage of phagocytosis, neutralization of 2

intraphagosomal pH by addition of ammonium chloride can be detrimental for Brucella. 3

Most of the available evidence indicated that urease does not play a significant role in 4

the intracellular survival of Brucella. 5

The most common route of infection of brucellosis in humans is through the 6

gastrointestinal tract. The ability of a pathogen to resist killing in the acidic environment 7

of the stomach increases the likelihood of intestinal colonization and invasion. The low 8

pH of the gastric juices has been suggested to play a role in the prevention of Brucella 9

infection, while proton pump inhibitors, antacids and other drugs that decrease gastric 10

acidity have been implicated in foodborne brucellosis (42).Urease has been involved in 11

the survival of bacteria in their transit through the acid contents of the stomach in a 12

number of bacterial pathogens, like H. pylori or Y. enterocolitica (11). Accordingly, we 13

decided to examine the role of urease in a model of intragastric inoculation in mice. 14

Since previous experiments had shown that there was a noticeable variation from mice 15

to mice, we choose to inoculate mixed cultures into individual mice rather than use 16

different groups of mice for each strain, thus reducing individual differences to a 17

minimum. Using this model, we have demonstrated a competitive deficiency of the 18

urease mutants BAM723 and 2308∆ureC1compared to the wild type bacteria in the 19

passage through the stomach of mice. The same pattern of acid sensitivity in vitro and 20

attenuation in the mouse oral model has been observed for ureC1 mutants of B. abortus 21

S19, B. melitensis Rev1 and B. suis 1330 (unpublished results). The transit time 22

through the stomach of a liquid feed mouse can be estimated in 15minutes (26). Then, 23

the acid exposure conditions used in this work were milder than the acid stress suffered 24

by Brucella in the passage through the stomach of a healthy human that are pH below 3 25

and gastric transit time of 2 hours (11) or the abomasum of a ruminant (41) . This 26

difference reinforces the importance of urease in the establishment of Brucella 27

alimentary infections in humans. 28

B. ovis is the only urease negative Brucella species. Transmission of B. ovis between 29

animals occurs mainly by the sexual route. The scarce importance of oral transmission 30

for B. ovis could be a consequence of its lack of an active urease, stressing the role of 31

this enzyme in the oral transmission of Brucella. 32

Recently it has been described that urease could also contribute to the establishment 33

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

14

of A. pleuropneumoniae infections in pigs through the respiratory tract (5). If this 1

mechanism is also operative in Brucella, then urease negative mutants could be not only 2

deficient to establish infection by the digestive route by also through aerosol inhalation, 3

the two main routes of Brucella infection in humans. In addition the B. melitensis 4

vaccine strain Rev.1 is known to be secreted into the milk of vaccinated animals, 5

constituting a major route of transmission to humans (1). According to this, the 6

introduction of mutations abolishing urease activity in vaccine strains could be an 7

additional procedure to improve safety of Brucella vaccines by minimizing the 8

possibility of human infection. 9

10

11

ACKNOWLEDGMENTS 12

13

This work was supported by grants BIO2004-06117 from the Spanish “Ministerio de 14

Educación y Ciencia” and PI052499 from the “Instituto de Salud Carlos III”. 15

MCR was recipient of a scholarship from the Fundación Marqués de Valdecilla-16

IFIMAV. 17

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

15

REFRERENCES 1

2

1. Banai, M. 2002. Control of small ruminant brucellosis by use of Brucella 3

melitensis Rev.1 vaccine: laboratory aspects and field observations. Veterinary 4

Microbiology. 90:497-519. 5

2. Barrios, H., B. Valderrama, and E. Morett. 1999. Compilation and analysis of 6

sigma(54)-dependent promoter sequences. Nucleic Acids Res. 27:4305-4313. 7

3. Beswick, E. J., I. V. Pinchuk, K. Minch, G. Suarez, J. C. Sierra, Y. 8

Yamaoka, and V. E. Reyes. 2006. The Helicobacter pylori Urease B Subunit 9

Binds to CD74 on Gastric Epithelial Cells and Induces NF-{kappa}B Activation 10

and Interleukin-8 Production. Infect. Immun. 74:1148-1155. 11

4. Bosse, J. T., H. D. Gilmour, and J. I. MacInnes. 2001. Novel Genes Affecting 12

Urease Activity in Actinobacillus pleuropneumoniae. J. Bacteriol. 183:1242-13

1247. 14

5. Bosse, J. T., and J. I. MacInnes. 2000. Urease activity may contribute to the 15

ability of Actinobacillus pleuropneumoniae to establish infection. Can. J. Vet. 16

Res. 64:145-150. 17

6. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of 18

microgram quantities of protein utilizing the principle of protein-dye binding. 19

Anal. Biochem. 72:248-254. 20

7. Chain, P. S. G., D. J. Comerci, M. E. Tolmasky, F. W. Larimer, S. A. 21

Malfatti, L. M. Vergez, F. Aguero, M. L. Land, R. A. Ugalde, and E. Garcia. 22

2005. Whole-genome analyses of speciation events in pathogenic Brucellae. 23

Infect. Immun. 73:8353-8361. 24

8. Chomel, B. B., E. E. DeBess, D. M. Mangiamele, K. F. Reilly, T. B. Farver, 25

R. K. Sun, and L. R. Barrett. 1994. Changing trends in the epidemiology of 26

human brucellosis in California from 1973 to 1992: a shift toward foodborne 27

transmission. J. Infect. Dis. 170:1216-1223. 28

9. Collins, C. M., and S. E. D'Orazio. 1993. Bacterial ureases: structure, 29

regulation of expression and role in pathogenesis. Mol. Microbiol. 9:907-913. 30

10. Corbel, M. J., and D. M. Hendry. 1985. Urease activity of Brucella species. 31

Res. Vet. Sci. 38:252-253. 32

11. De Koning-Ward, T. F., and R. M. Robins-Browne. 1995. Contribution of 33

urease to acid tolerance in Yersinia enterocolitica. Infect. Immun. 63:3790-3795. 34

12. DelVecchio, V. G., V. Kapatral, R. J. Redkar, G. Patra, C. Mujer, T. Los, N. 35

Ivanova, I. Anderson, A. Bhattacharyya, A. Lykidis, G. Reznik, L. 36

Jablonski, N. Larsen, M. D'Souza, A. Bernal, M. Mazur, E. Goltsman, E. 37

Selkov, P. H. Elzer, S. Hagius, D. O'Callaghan, J. J. Letesson, R. Haselkorn, 38

N. Kyrpides, and R. Overbeek. 2002. The genome sequence of the facultative 39

intracellular pathogen Brucella melitensis. Proc. Natl. Acad. Sci. U S A. 99:443-40

448. 41

13. Gorden, J., and P. L. Small. 1993. Acid resistance in enteric bacteria. Infect. 42

Immun. 61:364-367. 43

14. Halling, S. M., and B. J. Bricker. 1994. Characterization and occurrence of 44

two repeated palindromic DNA elements of Brucella spp.: Bru-RS1 and Bru-45

RS2. Mol. Microbiol. 14:681-689. 46

15. Halling, S. M., B. D. Peterson-Burch, B. J. Bricker, R. L. Zuerner, Z. Qing, 47

L. L. Li, V. Kapur, D. P. Alt, and S. C. Olsen. 2005. Completion of the 48

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

16

genome sequence of Brucella abortus and comparison to the highly similar 1

genomes of Brucella melitensis and Brucella suis. J. Bacteriol. 187:2715-2726. 2

16. Johnson, D. E., R. G. Russell, C. V. Lockatell, J. C. Zulty, J. W. Warren, 3

and H. L. Mobley. 1993. Contribution of Proteus mirabilis urease to 4

persistence, urolithiasis, and acute pyelonephritis in a mouse model of ascending 5

urinary tract infection. Infect. Immun. 61:2748-2754. 6

17. Jubier-Maurin, V., A. Rodrigue, S. Ouahrani-Bettache, M. Layssac, M. A. 7

Mandrand-Berthelot, S. Kohler, and J. P. Liautard. 2001. Identification of 8

the nik gene cluster of Brucella suis: regulation and contribution to urease 9

activity. J. Bacteriol. 183:426-434. 10

18. Kim, J. K., S. B. Mulrooney, and R. P. Hausinger. 2005. Biosynthesis of 11

active Bacillus subtilis urease in the absence of known urease accessory proteins. 12

J. Bacteriol. 187:7150-7154. 13

19. Kovach, M. E., R. W. Phillips, P. H. Elzer, R. M. Roop, 2nd, and K. M. 14

Peterson. 1994. pBBR1MCS: a broad-host-range cloning vector. Biotechniques 15

16:800-802. 16

20. Krishnamurthy, P., M. Parlow, J. B. Zitzer, N. B. Vakil, H. L. Mobley, M. 17

Levy, S. H. Phadnis, and B. E. Dunn. 1998. Helicobacter pylori containing 18

only cytoplasmic urease is susceptible to acid. Infect. Immun. 66:5060-5066. 19

21. Madkour, M. M. 1989. Brucellosis. Butterworths, London ; Boston. 20

22. Maroncle, N., C. Rich, and C. Forestier. 2006. The role of Klebsiella 21

pneumoniae urease in intestinal colonization and resistance to gastrointestinal 22

stress. Res. Microbiol. 157:184-193. 23

23. Marshall, B. J., L. J. Barrett, C. Prakash, R. W. McCallum, and R. L. 24

Guerrant. 1990. Urea protects Helicobacter (Campylobacter) pylori from the 25

bactericidal effect of acid. Gastroenterology. 99:697-702. 26

24. Mobley, H. L., G. R. Chippendale, K. G. Swihart, and R. A. Welch. 1991. 27

Cytotoxicity of the HpmA hemolysin and urease of Proteus mirabilis and 28

Proteus vulgaris against cultured human renal proximal tubular epithelial cells. 29

Infect. Immun. 59:2036-2042. 30

25. Mobley, H. L., M. D. Island, and R. P. Hausinger. 1995. Molecular biology of 31

microbial ureases. Microbiol. Rev. 59:451-480. 32

26. Moreto, M., L. Guzman, and A. Diez. 1982. A pattern for gastric emptying in 33

mice. Am. J. Physiol. 242:G333-336. 34

27. Paulsen, I. T., R. Seshadri, K. E. Nelson, J. A. Eisen, J. F. Heidelberg, T. D. 35

Read, R. J. Dodson, L. Umayam, L. M. Brinkac, M. J. Beanan, S. C. 36

Daugherty, R. T. Deboy, A. S. Durkin, J. F. Kolonay, R. Madupu, W. C. 37

Nelson, B. Ayodeji, M. Kraul, J. Shetty, J. Malek, S. E. Van Aken, S. 38

Riedmuller, H. Tettelin, S. R. Gill, O. White, S. L. Salzberg, D. L. Hoover, 39

L. E. Lindler, S. M. Halling, S. M. Boyle, and C. M. Fraser. 2002. The 40

Brucella suis genome reveals fundamental similarities between animal and plant 41

pathogens and symbionts. Proc. Natl. Acad. Sci. U S A. 99:13148-13153. 42

28. Pelicic, V., J. M. Reyrat, and B. Gicquel. 1996. Generation of unmarked 43

directed mutations in mycobacteria, using sucrose counter-selectable suicide 44

vectors. Mol. Microbiol. 20:919-925. 45

29. Pitcher, D. G., N. A. Saunders, and R. J. Owen. 1989. Rapid extraction of 46

genomic DNA with guanidinium thiocyanate. Lett. Appl. Microbiol. 8:151-156. 47

30. Porte, F., J. P. Liautard, and S. Kohler. 1999. Early acidification of 48

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

17

phagosomes containing Brucella suis is essential for intracellular survival in 1

murine macrophages. Infect. Immun. 67:4041-4047. 2

31. Quandt, J., and M. F. Hynes. 1993. Versatile suicide vectors which allow 3

direct selection for gene replacement in gram-negative bacteria. Gene. 127:15-4

21. 5

32. Reitzer, L. 2003. Nitrogen assimilation and global regulation in Escherichia 6

coli. Annu. Rev. Microbiol. 57:155-176. 7

33. Sambrook, J., T. Maniatis, and E. F. Fritsch. 1989. Molecular cloning : a 8

laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, 9

N.Y. 10

34. Sangari, F., and J. Agüero. 1991. Mutagenesis of Brucella abortus: 11

comparative efficiency of three transposon delivery systems. Microb. Pathog. 12

11:443-446. 13

35. Senior, B. W., N. C. Bradford, and D. S. Simpson. 1980. The ureases of 14

Proteus strains in relation to virulence for the urinary tract. J. Med. Microbiol. 15

13:507-512. 16

36. Simon, R., U. Priefer, and A. Pühler. 1983. A broad host range mobilization 17

system for in vivo genetic engineering, transposon mutagenesis in Gram negative 18

bacteria. Bio/Technology. 1:784-791. 19

37. Skurnik, M., S. Batsford, A. Mertz, E. Schiltz, and P. Toivanen. 1993. The 20

putative arthritogenic cationic 19-kilodalton antigen of Yersinia enterocolitica is 21

a urease beta-subunit. Infect. Immun. 61:2498-2504. 22

38. Smith, D. G., W. C. Russell, W. J. Ingledew, and D. Thirkell. 1993. 23

Hydrolysis of urea by Ureaplasma urealyticum generates a transmembrane 24

potential with resultant ATP synthesis. J. Bacteriol. 175:3253-3258. 25

39. Smith, L. D., and T. A. Ficht. 1990. Pathogenesis of Brucella. Crit. Rev. 26

Microbiol. 17:209-230. 27

40. Trzebiatowski, J. R., G. A. O'Toole, and J. C. Escalante-Semerena. 1994. 28

The cobT gene of Salmonella typhimurium encodes the NaMN: 5,6-29

dimethylbenzimidazole phosphoribosyltransferase responsible for the synthesis 30

of N1-(5-phospho-alpha-D-ribosyl)-5,6-dimethylbenzimidazole, an intermediate 31

in the synthesis of the nucleotide loop of cobalamin. J. Bacteriol. 176:3568-32

3575. 33

41. Wittek, T., K. Schreiber, M. Furll, and P. D. Constable. 2005. Use of the D-34

xylose absorption test to measure abomasal emptying rate in healthy lactating 35

Holstein-Friesian cows and in cows with left displaced abomasum or abomasal 36

volvulus. J. Vet. Intern. Med. 19:905-913 37

42. Young, E. J. 2000. Brucella species, p. 2053-2060. In G. L. Mandell, J. E. 38

Bennett, and R. Dolin (ed.), Mandell, Douglas, and Bennett's principles and 39

practice of infectious diseases, 4th ed. Churchill Livingstone, Philadelphia. 40

43. Young, G. M., D. Amid, and V. L. Miller. 1996. A bifunctional urease 41

enhances survival of pathogenic Yersinia enterocolitica and Morganella 42

morganii at low pH. J. Bacteriol. 178:6487-6495. 43

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

18

Table 1. Bacterial strains and plasmids used in this study 1

2

3

Plasmid or strain Characteristics Source or

reference

Plasmids

pBluescript SK II+ Cloning vector Stratagene

pCRIS 35 kb EcoRI genomic fragment from 2308 ure1::Tn5

cloned in pBluescript SK II+

This work

pJQ200uc1 Broad-host-range mobilizable suicide vector; Gmr (31)

pJQ200SK Broad-host-range mobilizable suicide vector; Gmr (31)

pFJS110 2,556 bp fragment containing ureC1 cloned into

pGEM®-T Easy

This work

pFJS111 pFJS110 with an EcoRV deletion of 732 bp (∆ureC1) This work

pFJS112 1,858 bp NotI fragment from pFJS111 containing

∆ureC1 cloned into pJQ200uc1

This work

pFJS113 2,131 bp fragment containing ureC2 cloned into

pGEM®-T Easy

pFJS114 pFJS113 with an EcoRV deletion of 732 bp (∆ureC2)

pFJS115 1,433 bp NotI fragment from pFJS111 containing

∆ureC1 cloned into pJQ200SK

pGEM®-T Easy

pBBR1MCS

PCR cloning vector

Broad host range plasmid

Promega

(19)

Bacterial strains

E. coli

S17-1 (λ-pir) Mobilizing donor for conjugation (36)

DH5α Standard E. coli cloning strain Gibco BRL

B. abortus

2308 Virulent laboratory strain

BAM723 Strain 2308 ure1::Tn5 This work

2308∆ureC1 This work

2308∆ureC2 This work

4

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

19

LEGENDS TO THE FIGURES. 1

2

Figure 1. Optimum pH of urease activity. Brucella protein extracts were assayed for 3

urease activity in different buffer conditions ranging from pH 5.5 to pH 8. Experiment 4

was performed three times by duplicate. Each point in the graph is the arithmetic mean 5

of the six independent experimental values. Error bars show the standard deviation of 6

the data.Urease activity is expressed as µmols of urea hydrolyzed per minute and per mg 7

of protein. 8

9

Figure 2. Urease activity in the presence of ammonium chloride. B. abortus 2308 10

cultures were grown in BB in the presence of different amounts of added ammonium 11

chloride , and their urease activity was measured. The activity is represented as 12

percentage over the maximum activity, that was obtained when no ammonium chloride 13

was added to the media. The experiment was performed by triplicate with three 14

technical measures per replica. The data shown correspond to the media of the 15

experiments and the error bar indicates the standard deviation. . 16

17

Figure 3. Map of the ure1 and ure2 cluster region. The boxes represent the ORFs, 18

dark boxes represent the structural genes, and the open ones represent the accessory 19

genes. The striped bars under ureC indicate the sequence deleted in the mutants 20

2308∆ureC1 and 2308∆ureC2. The location of Tn5 insertion in mutant BAM723 is 21

indicated with an arrow. 22

23

Figure 4. Survival of B. abortus 2308 and urease mutants to acid exposure. Bacteria 24

were resuspended in buffer at pH 4.0 (A), or buffer at pH 2.0 (B), in the presence of 25

different amounts of urea (expressed in mM). After 30 minutes of incubation at 37oC, 26

bacteria were diluted and plated to count for survivors. The arithmetic media from three 27

separate experiments was plotted with standard deviations. An umpaired t-test was 28

performed to determine if survival of each strain was signicantly different than the 29

corresponding wild type control. * indicates p < 0.05. 30

Color code to strains: Light grey: BAM723; white: 2308∆ureC1, dark grey: 2308; 31

and black bars 2308∆ureC2. 32

33

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

20

Figure 5. Survival of the urease mutants after transit through mice stomach. A 1:1 1

mixture of 2308 and the corresponding urease mutant was given orally to groups of 5 2

mice, and the experiment was performed two times. The figure shows the competitive 3

index of the three mutants with the wild type strain 2308 from one of the experiments. 4

The bars show the standard deviation of the data. The mouse competitive index assay 5

was analyzed with a nonparametric Mann-Withney test using log transformed 6

competitive indexes to determine if the indexes were significantly different than one. 7

* indicates p < 0.05. 8

Grey bars: BAM723/2308; white bars: 2308∆ureC1/2308, and black bars 9

2308∆ureC2/2308.10

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

Ure

ase

act

ivit

y

0

0.5

1.0

1.5

2.0

pH

5 6 7 8

Figure 1, Sangari et al.

ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

NH

4C

l (m

M)

100 %

60 %

25 %

12 %

0

50

100

200

Activity %


ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

ureD

ureA

ureB

ureC

ureE

ureF

ureG

HincII

HindIII

BglII

ClaI

ClaI

HincII

NruI

NruI

PvuII

PvuII

EcoRV

EcoRV

EcoRV

ureA

ureB

ureE

ureC

ureF

ureG

ureD

Urea

tran

spo

rter

HindIII

BglII

ClaI

ClaI

HindIII

NcoI

EcoRI

PvuII

NcoI

NcoI

EcoRI

1 k

b

Fig

ure 3

, San

gari

et a

l.

ACCEPTED on July 25, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

Lo

g n

um

ber

of

surv

ivo

rs

0

2

4

6

8

A

Lo

g n

um

ber

of

surv

ivo

rs

0

2

4

6

8

Inoculum 0 mM 5 mM 10 mM

B

Inoculum 0 mM 5 mM 10 mM


ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

0

0.4

0.6

0.8

1

CI

0 90 Time (m)

0.2


ACCEPTED


.org/D

ownloaded from

http://iai.asm.org/

1 Characterization of the urease operon of 2 3 4 5 6 ACCEPTED2 1 ABSTRACT 2 3 Most members of the genus Brucella show a strong urease activity. However, the 4 role of the enzyme in

Documents