What do you see?

What do you see?

Colorblindness is an example of a sex-linked disorder

Human Human GeneticsGenetics

Chapter 14-1, 14-2Human Heredity

The Human GenomeATGGGTCGCGTATCGTAGCTGATGGGGGTAGTATTT

TATATGCTGGTAGACAAAACGGTGTACTGCCGTCGTCGTAGTGATGTGCGGCGCCAAAAATTATACTGTGACTGATCGTAGTGTAAAAAAAAAAGTCGTGCTGCTTTTTTCGATCGCGCGTAGTAGCTACGCCGCGGTTCGCGCGTAAGAGACTGATGCGACTGATATATATACGCGCTAGCATATATCTCTCGATCTGATCGTAGATGCTTAAGTTACTAGCTGTCGTATACGTAGTTAGTCGGGTGATGATGCTGTATATATCGCGCTCTATATGCTAGCTAGTGTTGTAGCTAGCTGATTCCCTCGAAGTCTCGTGAATAATCGCGCTTTCGGGGGCTCTCTATA

Human Genome

• 3 billion base pairs– 6 billion individual bases

• “4 million pages”• Bases (letters) spell out

genes (words) that result in the phenotype (the story)

• Some spell out bad stories (diseases)

Chromosome # Genes # of BasesChromosome 1 2968 279 million basesChromosome 2 2288 251 million basesChromosome 3 2032 221 million basesChromosome 4 1297 197 million basesChromosome 5 1643 198 million basesChromosome 6 1963 176 million basesChromosome 7 1443 163 million basesChromosome 8 1127 148 million basesChromosome 9 1299 140 million basesChromosome 10 1440 143 million basesChromosome 11 2093 148 million basesChromosome 12 1652 142 million basesChromosome 13 748 118 million basesChromosome 14 1098 107 million basesChromosome 15 1122 100 million basesChromosome 16 1098 104 million basesChromosome 17 1576 88 million basesChromosome 18 766 86 million basesChromosome 19 1454 72 million basesChromosome 20 927 66 million basesChromosome 21 303 45 million basesChromosome 22 288 48 million basesChromosome X 1184 163 million basesChromosome Y 231 51 million bases

Chromosome size source: International Human Genome Sequencing Consortium. Initial sequencing and analysis of the human genome. Nature 409:860-921(2001).Gene count source: Wellcome Trust. Unveiling your genome. Wellcome News Supplement Q1:13-23(2001).

Humans have 22 pairs of AUTOSOMES

Why is the 23rd pair different? What is it called?What is this picture called? When was this cell photographed?

Is this a man or a woman? How do you know?

Answers…

2. The “23rd” pair are the sex chromosomes3. This picture is a karyotype4. It was taken during mitosis (likely metaphase)5. It is a man• He has one X chromosome (larger) and one Y

chromosome (smaller)

What do you see?

Colorblindness is an example of a sex-linked disorder

• h = hemophilia, a sex-linked disorder

• For each, can you answer…• Is the dad affected?• Is the mom affected?• How many children have the

disease?• How many children are carriers?• How many children are healthy?

(careful!)

PEDIGREES another way to study inheritance

• What do you think the F1 generation (line II) # 2 and #5 offspring represent?

• Can you draw the Punnett Square for the Parent generation? (I)

How to read a pedigree…

Carrier female

Carrier male

Pedigrees

• Show how traits are passed down through many generations

• Based mostly on phenotypes• Show the actual offspring

– Punnett squares show the possible offspring

• Really only works well for single traits– Not polygenic traits

• Only works for inherited traits– Environmental factors play a large role in who we are

Inheriting Diseases• Just like physical traits, some diseases can be

inherited on our chromosomes.

• And, just like physical traits, some are X-linked, some are recessive, some are dominant or codominant.

Genetic Disorder Project topicsFragile x syndrome

Gaucher diseaseDuschene Muscular Dystrophy

Marfan syndromeColor blindness

Hurler syndrome

Tay-SachsAlbinism

Cystic FibrosisSickle cell anemia

PKULou Gehrig’s disease

Cri du Chat syndromeHuntington DiseaseTurner’s syndrome

Klinefelter syndromeDown syndromeFanconi anemia

Other Chromosomal Actions

• X-Inactivation if men only need one X chromosome, do women need both X’s? – If not, which one “works”?

• Non-disjunction how gametes can end up with the wrong # of chromosomes in meiosis

X-Chromosome Inactivation

• Men are XY: One X chromosome is enough• Women are XX: The “extra” copy is not needed.

It condenses into a “Barr body.” • Remember, you have trillions of cells. Which X

chromosome that “switches off” can vary in each cell!

Mosaicism

Nondisjunction• “Not coming apart”• Homologous

chromosomes fail to separate in meiosis

• Result in Trisomy or Monosomy

• Examples: – Klinefelter syndrome (trisomy X)– Down syndrome (trisomy 21)– Turners syndrome (X_

monosomy)

• Click the image to play the video segment.

Video 2

Nondisjunction