© 2008 Nathan Weinstockufdcimages.uflib.ufl.edu/UF/E0/02/22/24/00001/weinstock_n.pdf · including Post-Traumatic Stress Disorder, anxiety disorders and eating disorders. Our current

1

EFFECTS OF SOCIAL DEFEAT STRESS ON CONNEXIN36 GENE EXPRESSION IN THE AMYGDALA

By

NATHAN WEINSTOCK

A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT

OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE

UNIVERSITY OF FLORIDA

2008

2

© 2008 Nathan Weinstock

3

To my Mom, Dad, and Sister.

4

ACKNOWLEDGMENTS

I would like to thank my committee members Dr. Mohamed Kabbaj, Dr. Neil Rowland,

and Dr. Sue Semple-Rowland. I would especially like to thank my advisor, Dr. Darragh Devine,

for his guidance, patience and support.

5

TABLE OF CONTENTS page

ACKNOWLEDGMENTS ...............................................................................................................4

LIST OF TABLES...........................................................................................................................6

LIST OF FIGURES .........................................................................................................................7

ABSTRACT.....................................................................................................................................8

CHAPTER

1 INTRODUCTION ..................................................................................................................10

2 METHODS.............................................................................................................................16

Animals...................................................................................................................................16 Drugs.......................................................................................................................................16 Surgical Procedures ................................................................................................................17 Experimental Procedures ........................................................................................................17

Social Dominance Training.............................................................................................17 Social Defeat Stress Experiment .....................................................................................18

Behavioral Assays ..................................................................................................................19 Gene Assays............................................................................................................................19 Statistical Analyses.................................................................................................................23

3 RESULTS...............................................................................................................................25

Social Defeat Experiment .......................................................................................................25 Gene Assays............................................................................................................................28

4 DISCUSSION.........................................................................................................................33

APPENDIX RAW ΔCT VALUES............................................................................................38

LIST OF REFERENCES...............................................................................................................39

BIOGRAPHICAL SKETCH .........................................................................................................45

6

LIST OF TABLES

Table page 2-1 Schedule of social defeat stress exposure by group...........................................................24

2-2 Forward and reverse primer sequences for connexin36 and GAPDH...............................24

7

LIST OF FIGURES

Figure page 3-1 Social defeats per daily experimental session....................................................................26 

3-2 Effects of social defeat stress exposure on glandular masses. ...........................................27 

3-3 Localization of amygdala micropunches. ..........................................................................29 

3-4 The RNA-denaturing formaldehyde-agarose gel...............................................................30 

3-5 Assessment of primer specificity. ......................................................................................31 

3-6 Social defeat stress increases expression of Cx36 mRNA in the amygdala. .....................32 

8

Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the

Requirements for the Degree of Master of Science

EFFECTS OF SOCIAL DEFEAT STRESS ON CONNEXIN36 GENE EXPRESSION IN THE AMYGDALA

By

Nathan Weinstock

May 2008

Chair: Darragh P. Devine Major : Psychology

Major depression is a debilitating emotional disorder, affecting millions of Americans

annually. It is characterized by the loss of interest or pleasure in nearly all activities for a period

of at least two weeks. A preponderance of individuals with major depression report a

considerable amount of emotional stress in their lives in the form of significant daily hassles and

aversive major life events. These individuals also suffer from a variety of co-morbid disorders

including Post-Traumatic Stress Disorder, anxiety disorders and eating disorders. Our current

understanding of the etiology of major depression underscores the significance of emotional

stress in conferring vulnerability to developing this devastating disorder. These emotional

stressors are processed by limbic circuits that are capable of undergoing plastic alterations in a

variety of mechanisms that determine the strength of neuronal signaling. One potential

mechanism is altered gene expression of the protein sub-units of gap junctions, known as

connexins. Connexin gene expression is altered by withdrawal from chronic cocaine or

amphetamine self-administration. Furthermore, rats treated with a gap junction antagonist, and

connexin knockout mice, both exhibit impairments in standard tests of learning and memory. In

the present study, we investigated changes in connexin gene expression as a potential mechanism

contributing to limbic plasticity during social defeat stress.

9

For social defeat stress exposure, “intruder” male rats were each subjected to a larger

dominant “resident” male rat until the intruder was defeated. This interaction proceeded for 5

min or until the intruder displayed the defeated, submissive posture three times. The intruder

was then placed into a double-layered wire mesh cage and returned, in the protective cage, into

the resident’s home cage. This interaction proceeded until 10 min had elapsed from the start of

the social defeat session. The experimental rats were exposed to only one social defeat session

(acute) or to six sessions (repeated) with a different resident for each session. Control rats were

not exposed to social defeat stress. All the rats were terminated 2 hours after their final social

defeat session or at an equivalent time for the unstressed controls. The brains were then

dissected out and flash frozen. Punches were collected from the amygdala, homogenized, and

processed by RT-PCR to assay the expression of connexin36 (Cx36) mRNA.

Overall, the repeatedly stressed rats but not the acutely stressed rats exhibited an

upregulation of Cx36 mRNA expression in the amygdala. This experiment provides evidence

that amygdaloid Cx36 expression is implicated in the brain-altering effects of repeated emotional

stress. However, further characterization will be needed to examine the impact of this altered

gene regulation on protein expression and function, and to identify the potential impact of

alterations of connexins in determining the affective state of the animal.

10

CHAPTER 1 INTRODUCTION

Major depression is a pervasive and debilitating emotional disorder, affecting 14 million

American adults annually (Kessler et al., 2003b). The fourth edition of the Diagnostic and

Statistical Manual of Mental Disorders (DSM-IV, 1994) defines major depression by the

presence of a depressed mood or loss of interest or pleasure in nearly all activities for a period of

at least two weeks. These mood alterations often occur in conjunction with severe changes in

appetite accompanied by weight disturbances, sleep abnormalities, fatigue, feelings of

worthlessness, and a diminished ability to think or concentrate. In order to be diagnosed with

major depressive disorder, the DSM-IV specifies that the patient must present with symptoms

that generate a significant amount of distress or impairment in all aspects of daily life (DSM-IV,

1994). A preponderance of these individuals with major depression also report a considerable

amount of emotional stress in their lives in the form of significant daily hassles and aversive

major life events (Cummins, 1990). These set-backs often result in considerable difficulty

functioning socially, occupationally, or in other important areas (DSM-IV, 1994). Individuals

with major depression also suffer from a variety of co-morbid disorders such as Post-Traumatic

Stress Disorder (PTSD), anxiety disorders, eating disorders, and phobias (Aina et al., 2006;

Vieweg et al., 2006; Woodside et al., 2006; Kessler et al., 2003a). Drugs that increase the levels

of serotonin and norepinephrine in the synapse can be effective for the treatment of major

depression (for review, see Nemeroff, 2007), indicating that these systems may be altered in

individuals with this disorder (for review, see Ressler and Nemeroff, 2000). From an economic

standpoint the impact of major depression is also staggering. The loss of labor attributable to

depression costs an estimated 44 billion dollars annually (Greenberg, 2005).

11

Since emotional stress is an important trigger for the etiology of affective disorders

(Kendler et al., 1995; for review see, Hayley et al., 2005), it is important to understand the

biochemical changes that occur during stress exposure, as these changes may play important

roles in the etiology of major depression and other related psychopathologies. Stress is defined

as the physiological reaction caused by an aversive or threatening situation (Herman and

Cullinan, 1997). One way the body responds to acute stress exposure is by increasing the

activity of the sympathetic nervous system, which is essential for the mobilization of systems

required for energy -intensive behaviors (for review, see Smith and Vale, 2006). Once the

perceived stressor has subsided, activity of the parasympathetic nervous system is increased to

help restore homeostatic balance (for review, see McEwen, 2006). Another physiological

response to stress is increased activity of the Hypothalamic Pituitary Adrenal (HPA) axis

(Herman and Cullinan, 1997) in response to inputs from the brainstem, cortex, and limbic

system. These inputs converge on the dorso-medial parvocellular neurons, within the

paraventricular nucleus of the hypothalamus (PVN), stimulating the release of corticotropin

releasing hormone (CRH). Under basal conditions a small portion of these CRH-containing

neurons express arginine vasopressin (AVP) mRNA. After repeated stress, the number of AVP-

expressing neurons is elevated so that the co-localization of CRH and AVP mRNAs increases as

much as 5-fold (Albeck et al., 1997; Amaya et al., 2000; Aubry et al., 1999; Bartanusz et al.,

1993; de Goeij et al., 1992). CRH and AVP are then co-released by the parvocellular neurons

into the hypophyseal portal system, at the median eminence, where they activate the anterior

pituitary gland (for review, see Whitnall, 1993; Herman et al., 2002). At the anterior pituitary

CRH stimulates the release of adrenocorticotropic hormone (ACTH) into the bloodstream, while

AVP serves to enhance the CRH function in a synergistic manner (Gillies et al., 1982). ACTH

12

then acts by stimulating the adrenal cortex to synthesize and release glucocorticoids. One

glucocorticoid (cortisol in humans and corticosterone in rats) is involved in the regulation of a

variety of bodily processes including energy allocation, digestion, and immune function.

Cortisol also activates the negative feedback regulation of the HPA axis that attenuates the

system after stimulation by stress (for review, see Whitnall, 1993).

The stressors that activate the HPA axis can be defined as systemic and processive.

Systemic stressors are those that pose an immediate physiological threat to tissue and organ

systems. Common systemic stressors are exposure to extreme temperatures and food or fluid

deprivation. Information regarding systemic stressors is relayed directly to the PVN of the

hypothalamus via brainstem catecholaminergic projections. Lesion studies have shown that

responses to this type of stressor are not affected by an insult to the limbic system. Processive

stressors are stimuli that are generally not an immediate threat to homeostasis but they require

interpretation by higher brain structures and are perceived as stressful based on comparisons to

previous experiences. Common examples of processive stressors are social instability and the

perceived loss of control over one’s environment. Processive stressors are distinguished from

systemic stressors because they process signals from multiple sensory modalities. Information

regarding processive stressors is relayed indirectly to the PVN of the hypothalamus through

cortical and limbic structures such as the prefrontal cortex, amygdala, and bed nucleus of stria

terminalis. Lesion studies have shown that HPA responses to this type of stressor are affected by

an insult to the limbic system (Herman and Cullinan, 1997).

Chronic changes in HPA axis functioning are often found in individuals with major

depression and related disorders. Individuals diagnosed with major depression show increased

levels of CRH mRNA in the PVN (Arborelius et al., 1999) as well as increased levels of CRH in

13

the cerebrospinal fluid (Arborelius et al., 1999; Nemeroff et al., 1984). The majority of these

individuals also display elevated daily cortisol levels (Gold et al., 1986; Arborelius et al., 1999),

indicating that HPA axis activity has increased. Furthermore, individuals diagnosed with major

depression that are responsive to anti-depressant treatment frequently exhibit a return to baseline

HPA axis functioning (Gold et al., 1986; Amsterdam et al., 1988; Nemeroff et al., 1991). It has

been hypothesized that early-life stress coupled with chronic emotional stress may provide the

appropriate neuroplastic foundation for the development of HPA axis dysregulation and the

manifestation of major depression (for review, see Mello et al., 2003). Furthermore, HPA axis

dysregulation and concomitant depressive-like behaviors are seen in non-human primates who

have a history of early-life stress (Arborelius et al., 1999).

The limbic system appears to be dysregulated as a result of stress and limbic dysfunction is

thought to lead to dysregulation of the HPA axis. However, the mechanism by which emotional

stress alters specific limbic nuclei resulting in the dysregulation of this axis is unknown. One

way to examine this phenomenon is to expose rats to processive stressors. In the present study

we utilized a processive stress regimen known as social defeat stress. In the social defeat stress

procedure a young naїve male rat is exposed to a larger dominant male rat until the naїve male is

defeated. Social interactions such as these result in the activation of limbic structures in rats as

evidenced by increases in expression of the immediate early gene, c-fos, in the hypothalamus,

septum, and amygdala (Martinez et al., 1998; Nikulina et al., 2004; Chung et al., 1999). Social

defeat stress also activates the HPA axis of the defeated, male rats as indicated by increases in

the levels of circulating ACTH (Ebner et al., 2005) and CORT (Wommack and Delville, 2003;

Covington and Miczek, 2001) following exposure. The impact on limbic functioning coupled

14

with the observable changes in endocrine measures suggests that the limbic system may undergo

plastic changes as a result of exposure to repeated social defeat stress.

We are using the social defeat model to study alterations in gap junction gene expression

as a candidate mechanism for this limbic plasticity. Initially, gap junctions were known to exist

only among invertebrates and were thought to offer a mechanism of information signaling

between neurons that was primitive and much simpler than the complex chemical synapses (for

example, see Hand and Gobel, 1972; for review, see Söhl et al., 2005). Now, gap junctions have

been reported to be both present and of functional significance, throughout the mammalian brain,

in both neurons and glia (for review, see Nagy et al., 2004). Gap junctions form hydrophilic

channels that directly couple adjacent cells and allow the passage of ions, nutrients, small

intracellular metabolites, and small cell-signaling molecules, less than 1 kDa in size (for review,

see Söhl et al., 2005). Each gap junction is formed by apposing cells creating a narrow 2-3 nm

gap (Kumar and Gilula, 1996). They are composed of two-hemichannels, one pre-synaptic and

one-postsynaptic, each called a connexon. Each connexon is made up of six homomeric or

heteromeric subunits called connexins (Cx) (for review, see Hormuzdi et al., 2004). There have

been 20 distinct connexins identified in the mouse and 21 in the human genome (for review, see

Söhl and Willecke, 2003). The number of connexins in the rat is expected to be similar to that of

the mouse, although they have not been as completely catalogued. The members of this

multigene family are distinguished by their molecular mass (e.g. Cx32, Cx36, where the

molecular mass is indicated in kDa) (for review, see Söhl and Willecke, 2003). Each connexin

consists of two extracellular domains, four hydrophobic membrane-spanning domains, and three

cytoplasmic domains, as well as an intracellular loop, and amino and carboxy termini (for

review, see Wei et al., 2004). The regulation of gap junction channels is dynamic and can occur

15

in response to various stimuli including changes in voltage, extracellular calcium concentration,

pH, and protein phosphorylation (Harris 2001). For example, when cytoplasmic Ca2+

concentration is low the gap junction channel opens, and conversely, if cytoplasmic Ca2+

concentration is high (in the micromolar range) the gap junction channel closes (for review, see

Wei et al., 2004). Connexin gene mutations have been implicated in a variety of human diseases

including cardiovascular disorders, deafness, skin disorders, cataracts, and peripheral

neuropathies (for review, see Wei et al., 2004). The behavioral consequences of functioning gap

junctions have been studied in relation to learning and memory. The gap junction antagonist

carbenoxolone blocked learning and memory in the Morris Water Maze (Hosseinzadeh et al.,

2005) and Cx36 knockout mice were impaired in the Y-maze as well as on an object recognition

task (Frisch et al., 2005), suggesting that these channels may contribute to plasticity.

However, the role of gap junctions has not been studied in stress-induced limbic plasticity.

Therefore, we are examining the potential that altered connexin gene expression is implicated in

social defeat stress-induced changes in limbic functioning.

16

CHAPTER 2 METHODS

Animals

Sixteen male Long Evans (LE) rats (Harlan, Indianapolis, IN) weighing 225-250 g were

housed in a climate-controlled vivarium with a 12-hour light/dark schedule (lights on at 7 a.m.

daily). These rats were used as “intruders” (see Experimental Procedures). The rats were

allowed ad libitum access to standard laboratory chow (Lab Diet 5001) and tap water. Upon

arrival the rats were pair-housed in standard polycarbonate cages (43 x 21.5 x 25.5 cm) and

allowed to acclimate to the housing facility for 7 days before any experimental or surgical

procedures were initiated. An additional eleven male LE rats weighing 300-325 g and an

additional eleven female LE rats weighing 200-225 g were pair-housed with gender-matched

conspecifics for 7 days. These rats were later used as “residents” (see Experimental Procedures).

Four more male LE rats weighing 250-275 g were pair-housed and used as intruders to train the

resident males to exhibit dominant behavior (see Experimental Procedures). All the animal care

procedures were pre-approved by the University of Florida Institutional Animal Care and Use

Committee and were performed in accordance with the National Research Council’s Guide for

the Care and Use of Laboratory Animals.

Drugs

The anesthetics ketamine, xylazine, and Aerrane (99% isoflurane) were purchased from

Henry Schein Inc. (Melville, NY). The ketamine and xylazine were combined to yield a solution

containing 83.3% ketamine : 16.7% xylazine (w/v). The analgesic Ketorolac tromethamine (30

mg/ml), a non-steroidal anti-inflammatory drug, was also obtained from Henry Schein Inc.

17

Surgical Procedures

The resident rats (325-355 g at the time of surgery) were vasectomized under ketamine-

xylazine anesthesia (62.5 mg/kg ketamine + 12.5 mg/kg xylazine, i.p. in a volume of 0.75

ml/kg). If supplementary anesthesia was necessary during surgery, a gauze pad was soaked with

AErrane and placed in a nose cone approximately 23 mm away from the rat’s snout. Ketorolac

tromethamine (2 mg/kg s.c.), was administered for analgesia at the time of surgery.

Each anesthetized rat was shaved from the rostral edge of the scrotal area to the caudal

abdomen. Following sterilization of the surgical area a 1 cm incision was made near the midline

of the abdomen, which terminated caudally near the base of the penis. The vas deferens was

then isolated with forceps, and a 0.5 cm section was removed from each duct with the aid of a

miniature cautery utensil. The internal incision was sutured with absorbable 4-0 “Ethilon”

monofilament vicryl suture (Ethicon Inc.) and the external incision was closed with 9 mm

stainless steel wound clips (World Precision Instruments Inc.) which were then removed 7 days

subsequent to surgery. Each surgical procedure lasted 15-25 min.

Experimental Procedures

Social Dominance Training

Prior to the onset of the social defeat sessions the vasectomized resident male rats were

pair-housed with the female rats for two weeks. During this time the male residents were trained

and screened for characteristic territorial dominance behavior. At the beginning of each training

session each female resident was removed from the home cage and placed in a similar cage

nearby. Ten min after removal of the female an intruder was placed into the resident’s home

cage. Each male resident was trained to exhibit characteristic dominance behavior. The

residents and intruders were allowed to interact for 5 min or until the intruder displayed a

submissive posture three times. This constituted the direct interaction phase. An intruder was

18

considered to be defeated when it displayed a submissive posture by lying motionless in the

supine position, with the resident on top of it, for a period of at least two sec. Precautions were

taken to ensure the safety of the intruder rats. If a resident bit the intruder, the intruder was

promptly removed and the direct interaction phase of that session was immediately terminated.

The residents that consistently defeated the intruders at least 2 times in each of the seven training

sessions were used for the experiment. From the initial eleven male residents used in the

screening procedure six were retained for use in the social defeat experiment.

Social Defeat Stress Experiment

Sixteen naïve male Long Evans rats were utilized as intruders for the social defeat stress

experiment. The procedure consisted of two phases of resident-intruder interaction. The first,

the direct interaction phase, was conducted in exactly the same manner as the training sessions,

with each intruder exposed to a different resident during every social defeat session. Following

the conclusion of every direct interaction phase each intruder was removed from the home cage

of the resident, placed into a separate 10cm x 10cm x 15cm (inner dimensions) double-layered

wire mesh cage and returned, in this protective cage, into the home cage of the resident. Once

the intruder was returned to the resident’s cage the second phase of the procedure, the indirect

interaction phase, was initiated. In the indirect interaction phase the intruder remained in the

stressful environment without the possibility of direct contact by the resident. The intruder was

maintained in the wire mesh cage until 10 min had elapsed from the start of the direct interaction

phase. After the entire 10 minute interaction (i.e. total of direct and indirect phases) had

concluded both the female resident and the male intruder were returned to their respective home

cages.

The social defeat stress procedure consisted of three experimental groups (Table 1). The

rats in Group 1 were unhandled, unstressed controls and were not exposed to the social defeat

19

stress procedure. The rats in Group 2 were unhandled for five days and were then exposed to

social defeat stress only once, on day 6 of the experiment. The rats in Group 3 were exposed to

the social defeat procedure once daily for 6 consecutive days. On day 6 of the experiment all the

intruder rats were rapidly decapitated 2 hours after the start of their social defeat stress session

(or at an equivalent time for the unstressed control group). Immediately upon termination of the

intruders, the brains were dissected and rapidly frozen in 2-methylbutane at -40º C and stored at -

80º C. At the same time, the adrenal and thymus glands were dissected out and stored at -80º C.

The glands were then weighed at a later date in order to verify the health and stress condition of

each intruder.

Behavioral Assays

Video cameras were placed in the behavioral testing room where the social defeat stress

experiment occurred. Each social defeat session was recorded and the number of defeats per

session was scored for each intruder.

Gene Assays

Each brain was removed from the -80º C freezer and incubated in 2-methylbutane at -20º

C for 10 min. After the 10 min had elapsed the brain was placed into a stainless steel rat brain

matrix, with slots spaced at 1.0 mm distances in the coronal plane (Braintree Scientific, MA),

which had been stored at -20º C. All dissections were conducted under RNase-free conditions.

A standard single-edge razor blade was inserted into the most rostral slot within the matrix.

Then, the brain and the matrix were placed in a cooler lined with dry ice for 30 sec. Once the

brain and matrix were removed from the cooler two blades were inserted into the two most

caudal slots, and then the brain within the matrix was placed back into the cooler for 30 sec.

These blades anchored the brain in the matrix. Then, individual blades were placed into the

successive slots in the matrix from the rostral to caudal direction. After each blade was inserted

20

into the matrix, the brain and matrix were placed in the cooler for 30 sec. This procedure was

repeated until the brain was completely sectioned through the amygdala in the coronal plane.

Then, the first blade was removed with the 1 mm coronal section freeze-mounted to it. The

blade and section were placed on the dry ice, and then the brain and matrix were returned to the

dry ice for 30 sec. This procedure was repeated until all of the slices through the amygdala had

been obtained. The sections that were within the rostral-caudal extent of the amygdala (between

1.80 and 2.80 mm posterior to bregma, according to the atlas of Paxinos and Watson, 1998) were

kept on the dry ice and three bilateral micropunches (1mm in diameter) were taken using a Harris

Uni-Core (Ted Pella, CA). The micropunches from each rat were placed into individual 0.5 ml

microcentrifuge tubes, on dry ice. The micropunches from each rat were then homogenized for 5

sec in 40 µl TRI Reagent (Molecular Research Center, OH) using a Sonic Dismembrator Model

150 (Fisher Scientific, GA) set at 40. The homogenates were incubated at room temperature for

5 min and stored at -80º C (for 1-2 weeks) until the total RNA was isolated.

The homogenates were then thawed at room temperature, supplemented with 5.4 µl 1-

Bromo-3-Chloropropane (BCP) and shaken by hand vigorously for 15 sec. The resulting

mixture was then stored at room temperature for 3 min and centrifuged at 12,000 g for 15 min at

4º C. Following centrifugation, the colorless upper aqueous phase was extracted and transferred

to a fresh 0.2 ml microcentrifuge tube. The total RNA was precipitated from the aqueous phase

by adding 26.6 µl of isopropanol to the mixture. The samples were then incubated at room

temperature for 7 min and centrifuged at 12,000 g for 8 min at 4º C. The supernatant was

removed and discarded by aspiration. The RNA pellet was then washed by adding 53.4 µl of

75% ethanol, mixed by vortexing and centrifuged at 12,000 g for 15 min at 4º C. The ethanol

wash was removed by aspiration. The RNA pellet was then partially air-dried for 10 min at

21

room temperature and was dissolved in 10 µl diethyl pyrocarbonate (DEPC) treated water by

gently passing the solution through a pipette tip approximately 4 or 5 times. The isolated total

RNA was then incubated in a water bath for 15 min at 55 – 60º C.

To eliminate the possibility of contamination by genomic DNA, equal aliquots of total

RNA were treated with DNase 1 using the TURBO DNA-free kit (Ambion, TX). TURBO

DNase Buffer (1 µl @ 10X ) and TURBO DNase (1 µl) were added to the total RNA samples.

The resulting mixture was then incubated at 37º C for 30 min. Following incubation, 2 µl of

DNase Inactivation Reagent was added to each tube then intermittently vortexed at room

temperature for 2 min. The resulting mixture was centrifuged at 10,000 g for 1.5 min at room

temperature then the supernatant was transferred to a fresh tube. The concentration of total RNA

in each sample was determined by measuring absorbance of 1.5 µl of the sample at 260 nm

(OD260) in a Nanodrop ND-1000 spectrophotometer (NanoDrop Technologies, DE). The purity

of each sample was determined by calculating the ratio of absorbance at 260 and 280 nm

(OD260/OD280). In order to confirm the integrity of the isolated RNA an additional 2 µl of

total RNA was loaded onto an RNA-denaturing formaldehyde-agarose gel and visualized by

staining with ethidium bromide.

The cDNA was synthesized from each total RNA sample with random hexamers and

oligo(dT)20 using the Superscript III Platinum Two-Step qRT-PCR kit (Invitrogen, CA). RT

Reaction Mix (10 µl @ 2X), RT Enzyme Mix (2 µl), and equal amounts of the total RNA

samples (1.0 µg in 1.6 – 3.5 µl) were combined, and then thoroughly mixed. DEPC-treated

water was added to each sample (4.5 – 6.3 µl) resulting in a final volume of 20 µl of the cDNA

synthesis reaction. Then, each cDNA synthesis reaction was incubated at 25° C for 10 min,

followed by 42° C for 50 min. Each reaction was terminated by incubating the mixture at 85° C

22

for 5 min, and then chilling on ice. E. coli RNase H (1 µl) was added to each reaction and then

the resulting mixture was incubated at 37° C for 20 min. Each cDNA synthesis reaction was

then stored at -20° C until the time of use.

Forward and reverse primer sequences were generated by inputting the GenBank

sequences for Cx36 and GAPDH (NM_019281 and NM_017008, respectively) into the

OligoPerfect Designer (Invitrogen, CA). The three primer sets that were ranked most highly for

Cx36 and for GAPDH by the OligoPerfect program were purchased, and an initial RT-PCR

screening was performed. The specificity of each primer was determined by the number of

peaks in the dissociation curve generated at the conclusion of the RT-PCR reaction. Primer sets

that produced only one peak (and therefore yielded only one amplicon) were used in this

experiment (Table 2). A dilution curve was also performed in order to ensure that a sufficient

amount of the cDNA and primers were included in each reaction. Once the appropriate

parameters were established each well was loaded with 12.5 µl Power SYBR Green PCR Master

Mix (Applied Biosystems, CA), 6.5 µl DEPC treated water, 4 µl cDNA, and 2 µl of the Cx36 or

GAPDH primers to obtain a final volume of 25 µl. The 96-well plate was then placed into the

ABI 7900HT thermal cycler (Applied Biosystems, CA). The thermal cycling was performed

with an initial denaturation at 95º C for 5 min. This was followed by 40 cycles each consisting

of 15 sec of denaturation at 95º C, 30 sec of primer annealing at 60º C, and 30 sec of template

extension at 72º C. Upon completion of all 40 cycles a dissociation curve was generated in order

to confirm the specificity of both targeted amplifications. For the dissociation curve a final

denaturing step was performed for 1 min at 95º C followed by an additional min at 55º C then,

every 10 sec the set-point temperature of the thermal cycler was increased by 0.4º C for 100

repetitions in order to determine the range of amplicon melting temperatures.

23

Statistical Analyses

Potential between-groups differences in the total number of defeats was analyzed using

an independent samples t-test to compare the two groups of intruders (i.e. the acutely stressed

group and the repeatedly stressed group) during their initial exposure to social defeat stress. A

one-way repeated-measures analysis of variance (ANOVA) was used to examine any potential

differences in number of defeats across experimental sessions for the repeatedly stressed group.

Potential between groups differences in adrenal and thymus gland weights were analyzed

by a one-way ANOVA.

An analysis of fold-change for both the acutely stressed and repeatedly stressed groups

was calculated by normalizing the Cx36 gene expression to the expression of the control gene

(GAPDH) using the Comparative Crossing Threshold (CT) method (Livak, 2001). In order to

ascertain whether the calculated fold-change significantly differed from 1.0, a one-way ANOVA

was performed.

Five of the 16 intruder rats were excluded from all the data analysis. Two of the rats

were excluded because they were not defeated (one rat in the acute group was not defeated, and

one rat in the repeated group was only defeated 4 times during the 6 sessions, and was not

defeated at all during the final session). The RNA extraction from 2 rats (1 control and one

repeated defeat) failed due to a procedural error. The RT-PCR for 1 rat in the acute defeat group

failed due to a procedural error (see Fig. 5).

24

Table 2-1. Schedule of social defeat stress exposure by group Repeated Stress Acute Stress Kill Time

Day 1 Day 2 Day 3 Day 4 Day 5 Day 6 2 Hours Group 1 X X X X X X X Group 2 X X Group 3 X

Table 2-2. Forward and reverse primer sequences for connexin36 and GAPDH Gene Forward primer Reverse primer Connexin36 TAGCATGCCAGCTTTTCTTT GGCTCTACTGCAAACCTCTG GAPDH TGTATCCGTTGTGGATCTGA GACAACCTGGTCCTCAGTGT

25

CHAPTER 3 RESULTS

Social Defeat Experiment

There were no significant between-groups differences in the number of defeats during the

first exposure to social defeat stress when the acutely and repeatedly stressed groups were

compared (t (6) = 1.567, p = 0.1682; Figure 3-1). The rats in the repeated stress condition

showed no significant between-groups differences in the number of defeats (F (3, 5) = 1.343, p =

0.2997; Figure 3-1) across all six experimental sessions.

There were no significant between-groups differences in thymus masses following

exposure to social defeat stress for any of the experimental conditions (F (2, 8) = 0.3129, p =

0.7398; Figure 3-2A). Similarly, the adrenal gland masses did not differ significantly (F (2, 8) =

1.321, p = 0.3193; Figure 3-2B) between the rats in any of the experimental conditions.

26

0 1 2 3 4 5 60.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5Repeated StressAcute Stress

Defeat Session

Num

ber

of D

efea

ts

Figure 3-1. Social defeats per daily experimental session. The rats that were exposed to only

one social defeat session (acute stress group) experienced a similar number of defeats (defeat session 6) as the rats in the repeated stress condition on their first exposure to social defeat (defeat session 1). Those rats in the repeated stress group were exposed to an equivalent number of social defeats across all 6 experimental sessions. Results are expressed as group means ± the standard error of the mean (SEM) (n = 4 rats per group).

27

Control Acute Repeated0

50

100

150

Thym

us W

eigh

t (m

g/10

0g)A

Control Acute Repeated0

5

10

15

20

Adr

enal

Wei

ght (

mg/

100g

)B

Figure 3-2. Effects of social defeat stress exposure on glandular masses. A) Thymus gland masses, B) Adrenal gland masses showed no significant between-groups differences, regardless of experimental condition. Results are expressed as group means ± the SEM (n = 3 rats per group for controls; n = 4 rats per group for both acute and repeated stress groups).

28

Gene Assays

Representative sections demonstrating the locations from which micropunches were

extracted are shown in Figure 3-3. Representative RNA-denaturing formaldehyde-agarose gel,

indicating the integrity of the RNA as evidenced by the visible 18S and 28S bands (Figure 3-4).

When the semi-quantitative RT-PCR was run the dissociation curve generated at the

conclusion of the reaction contained only one peak for each of the primer sets for both Cx36 and

GAPDH (Figure 3-5). A significantly greater Cx36 mRNA expression was evident in the

amygdala of rats following exposure to repeated social defeat stress (F (2, 8) = 10.27, p < 0.01;

Figure 3-6).

29

Figure 3-3. Localization of amygdala micropunches. Rodent brain atlas figures depicting the

target sites for the three bilateral micropunches of the amygdala (Top). Representative rodent brain slices showing the actual amygdala micropunches (Bottom).

30

Figure 3-4. The RNA-denaturing formaldehyde-agarose gel. Representative gel of RNA isolated from six different limbic brain regions. The sharp 18S and 28S ribosomal RNA bands indicate the presence of intact RNA.

31

Figure 3-5. Assessment of primer specificity. Dissociation curve of primers for Cx36 (blue) and GAPDH (purple). The curve contains one peak for each primer, at the melting temperature of each amplicon, indicating that the amplified RNA products are specific and that the SYBR Green fluorescent signal directly measured the exponential increase of Cx36 and GAPDH.

32

Cx36 Amygdala

Acute Repeated0

1

2

3

4 *

Fold

Cha

nge

Figure 3-6. Social defeat stress increases expression of Cx36 mRNA in the amygdala. Cx36

mRNA was not significantly changed in the acutely stressed group compared to that of the control group. Cx36 mRNA was significantly increased in the repeatedly stressed group compared to that of the control group. Results are expressed as group means ± the SEM relative to the controls (dotted line) (n = 3 rats per group for controls; n = 4 rats per group for both acute and repeated stress conditions). *Significant at p < 0.05.

33

CHAPTER 4 DISCUSSION

The results of the current study demonstrate that repeated social defeat stress induces

limbic plasticity in the form of an elevation in Cx36 mRNA within the amygdala. The impact

that this change in Cx36 gene expression has on neuronal communication in the limbic system is

currently unknown. However, this effect of repeated social defeat raises the possibility that

alterations in connexin gene expression may play an important role in stress-induced changes in

limbic processing of emotional stimuli. This possibility is in line with previous reports that

amygdaloid neuroplasticity plays an important role in the effects of stress (Sigurdsson et al.,

2007), and that connexin gene expression is increased during withdrawal from psychostimulant

self-administration (Bennett et al., 1999; McCracken et al., 2005a; McCracken et al., 2005b).

Classical learning and memory mechanisms have been shown to underlie alterations in the

processing of emotionally salient stimuli within the amygdala. Amygdaloid evoked responses to

medial geniculate stimulation are increased after high-frequency stimulation of the geniculate

(Rogan and LeDoux, 1995). This effect is blocked by NMDA receptor antagonists, indicating a

role for changes in glutamate signaling (Li et al., 1995). Similar changes in amygdaloid

responsiveness are observed after associative fear conditioning to a tone, indicating that

amygdaloid processing of auditory inputs from the amygdala are enhanced by the pairing of the

auditory cue with the aversive stimulus (Rogan et al., 1997). Plasticity in amygdaloid processing

of geniculate inputs resembles glutamate-mediated alterations in hippocampal processing of

information and hippocampal plasticity is thought to model mechanisms of declarative learning

and memory (for review, see Disterhoft and De Jonge, 1987; Kemp and Manahan-Vaughan,

2007).

34

Limbic plasticity was also demonstrated in a study conducted by Simpkiss and Devine

(2003). Following tetanic stimulation of the bed nucleus of stria terminalis (BNST), a crucial

site of limbic convergence (Weller and Smith, 1982; Moga et al., 1989), a decrease in evoked

field potential responses was recorded in the PVN. This effect was potently blocked by the

NMDA receptor antagonist MK-801, indicating the presence of glutamate-mediated plasticity in

this limbic circuit. Plasticity in this system suggests a functional congruity between known

stress circuitry and the mechanisms thought to underlie classical learning and memory.

Limbic plasticity has also been described in rats subjected to a week of isolation housing.

Some rats exhibit increases in anxiety-related behavior after one week exposure to the stress of

social isolation (Kabbaj et al., 2000), providing further evidence that a stressor can produce

changes in limbic function. These converging lines of evidence indicate that limbic structures

are capable of plastic alterations after stimulation or stress exposure, and that these changes may

produce meaningful alterations in the processing of emotionally-salient stimuli. The findings of

the current study reveal an additional mechanism that may contribute to stress-induced

alterations in functional activity of the limbic system.

Although we demonstrated a stress-induced alteration of the limbic system we did not see

an associated change in adrenal or thymus masses. Exposure to repeated stress has been shown

to produce thymus involution and adrenal hypertrophy (Blanchard et al., 1998; Dominguez-

Gerpe and Rey-Mendez, 2001; Hasegawa and Saiki, 2002). Since we did not see a change in

thymus or adrenal gland mass this suggests that the total number of social defeat sessions should

be increased for the repeatedly stressed group in all future stress manipulations. Despite

extensive efforts to assure that the residents were well-trained and experienced, that they

significantly outweighed the intruders, and that they had established territorial dominance

35

through pair-housing with a female, there were some inconsistencies in the number of defeats

that the residents initiated across days and for individual intruder rats. This could have been

influenced by uncontrolled environmental factors (see Dallman et al., 1999), or by differences in

the interactions between the individual residents and intruders. In any case, the overall impact of

these individual variations is not known. On the other hand, an important variable that could

have contributed to the lack of thymus and adrenal changes is that the intruder rats were pair-

housed between defeat sessions. Ruis and colleagues (1999) found that pair-housing following

resident-intruder interactions resulted in an attenuation of the stress effects due to the formation

of a stable social relationship. Since we did not see the typical stress effects on gland masses and

we know the social defeat stress procedure is susceptible to environmental variables, including

pair-housing, we have begun to formulate a more vigorous stress regimen utilizing naturalistic

stressors, along with social defeat, in an attempt to further explore the effects of emotional stress

on connexin gene expression throughout the limbic system.

In the social defeat sessions, there were no significant differences in the number of defeats

during the first exposure to social defeat stress for both stress groups. Moreover, despite the

apparent fluctuation in the number of defeats across days in the repeatedly stressed group, there

were no statistically significant differences in the daily numbers of defeats. This may be due to

the small number of rats in this experimental group. Despite this apparent variability, the Cx36

mRNA expression was quite consistent and significantly elevated in these rats, suggesting that

the mere presence of the dominant resident serves as a stressor in intruder rats that have a history

of defeat. Thus, it is unclear if the precise number of defeats has any bearing on the emotional

and physiological state of the intruders.

36

In accordance with the observations of this experiment, stress-induced changes in connexin

gene expression should be further characterized. Cx36 protein expression within the amygdala

must be evaluated since connexin protein expression may not always match its gene expression

(Oguro et al., 2001; McCracken et al., 2005a; McCracken et al., 2005b; Nakata et al., 1996;

Temme et al., 1998; Matesic et al., 1994). Protein levels of the various connexins are considered

to be tightly regulated by both post-transcriptional and post-translational processes. Connexin

protein expression can be altered post-transcriptionally by decreasing protein synthesis (Nakata

et al., 1996) or post-translationally by reducing the rate of degradation (Musil et al., 2000;

VanSlyke and Musil, 2005). Furthermore, the half-life of gap junctions in cultured cells and

tissues has been reported to be less than 2 hours (Crow et al., 1990; Beardslee et al., 1998).

Therefore, the formation and turnover of gap junctions may explain the disparity between the

levels of gene and protein expression.

Additional studies must also be performed to elucidate the physiological and behavioral

roles of the changes in Cx36 gene (and potentially protein) expression. By pharmacologically

challenging connexin proteins through the administration of the gap junction antagonist

carbenoxolone or the specific Cx36 antagonist mefloquine the effects of connexin dysregulation

on limbic-mediated tasks can be assessed. Furthermore, by microinjecting viral vectors

containing the Cx36 gene into the amygdala we may be able to increase Cx36 protein expression

and examine how this impacts fear and startle responses, as well as responses on standard tests of

anxiety-related behaviors and models of major depression. Likewise, we can also examine the

potential effects of increasing Cx36 protein expression on measures of sympathetic activity,

ACTH and corticosterone, under stressed and unstressed conditions. Additionally, by

conducting a time-course study we can investigate the duration of the observed connexin

37

plasticity. Moreover, by conducting a series of low-density arrays exploring the gene expression

of Cxs26, 32, 43, 45, 47, and 57 we can further advance our understanding of the part other

connexins play in the limbic system’s response to stress. From these analyses we should gain

substantial insight into the roles connexins may play in stress-induced plasticity, which should

lead to a greater understanding of the etiology of major depression and its related disorders.

38

APPENDIX RAW ΔCT VALUES

Control 8.0571 9.1612 9.0994

Acute

9.3491 9.5528 8.4545 9.2418

Repeated

8.1420 7.5250 6.5152 6.6185

39

LIST OF REFERENCES

Aina Y and Susman JL (2006) Understanding comorbidity with depression and anxiety disorders. J Am Osteopath Assoc 106:S9-14.

Albeck DS, McKittrick CR, Blanchard DC, Blanchard RJ, Nikulina J, McEwen BS, and Sakai

RR (1997) Chronic social stress alters levels of corticotropin-releasing factor and arginine vasopressin mRNA in rat brain. J Neurosci 17:4895-4903.

Amaya F, Tanaka M, Hayashi S, Tanaka Y, and Ibata Y (2000) Hypothalamo-pituitary-adrenal

axis sensitization after chronic salt loading. Neuroendocrinology 73:185-193. American Psychiatric Association (1994) Diagnostic and statistical manual of mental disorders,

4th ed. American Psychiatric Association, Washington, DC. Amsterdam JD, Maislin G, Winokur A, Berwish N, Kling M, and Gold P (1988) The CRH

stimulation test before and after clinical recovery from depression. J Affect Disord 14:213-222.

Arborelius L, Owens MJ, Plotsky PM, and Nemeroff CB (1999) The role of corticotrophin-

releasing factor in depression and anxiety disorders. J Endocrinol 160:1-12. Aubry JM, Bartanusz V, Jezova D, Belin D, and Kiss JZ (1999) Single stress induces long-

lasting elevations in vasopressin mRNA levels in CRF hypophysiotrophic neurones, but repeated stress is required to modify AVP immunoreactivity. J Neuroendocrinol 11:377-384.

Bartanusz V, Jezova D, Bertini LT, Tilders FJ, Aubry JM, and Kiss JZ (1993) Stress-induced

increase in vasopressin and corticotropin-releasing factor expression in hypophysiotrophic paraventricular neurons. Endocrinology 132:895-902.

Beardslee MA, Laing JG, Beyer EC, and Saffitz JE (1998) Rapid turnover of connexin43 in the

adult rat heart. Circ Res 83:629-635. Bennett SA, Arnold JM, Chen J, Stenger J, Paul DL, and Roberts DC (1999) Long-term changes

in connexin32 gap junction protein and mRNA expression following cocaine self-administration in rats. Eur J Neurosci 11:3329-3338.

Blanchard RJ, Nikulina JN, Sakai RR, McKittrick C, McEwan B, and Blanchard DC (1998)

Behavioral and endocrine change following chronic predatory stress. Physiol Behav 63:561-569.

Chung KK, Martinez M, and Herbert J (1999) Central serotonin depletion modulates the

behavioral, endocrine and physiological responses to repeated social stress and subsequent c-fos expression in the brains of male rats. Neuroscience 92:613-625.

40

Covington HE and Miczek KA (2001) Repeated social-defeat stress, cocaine or morphine. Effects on behavioral sensitization and intravenous cocaine self administration “binges.” Psychopharmacology 158:388-398.

Crow DS, Beyer EC, Paul DL, Kobe SS, and Lau AF (1990) Phosphorylation of connexin43 gap

junction protein in uninfected and Rous sarcoma virus-transformed mammalian fibroblasts. Mol Cell Biol 10:1754–1763.

Cummins R (1990) Social insecurity, anxiety, and stressful events as antecedents of depressive

symptoms. Behav Med 16:161-164. Dallman MF, Akana AM, and Bhatnagar S (1999) Warning! Nearby construction can profoundly

affect your experiments. Endocrine 2:111-113. de Goeij D, Jezova D, and Tilders FJ (1992) Repeated stress enhances vasopressin synthesis in

corticotropin releasing factor neurons in the paraventricular nucleus. Brain Res 577:165-168.

Disterhoft JF and De Jonge M (1987) Associative learning and long-term potentiation: cellular

mechanisms compared. Int J Neurol 21-22:172-183. Dominguez-Gerpe L and Rey-Mendez M (2001) Alterations induced by chronic stress in

lymphocyte subsets of blood and primary and secondary immune organs of mice. BMC Immunol 2:7.

Ebner K, Wotjak CT, Landgraf R, and Engelmann M (2005) Neuroendocrine and behavioral

response to social confrontation: residents versus intruders, active versus passive coping styles. Horm Behav 47:14-21.

Frisch C, De Souza-Silva MA, Söhl G, Güldenagel M, Willecke K, Huston JP, and Dere E

(2005) Stimulus complexity dependent memory impairment and changes in motor performance after deletion of the neuronal gap junction protein connexin36 in mice. Behav Brain Res 157:177-185.

Gillies GE, Linton EA, and Lowry PJ (1982) Corticotropin releasing activity of the new CRF is

potentiated several times by vasopressin. Nature 299:355-357. Gold PW, Loriaux DL, Roy A, Kling MA, Calabrese JR, Kellnor CH, Nieman LK, Post RM,

Dicker D, Gallucci W, et al. (1986) Response to corticotrophin-releasing hormone in the hypercortisolism of depression and Cushing’s disease: pathophysiologic and diagnostic implications. N Engl J Med 314:1329-1335.

Greenberg PE and Birnbaum HG (2005) The economic burden of depression in the US: societal

and patient perspectives. Expert Opin Pharmacother 6:369-376.

41

Hand AR and Gobel S (1972) The structural organization of the septate and gap junctions of Hydra. J Cell Biol 52:307-408.

Harris AL (2001) Emerging issues of connexin channels: biophysics fills the gap. Q Rev Biophys

34:325-472. Hasegawa H and Saiki I (2002) Psychological stress augments tumor development through β-

adrenergic activation in mice. Jpn J Cancer Res 93:729-735. Hayley S, Poulter MO, Merali Z, and Anisman H (2005) The pathogenesis of clinical depression:

stressor- and cytokine-induced alterations of neuroplasticity. Neuroscience 135:659-678. Herman JP and Cullinan WE (1997) Neurocircuitry of stress: central control of the hypothalamo-

pituitary-adrenocortical axis. Trends Neurosci 20:78-84. Herman JP, Cullinan WE, Ziegler DR, and Tasker JG (2002) Role of the paraventricular nucleus

microenvironment in stress integration. Eur J Neurosci 16:381-385. Hormuzdi SG, Filippov MK, Mitropoulou G, Monyer H, and Bruzzone R (2004) Electrical

synapses: a dynamic signaling system that shapes the activity of neuronal networks. Biochim Biophys Acta 1662:113-137.

Hosseinzadeh H, Asl M, Parvardeh S, and Mansouri SM (2005) The effects of carbenoxolone on

spatial learning in the Morris water maze task in rats. Med Sci Monit 11:BR88-94. Kabbaj M, Devine DP, Savage VR, and Akil H (2000) Neurobiological correlates of individual

differences in novelty-seeking behavior in the rat: differential expression of stress-related molecules. J Neurosci 20:6983-6988.

Kemp A and Manahan-Vaughan D (2007) Hippocampal long-term depression: master or minion

in declarative memory processes? Trends Neurosci 30:111-118. Kendler KS, Kessler RC, Walter EE, MacLean C, Neale MC, Heath AC, and Eaves LJ (1995)

Stressful life events, genetic liability, and onset of an episode of major depression in women. Am J Psychiatry 152:833-842.

Kessler RC (2003a) The impairments caused by social phobia in the general population:

implications for intervention. Acta Psychiatr Scand Suppl 417:19-27. Kessler RC, Berglund P, Demler O, Jin R, Koretz Z, Merikangas KR, Rush AJ, Walters EE, and

Wang PS (2003b) The epidemiology of major depressive disorder: results from the National Comorbidity Survey Replication (NCS-R). JAMA 289:3095-3105.

Kumar NM and Gilula NB (1996) The gap junction communication channel. Cell 84:381-388.

42

Li XF, Phillips R, and LeDoux (1995) NMDA and non-NMDA receptors contribute to synaptic transmission between the medial geniculate body and the lateral nucleus of the amygdala. Exp Brain Res 105:87-100.

Livak KJ (2001) User Bulletin #2, ABI PRISM 7700 Sequence detection system. PE applied biosystems. [http://www.docs.appliedbiosystems.com/pebiodocs/04303859.pdf]

Martinez M, Phillips PJ, and Herbert J (1998) Adaptation in patterns of c-fos expression in the

brain associated with exposure to either single or repeated social stress in male rats. Eur J Neurosci 10:20-33.

Matesic DF, Rupp HL, Bonney WJ, Ruch RJ, and Trosko JE (1994) Changes in gap-junction

permeability, phosphorylation, and number mediated by phorbol ester and non-phorbol-ester tumor promoters in rat liver epithelial cells. Mol Carcinog 10:226–236.

McCracken CB, Hamby SM, Patel KM, Morgan D, Vrana KE, and Roberts D (2005a) Extended

cocaine self-administration and deprivation produces region-specific and time-dependent changes in connexin36 expression in rat brain. Synapse 58:141-150.

McCracken CB, Patel KM, Vrana KE, Paul DL, and Roberts D (2005b) Amphetamine produces

region-specific and time-dependent changes in connexin36 expression in rat brain. Synapse 56:39-44.

McEwen BS (2006) Protective and damaging effect of stress mediators: central role of the brain.

Dialogues Clin Neurosci 8:367-381. Mello AA, Mello MF, Carpenter LL, and Price LH (2003) Update on stress and depression: the

role of the hypothalamic-pituitary-adrenal (HPA) axis. Rev Bras Psiquiatr 25:231-238. Moga MM, Saper CB, and Gray TS (1989) Bed nucleus of the stria terminalis: cytoarchitecture,

immunohistochemistry, and projection to the parabrachial nucleus in the rat. J Comp Neurol 283:315-332.

Musil LS, Le AC, VanSlyke JK, and Roberts LM (2000) Regulation of connexin degradation as

a mechanism to increase gap junction assembly and function. J Biol Chem 275:25207–25215.

Nagy JI, Dudek FE, and Rash JE (2004) Update on connexins and gap junctions in neurons and

glia in the mammalian nervous system. Brain Res Rev 47:191-215. Nakata Y, Iwai M, Kimura S, and Shimazu T (1996) Prolonged decrease in hepatic connexin32

in chronic liver injury induced by carbon tetrachloride in rats. J Hepatol 25:529–537. Nemeroff CB (2007) The burden of severe depression: a review of diagnostic challenges and

treatment alternatives. J Psychiatr Res 41:189-206.

43

Nemeroff CB, Bissette G, Akil H, and Fink M (1991) Neuropeptide concentrations in the cerebrospinal fluid of depressed patients treated with electroconvulsive therapy, corticotrophin-releasing factor, beta-endorphin and somatostatin. Br J Psychiatry 158:59-63.

Nemeroff CB, Widerlov E, Bissette G, Walleus H, Karlsson I, Eklund K, Kilts CD, Loosen PT, and Vale W (1984) Elevated concentrations of CSF corticotrophin-releasing factor-like immunoreactivity in depressed patients. Science 226:1342-1344.

Nikulina EM, Covington HE, Ganschow L, Hammer RP, and Miczek KA (2004) Long-term

behavioral and neuronal cross-sensitization to amphetamine induced by repeated brief social defeat stress: Fos in the ventral tegmental area and amygdala. Neuroscience 123:857-865.

Oguro K, Jover T, Tanaka H, Lin Y, Kojima T, Oguro N, Grooms SY, Bennett MV, and Zukin

RS (2001) Global ischemia-induced increases in the gap junctional proteins connexin32 (Cx32) and Cx36 in hippocampus and enhanced vulnerability of Cx32 knock-out mice. J Neurosci 21:7534–7542.

Paxinos G and Watson C (1998) The Rat Brain in Stereotaxic Coordinates, 4th Ed. CD-ROM:

Hulasz, P. Ressler KJ and Nemeroff CB (2000) Role of serotonergic and noradrenergic systems in the

pathophysiology of depression and anxiety disorders. Depress Anxiety 12 (Suppl 1):2-19. Rogan MT and Ledoux JE (1995) LTP is accompanied by commensurate enhancement of

auditory-evoked responses in a fear conditioning circuit. Neuron 15:127-136. Rogan MT, Staubli UV, and Ledoux JE (1997) Fear conditioning induces associative long-term

potentiation in the amygdala. Nature 390:604-607. Ruis MA, te Brake JH, Buwalda B, De Boer SF, Meerlo P, Korte SM, Blokhuis HJ, and

Koolhaas JM (1999) Housing familiar male wildtype rats together reduces the long-term adverse behavioural and physiological effects of social defeat. Psychoneuroendocrinology 24: 285-300.

Sigurdsson T, Doyere V, Cain CK, and LeDoux JE (2007) Long-term potentiation in the

amygdala: a cellular mechanism of fear learning and memory. Neuropharmacology 52:215-227.

Simpkiss JL, and Devine DP (2003) Responses of the HPA axis after chronic variable stress:

effects of novel and familiar stressors. Neuro Endocrinol Lett 24:75-81. Smith SM and Vale WW (2006) The role of the hypothalamic-pituitary-adrenal axis in

neuroendocrine responses to stress. Dialogues Clin Neurosci 8:383-395. Söhl G, and Willecke K (2003) An update on connexin genes and their nomenclature in mouse

and man. Cell Commun Adhes 10:173–180.

44

Söhl G, Maxeiner S, and Willecke K (2005) Expression and functions of neuronal gap junctions.

Nat Rev Neurosci 6:191-200. Temme A, Traub O, and Willecke K (1998) Downregulation of connexin32 protein and gap-

junctional intercellular communication by cytokine-mediated acute-phase response in immortalized mouse hepatocytes. Cell Tissue Res 294:345–350.

VanSlyke JK and Musil LS (2005) Cytosolic stress reduces degradation of connexin43

internalized from the cell surface and enhances gap junction formation and function. Mol Biol Cell 16:5247-5257.

Vieweg W, Julius D, Fernandez A, Beatty-Brooks M, Hettema JM, and Pandurangi AK (2006)

Posttraumatic stress disorder: clinical features, pathophysiology, and treatment. Am J Med 119:383-390.

Wei CJ, Xu X, and Lo CW (2004) Connexins and cell signaling in development and disease.

Annu Rev Cell Dev Biol 20:811-838. Weller KL and Smith DA (1982) Afferent connections to the bed nucleus of the stria terminalis.

Brain Res 232:255-270. Whitnall MH (1993) Regulation of the hypothalamic corticotropin-releasing hormone

neurosecretory system. Prog Neurobiol 40:573-629. Wommack JC and Delville Y (2003) Repeated social stress and the development of agonistic

behavior: Individual differences in coping responses in male golden hamsters. Physiol Behav 80:303-308.

Woodside BD and Staab R (2006) Management of psychiatric co-morbidity in anorexia nervosa

and bulimia nervosa. CNS Drugs 20:655-663.

BIOGRAPHICAL SKETCH

Nathan Weinstock received his Bachelor of Science in spring 2005 from the University of

Florida. He began his graduate education in fall 2005 working towards his Master of Science

degree in the behavioral neuroscience program in the psychology department at the University of

Florida.