Topics in genetics of complex human traits Tomas Drgon National Institute on Drug Abuse NIH, Baltimore MD, USA.

Topics in genetics of complex human traits

Tomas Drgon

National Institute on Drug Abuse

NIH, Baltimore MD, USA

Complex Genetics

• As opposed to “simple genetics” describing Mendelian, single gene traits

• Phenotype is determined by more than one gene

• Environmental influence

Dpt Genet. Genomics, Boston U. http://gmed.bu.edu/about/images/human_migration.jpg

Human Migration History

25-50 million deaths in Europe30%-60% of European population

Human Migration Today

www.mapsofworld.com

Genetic properties of human populations

• Genetic variants– Type

• Chromosomal abnormalities• Variable length repeats• Single Nucleotide Polymorphisms (SNP)• Copy Number Variants (CNV)

– Allele frequencies– LD– Haplotypes

• Genetic variants

– Large scale rearrangements• Rare• De novo• Strong, penetrant, environment independent and

early onset phenotypes

• Not where the action is in behavioral genetics

University of Wisconsin Comprehensive Cancer Center

– Variable stretches of sequence• Low genome-wide density• Unstable/mutable

Exon 1

cagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcag

Normal (26)

cagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcag

Mutable normal (27-35)

cagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcag

Reduced penetrance HD allele (36-39)

cagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcag…

HD allele (>40)

IT-15 gene

Potter et al (2006) AMERICAN COLLEGE OF MEDICAL GENETICS, Standards and Guidelines for Clinical Genetics Laboratories

• Genetic variants: – SNPs

http://fig.cox.miami.edu/~cmallery/150/gene/sf12x16.jpg

• Genetic variants: – SNPs

• 13x106 SNPs defined from comparing genomes of several individuals

• 1 common SNP per 500 bp

• http://www.ncbi.nlm.nih.gov/SNP/

Mapviewer example

• Genetic variants:

– CNVs

• 12,000 in 5000 loci

• http://projects.tcag.ca/variation/

Legend: Blue bars indicate reported CNVs; Red bars indicate reported inversion breakpoints; Green bars to the left indicate segmental duplications.

• Allele frequencies

– Frequencies of variants differ across populations

– Some variants only exist in some and not other populations (founder effects, selection, etc)

25-50 million deaths in Europe30%-60% of European population

• LD – “linkage disequilibrium”

– Human genetic polymorphisms are not independent from each other

– Alleles of polymorphisms that are close to each other travel together (recombination does not separate them)

Linkage disequilibrium

Marker Functional allele

All individuals in this pedigree will contain chromosomes that will have either AC or GT.

Linkage disequilibrium

Marker Functional allele

Individuals in this pedigree will contain chromosome that will have all possible combinations of the polymorphisms A C, G T, A T and G C.

• Haplotypes

– Haplotype is a block of alleles that travel together through recombination events

– Alleles within a block predict each other (D’, r^2)

www.hapmap.org

Human genetic traits

• Traits = phenotypes– Examples:

• Ethnicity• Disease• Behavioral

• How are the above related

• Ethnicity

– Defined by a set of polymorphic alleles inherited from ancestors

– The set is shaped by the history of the population

– Pigmentation, hair type, etc

• Disease

– Some variants will affect function or regulation of proteins and genes (many genes at once)

– Selection (positive, negative, balanced)

• Behavioral– Some variants may result in predisposing

individuals to react differently to outside stimuli

– Personality traits and their inheritance– Cognitive ability (IQ)– Psychiatric disorders

• Traits (phenotypes)– Ethnicity– Disease– Behavioral

• How are the above related

Human genetic traits• Some traits were selected for in certain environments and when

those environments ceased to exist, the traits persisted since they were not selected against (eg eyesight, athletic ability etc)

• Some traits may consist of components that are beneficial for survival/reproductive ability of an individual, although the entire trait may not be desirable/beneficial (novelty seeking – substance abuse).

• Some LD blocks may have variants contributing to different traits, one desirable and one not, there is a constant evolutionary tug-of-war between those.

• Some variants may be good for one thing and bad for the other (sickle cell anemia/resistance to malaria).

How to identify genes responsible for human genetic traits?

• Family studies (genes + environment)

• Twin studies

• Linkage and Mendelian traits

• Complex traits

• Association analysis

• Whole genome association

• Family studies (genes + environment)

– Familiality is prerequisite for a trait to be genetic.

– However, a familial trait may be purely environmental (respiratory phenotypes in families living in polluted areas)

• Twin studies

– Monozygous twins share ALL genomic variants

– Dizygotic (fraternal) twins share some of the genomic variants

– All twins share early environmental influences

• Twin studies

– Concordance (twins have same phenotype) of twins, difference in concordance of MZ and DZ twins

– Correlation between quantitative traits, difference in correlation of MZ and DZ twins

David Duffy, Queensland Inst Med Res, http://www.qimr.edu.au/davidD/Talks/twins2002/twin_asthma_talk.html

Is height heritable?

David Duffy, Queensland Inst Med Res, http://www.qimr.edu.au/davidD/Talks/twins2002/twin_asthma_talk.html

Are levels of Total Serum Immunoglobulin E

heritable?

Hurd et al, Department of Psychology University of Alberta

Hurd et al Department of Psychology University of Alberta

Kendler et al

Heritability of schizophrenia

Koenig et al (2005) Journal of Personality 73:2

Bouchard et al (2002) Journal of Neurobiology 54:4-45

Thompson PM (2001) Nature Neuroscience 4:1253-1258

Wallace et al (2006) Journal of Child Psychology and Psychiatry 47:987-993

• Linkage analysis and Mendelian traits

– Patterns of inheritance in extended family

– Correlation between genotype and phenotype segregation

• Complex traits– Oligogenic– Polygenic– Genetic heterogeneity– Penetrance– Environmental effects– Epigenetics

• Failure of linkage analysis (complex traits)

– Many loci, small effect– Linkage areas very large, containing

hundreds of genes– Findings relevant to particular pedigree, not

population

Cases Controls

Measure allele frequency of selected polymorphisms and compare the cases group with the control group. Difference can be attributed to the difference in phenotype.

Association regions usually contain one or few genes.

Cases Controls

Issues: population stratification, relatedness

• Genome Wide Association

– Probing large amount of genetic polymorphisms at once

– “Hypothesis free”

– SNPs

• 13 x 10^6 SNPs defined from comparing genomes of many individuals

• 1 common SNP per 500 bp

• http://www.ncbi.nlm.nih.gov/SNP/

– CNVs

• 12,000 in 5000 loci

• http://projects.tcag.ca/variation/

Hubble telescope of genetics

gacgcactacatgtatcTagcgctgtattgtcgtacta

gacgcactacatgtatcCagcgctgtattgtcgtacta

cagcgtgatgtacatagAtcgcgacataacagcatgat

AA homozygote

cagcgtgatgtacatagGtcgcgacataacagcatgat

GG homozygote

AG heterozygote

HuSNP, 1500 SNPs

10k chip10 000 SNPs

100K chip100 000 SNPs

500K chip500 000 SNPs

1M chip1 000 000 SNPs1 000 000 CNVs

Each spot represents a hybridization intensity of a SNP or a CNV probe.

These can be used in binary mode to identify presence or absence of an allele in an individual, or in a quantitative mode to assay SNP/CNV allele frequency in a pool of individuals.

Pool with 25% A and 75% G

Analytical issues

• Multiple testing issues, Bonferroni correction

• Sensitivity vs specificity

• Bayesian approaches

• PCA, HCA

• Monte Carlo Modelling

• Philosophy, epistemology

Topics in genetics of complex human traits Tomas Drgon National Institute on Drug Abuse NIH, Baltimore MD, USA.

usa slide

related slide

cavariation slide

human migration history

g c t slide

human genetic traits

human genetic traits

snps http

Documents

Sierras Pampeanas: Tomas Barrera, Tomas Suppo y Emiliano...

Alejandra Tomas NIH Public Access 1 Barbara Yermen Romano...

D16 Tomas de corriente industriales PK Presentación ·...

TOMAS ALVIRA LUIS CLAVELL/TOMAS MELENDO · tomas alvira...

Santo Tomas Scholarship Program...UNIVRSITY O SANTO TOMAS...

NIH as a NIH as a Research Partner

Tomas Directas

Tomas Bella

Tomas Ferrus

Tomas fotograficas

tomas hungerford

TOMAS ALVIRA LUIS CLAVELL/TOMAS MELENDO · 2018-01-21 ·.....

Unidad educativa tomas oleas educativa tomas oleas

sportas.vilnius.ltsportas.vilnius.lt/wp-content/uploads/2019...

Werkstoffe für KFO-Produkte - DENTAURUM ·...

Interruptores y tomas de corriente - · PDF filetomas de...