ОПШТИНА КАРПОШ ОПШТИНА КАРПОШ Одделение за детска, социјална и здравствена заштита Department for Children, Social and Health care Сектор за дејности од јавен интерес Sector for activities of public interest S S S S S S S Se e e e ec c c c ct t t t t t to o o o o or r r r r r f f f f f f fo o o or r r r r a a a a a ac c c c c ct t t t t t t ti i i i i i i iv v v vi i i i i i it t t ti i i i ie e e es s s o o o o of f f f f f f p p pu u u u u ub b b b b b b b bl l l l l l l li i i i i i i ic c c c c i i i i i i i i in n n n nt t t t t t t te e e er r r r re e e e es s s s s st t t t t t t t MUNICIPALITY OF KARPOSH MUNICIPALITY OF KARPOSH
9
Embed
Брошура на Одделението за детска, социјална и здравствена заштита 2013
Брошура на Одделението за детска, социјална и здравствена заштита 2013
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
ОПШТИНА КАРПОШ ОПШТИНА КАРПОШ
Одделение за детска, социјална и здравствена заштита
Department for Children, Social and Health care
Сектор за дејности од јавен интерес
Sector for activities of public interest SSSSSSSSeeeeeccccctttttttoooooorrrrrr ffffffffoooorrrrr aaaaaaccccccttttttttiiiiiiiivvvviiiiiiittttiiiiiieeeesss ooooofffffff pppuuuuuubbbbbbbbblllllllliiiiiiiiccccc iiiiiiiiinnnnntttttttteeeerrrrreeeeessssssttttttttMUNICIPALITY OF KARPOSH MUNICIPALITY OF KARPOSH
3 ДЕКЕМВРИ - Дружење на лица со хендикеп
3 December—Association of person with persons with handicap
Сите сме исти. Сакаме да бидеме љубени и да љубиме, но и да ја споделиме грижата меѓусебно. За некои наши сограѓани таа е попотребна од вообичаено. Карпош, токму нив, никогаш не ги заборава.
We are all the same. We want to be loved and to love, and to share mutual concern too. For some of our fellow citizens this care is more necessary from usual. Karposh, precisely this, never forgets.
Хуманитарни акции - мото „Да бидеме хумани за нашите соседи“ Humanitarian activities - motto” Let be humane for our neighbors”
Една стара поговорка вели: ,,Раката што дава не се суши“. Соседот е тука до нас, и во добро и во лошо. Општина Карпош организира традиционални акции трипати годишно: за Денот на Општината, за Нова година и за Велигден. Во тие денови, соседите си подаваат рака преку собирање прехранбени и хигиенски производи.
One old proverb says: “The hand which gives don’t dries”. The neighbor is here to us in good and bad. Municipality of Karposh organizes traditional activities three times a year: For the Day of Municipality, for New Year and For Easter. On that day, neighbors give their hands each other through gathering food and hygienic products.
Љубовта е милосрдност, грижа, заземање за некого. Општина Карпош, за Денот на вљубените, посебно место им отстапува на осамените и на старите лица. Со посета на Геронтолошкиот завод „Мајка Тереза“ и со традиционалниот заеднички ручек се дружиме со нив и им го разубавуваме овој ден.
The love is a mercy, care, taking care for somebody. Municipality Kar-posh, for the Valentine’s Day give a special place to lonely and old per-sons. We socialize with them through visiting of institute” The Mother Teresa” and through traditional together meal with which that day we make this day more beautiful.
Почит кон осамените лица од третото доба A respect to lonely persons from the third age
Заедништво, еднаквост, почит. Тоа се трите начела на кои почива мултиетничкиот соживот и традиција на нашата Општина. Секоја година Општина Карпош го одбележува Ѓурѓовден, големиот празник на Ромите. Тогаш сите пееме, се дружиме и се забавуваме. Празник на душата.
Community, equality, respect. This is the three principles on that rest multiethnic coexistence and tradition of our Municipality. Every year Municipality Karposh celebrates St, George the great holiday of the Gypsies. On that day we sing, fellowship and we have a fun. It’s a holiday of the soul.
Меѓуетничко дружење и почит кон традицијата
Interethnic friendship and respect of tradition
Децата се нашата најголема радост, нашата најголема грижа. Здраво детство значи создавање здрава иднина во која треба да се вложува.
Преку контролата на храната со имплементирање на НАССР-системот во сите детски установи го докажуваме токму тоа. Ние сме единствена членка на EHEDG (Европското тело за хигиенски инженеринг и дизајн) во светот од Македонија.
Грижа за децата преку контрола и безбедност на храната Care for children through control and safety of the food
Children are our biggest happy and our biggest care. Healthy childhood means creating healthy future in which we need to invest.
Through controlling of the food and with implementa-tion of HACCP- system in all child’s institutions we prove just that. We are the only member EHEDG (Eu-ropean body for hygienic engineering and design) in the world from Macedonia.
Montessori- implementation in the kindergartens Децата учат, децата се дружат. Нивните први чекори во образованието се истапкани по светски патеки, според врвните дострели во педагогијата и воспитувањето. Во дел од градинките од Карпош успешно се имплементира програмата „Монтесори“.
The children learn how to socialize. Their fi rst steps in the educa-tion are walked through world paths, under the top achievements in the pedagogy and education. In some kindergartens in Karposh, the program Montessori is success-fully implemented.
Монтесори-имплементација во градинките
Човекољубието е добра волја да му се помогне на својот близок. Тоа е активен напор да се промовира човековата благосостојба. Тоа е постојана грижа за другите, за послабите, за изнемоштените. Нам тоа не ни е тешко и го правиме во континуитет. Токму затоа, Општина Карпош е прогласена за лидер во филантропија во изминатата 2012 година.Ние сме благодарни.Тоа е чест, гордост и наша обврска.
The philanthropy is good-will to help to your close. It is an active effort to promote the human welfare. It is an con-stant care for the others, for the weaker and for the frail. It is not hard for us and we do it continu-ously. Therefore, Municipality of Karposh is declared as a leader in philanthropy in the past 2012 year.We are grateful.It is an honor, pride and our ob-ligation.
Награда за филантропија и општествена одговорност за 2012 година
A prize for philantropy and socially responsibility for 2012 year
Изработиле:
Гордана С. ЗафировскаМ-р Ирена МилевскаСектор за дејности од јавен интерес
Одделение за односи со јавноста
Графички дизајнИва МановаЈоана СтаниќОдделение за односи со јавноста
Prepared by:
Gordana S.Zafi rovskaMr.sci. Irena MilevskaSector for activities of public interest
Layout designIva ManovaJoana StanikDepartment of Public Relations