Tutorial 11 RNA Structure Prediction. Rfam – RNA structures database RNAfold – RNA secondary structure prediction tRNAscan – tRNA prediction TargetScan.

Tutorial 11

RNA Structure Prediction

RNA Structure Prediction

• Rfam – RNA structures database

• RNAfold – RNA secondary structure prediction

• tRNAscan – tRNA prediction

• TargetScan – microRNA prediction

RNA secondary structure types

Rfam

• The Rfam database is a collection of RNA families, each represented by multiple sequence alignments and consensus secondary structures.

http://rfam.sanger.ac.uk/

Rfam

Different search modes

http://rfam.sanger.ac.uk/

Search Rfam

The secondary structure

:::::: free extremes((())) Stem<<<>>> Internal Stem______ Loop,,,,,, Internal loop

Structure representations

RNA secondary structure prediction

GGGCUAUUAGCUCAGUUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGCUGAUUCGAAUUCAGCAUAGCCCA

RNA structure prediction by Vienna RNA package

RNAfold server minimum free energy structures and base pair probabilities from single RNA or DNA sequences.

RNAalifold server consensus secondary structures from an alignment of several related RNA or DNA sequences. You need to upload an alignment.

RNAinverse server design RNA sequences for any desired target secondary structure.

RNAfold

• Gives best stabilized structure (structure with minimal free energy (MFE))

• uses a dynamic programming algorithm that exploits base pairing and thermodynamic probabilities in order to predict the most likely structures of an RNA molecule (partition function algorithm).

RNAfold - input

RNA sequence

Minimal free energy structure

Frequency of the structure

RNAfold - output

Sequence-Structure alignment

Best “average” structure

Graphic representation

Coloring options

Minimal free energy

Folding Probabiliy

Mountain Plot

• A mountain plot represents a secondary structure in a plot of height versus position.

• The height m(k) is given by the number of base pairs enclosing the base at position k.

• Loops correspond to plateaus and stems correspond to slopes.

• The closer the two curves, the better defined the structure.

centroid

Entropy

RNAfold structure representations

RNAalifold - input

Alignment

RNAalifold - output

RNAinverse - input

RNAinverse - output

tRNAscan

• Detection of tRNA genes in raw genomic sequence orother types of sequence inputs.

http://lowelab.ucsc.edu/tRNAscan-SE/

Sequence

tRNAscan - input

tRNAscan - results

http://trna.nagahama-i-bio.ac.jp/

MicroRNA - reminder

• Search for predicted microRNA targets in mammals (/worm/fly) 3’ UTRs.• Find conserved 8mer and 7mer sites that match the seed region of each miRNA. • Predictions are ranked based on the predicted efficacy of targeting as calculated using the context+ scores of the sites

Mir 31 - broadly conserved* microRNA

* conserved across most vertebrates, usually to zebrafish

Mir 136 - conserved* microRNA

* conserved across most mammals, but usually not beyond placental mammals