Liberty Resources: The Road to Independence
Post on 24-Mar-2016
238 Views
Preview:
DESCRIPTION
Transcript
or
ga
niz
at
ion
al
de
ve
lo
pm
en
t
© 2010
Liberty R
esou
rces, Th
e Ro
ad To
Ind
epen
den
ce
The Road to Independence
Matthew Van Der Tuyn
Jacob Wells
Published by
211 South Broad Street, 5th FloorPhiladelphia, PA 19102
Copyright © 2010
Sherika Wynter
Liberty ResourcesThe Road to Independence
Copyright © 2010 by Uarts MIDIllustrations copyright © 2010 by Matthew Van Der Tuyn
Photography credits:Pages 05, © 2010 Harvey Finkle
All rights reserved. No portion of this book may be reproduced–mechanically, elec-tronically, or by any other means, including photocopying–without written permis-sion of the publisher.
Cover design by Matthew Van Der TuynBook design by Matthew Van Der Tuyn
Masters of Industrial Design at The University of the Arts212 South Broad Street, 5th FloorPhiladelphia, PA 19102
First printing June 2010
BACKGROUND03 | The Scenario07 | The Client
APPROACH13 | Client Goals15 | Our Role
PROCESS21 | Research25 | Facilitation & Observation31 | Shadowing & Interviewing
CONCEPTS40 | Areas of Focus43 | Deliverables61 | Impact63 | Moving Forward
Table of Contents
Chapter 1 BACKGROUNDThe Scenario
The Client
who?
Persons with disabilities
Close your eyes. It is a lovely fall afternoon,
the sun is warming your skin and you freely
walk from work to home on the same path
you have taken for many years. You enjoy the
scenery, greet those you pass daily. Nothing
different about today.
Then something out of the ordinary occurs:
Your life will never be the same, You must re-learn every day tasks,You must accept your new situation,You must adapt.
THE SCENAR IO
03BACKGROUND
The norms of disability
Whether born with a disability or
circumstantially gained one, doing every
day tasks can be cumbersome. There
are limited options available to you. Such
things as transportation and information
are not often designed to cater to
those with disabilities. Because of this, a
common thought is that these folks are
best off in a nursing facility.
In actuality it is not that they are
incapable of living in community but
rather it is more convenient for most to
have them out of the way. Some would
argue that the cost of remodeling our
communities to become more accessible
and providing in-home assistance to
those who need it would cost too much.
The fact is that it would be less costly
to have these individuals living in the
community than in a nursing facility
where in many cases an individual does
not need 24 hour care.
So why is at-home-assistance not
considered as an option? There is an
organization that works to do just that.
An organization that advocates for
the rights of persons with disabilities
and works to change the challenging
world that they face. This organization is
Liberty Resources.
04 BACKGROUND
Liberty Resources
Founded in 1980, Liberty Resources is the
Center for Independent Living (CIL) for the
Philadelphia area. What is a CIL? A CIL is a
consumer-driven, cross-disability, federally
funded non–profit organization that operates
within a local community to advocate for and
provide services to persons with disabilities.
To do this, Liberty offers an array of services
to provide the necessities an individual needs
to live independently in the community, such
as skills and vocational training, identifying
and providing housing options, and most
importantly, advocating for their rights on a
local and national level.
Being one of 400 independent living centers
nationwide, Liberty and is the largest and
most active Centers.
THE CL I ENT
07BACKGROUND
What it means to be a consumer
Liberty is very adamant in defining
their role in the disabled community.
They refer to those who they serve as
consumers. Influenced by Ralph Nader
and the consumerism movement of the
1960’s Liberty, strongly makes clear that
the consumer at all times has choices
and responsibilities in regards to their
service options.
Nothing for us with out us
One other important aspect of Liberty
is the fact that they are consumer driven
and consumer controlled. This means
a majority of the governing board and
staff are people with disabilities, in fact
over 51% of their employees have
some disability.
Fighting the good fight
Aside from offering services for persons
with disabilities to live independently
within the community Liberty also
works along side advocacy and activist
groups. These collaborating parties work
with policy makers to push for change
in accessible standards on both the local
and national level.
Liberty, along with other advocacy groups work to create change and often protest
to have their voices heard.
08 BACKGROUND
09
Chapter 2 APPROACHClient Goals
Our Role
why?
The path to performance excellence
Since its birth, Liberty has grown drastically.
Serving only 200 consumers their first year,
Liberty now serves over 7000 consumers. This
type of growth has lead to some growing
pains for the organization. Because of this,
the company has decided to investigate the
processes of different departments, their role
in the organization, department collaborations,
how they serve Liberty consumers.
Liberty Resources is at the beginning phase
of applying for the Malcolm Baldrige National
Quality Award. This award is given to
organizations who possess the ability to not
only provide outstanding services but also
function efficiently on all levels. The application
process is extensive and itself is a tool for
organizational development.
However it is not the award in itself that
Liberty is truly after but rather it is the path
to performance excellence and setting the
standard for other centers nation wide.
CL I ENT GOALS
A chart used by Quality Management to analyze the Baldrige work that is being done with in Liberty Resources.
13APPROACH
UArts MIDActions
Liberty ResourcesActions
Collaborative Actions
Liberty Resources & UArts MID
––––––––––––––––––––––Strategy for
Sustainable Innovation
A collaborative relationship
In collaboration with Liberty, we wanted to
investigate the processes both internally and
as they concern the consumer.
Through this investigation we had hoped to
isolate areas for improvement where design
solutions could be conceptualized, pototyped,
and tested.
Another important goal of ours was to
establish an ongoing collaborative relationship
with the organization, in order to provide
more innovative and effective solutions.
Though very excited about our participation
the organization was hesitant to allow us the
necessary freedom of investigation we
had hoped for.
OUR ROLE
An initial design strategy map that demonstrates how UArts and Liberty Resources could work in a collaborative, innovative relationship.
15APPROACH
Clarifying our intentions
Although Liberty’s expectations were
for us to assist the Quality Management
team in identifying and standardizing
departmental processes, we wanted to
expand our scope and explain exactly
what we, as designers, can do for the
organization in regards to improving not
only organizational processes bur also
human experience.
We drafted a design proposal in order
to give Liberty a better understanding of
what our interests and capabilities were.
Our main objective was to communicate
the importance of a consumer driven
organization, such as Liberty, in looking
more closely at their processes as they
relates directly to the consumer and
their experience. We had proposed
that we shadow and interview some
of the departments that work closely
with the consumers in order to better
understand those processes and
needs for improvement. We made the
argument that observing the processes
in action would allow for a better
understanding of how that department
currently works and influence well
informed strategies for improving both
the processes and experiences.
08 BACKGROUND | the client
A visual representation of our design proposal.
16 APPROACH
Interact With & Observe Individuals
Analyze Processes & Experiencesof Staff & Consumers
Identify Shared Concerns
Develop Possible Solutions
Pilot Solutions & Gather Feedback
Implement Final Solutions
UArts MID ––––––––––––––––––––––
Design Strategy Proposal
PROCESSResearch
Facilitation & Observation
Shadowing & Interviewing
how?
Chapter 3
Our Orientation
We were given the opportunity to take part
in a condensed employee orientation. While
normally new employees go through their
orientation over a three day period, we were
given all of the information in one day. During
the initial session, an orientation manual
was given to everyone present. This manual
contained over 417 slides breaking down and
describing many of the departments within
Liberty. All of this information was hard to
grasp, as it was very spread out in the manual.
In order to gain a better understanding, we
began to map out our interpretation of the
content. One of the most helpful maps we
created was a departmental interaction
map that allowed us to achieve a higher
understanding of the many interactions
between departments, external entities,
and consumers.
RESEARCH
The orientation manual containing over 417 slides about the many departments with in Liberty Resources.
One of many maps developed to visualize the complex information from the orientation manual.
21PROCESS
Liberty Resources ––––––––––––––––––––––
Department Interaction
Liberty Resources ––––––––––––––––––––––
Department Interaction
Process Workshops
The departmental process investigation began
with a series of Process Workshops, done by
the Quality Management department under
the supervision of Michael Smith, the director
of QM. The idea behind these workshops is
to identify overlaps and redundancies within
the organization. Liberty understands that,
in order to achieve performance excellence,
these workshops must be done. These
process workshops would also afford for
departmental improvements. If all tasks are
laid out, then each department can begin to
strategically plan to as to how they can
better themselves.
FAC I L I TAT ION& OBSERVAT ION
Design team member, Sherika Wynter, facilitating a process workshop.
Design team member, Matt Van Der Tuyn, facilitating a process workshop.
We used large sticky notes to layout each departments many process tasks.
25PROCESS
Gathering the information
The basic goal of these process
workshops are to provide a breakdown
of the different tasks performed by each
department. The tasks would be mapped
as they currently occur.
Each task is written on large sticky notes
and placed on a wall. They are separated
by consumer related tasks and Liberty
support tasks. This is to aid in helping
the department representative to see
how all these processes are related.
Once the meeting has concluded, the
gathered information is placed into an
interactive Power Point document.
In order to cater to the needs of
individuals who are visually impaired,
white text is placed behind each Power
Point slide giving a description of the
graphic on the slide to be read by a
screen reader.
A screen reader is software that
identifies, interprets and reads what is
being displayed on the screen. It informs
the user of all graphics and
selections available.
A visualization of the process used by Mike Smith to document the information gathered during the process workshops.
26 PROCESS
Slide shows a process map with high level customer and support processes and how information flows among the processes. Starting in the customer section – information flows from the building relationships with consumers box to the assessing consumers and preparing consumers for transition box. The preparing consumers for transition activity can happen at any and all points in the STS process. The other boxes within customer process section are developing action plans which impacts or flows to preparing for consumer transition and transitioning consumer. Implementing specialized services plans also feeds the preparing for consumer transition process. Managing financial reimbursement, managing employees, collecting and reporting data, contributing to LRI activities and ensuring regulatory compliance are all Support processes that are in boxes below the Customer processes with arrows indicating that these processes support the STS department so they can support the consumer.
eeeeeeeeeeeeem
aaaaaar
maaaaaaaano LLLLLLLR
s iiiiiinnd
ggggggggggggg aaaaaaa
heeeeee
STS Process Map
. uppppoorrttttttt ttttttthhhhhhhee ccoonnssummeesssuusss eerrrCollecting and Reporting Data
rrrrrrreeeeeee iiiiiiinnnnnnn bbbbbbboooooooxxxxxxxeeeeeeesssssss bbbbbbbeeeeeeelllllllooooooowwwwwww ttttttthhhhhhh CCCCCCCuuuuuuussssssstttttttooooooommmmmmmeeeeeeerrrrrrr ppppppprrrrrrroooooooccccccceeeeeeesssssssssssssseeeeeeesssssss wwwwwwwiiiiiiittttttthhhhhhh aaaaaaarrrrrrrrrrrrrrooooooowwwwwwwsssssss dddddddiiiiiiicccccccaaaaaaatttttttiiiiiiinnnnnnnggggggg aaaaaaaaattttttttt ttttttttthhhhhhhhheeeeeeeeessssssssseeeeeeeee pppppppppppppppprrrrrrrrroooooooooccccccccceeeeeeeeesssssssssssssssssseeeeeeeeesssssssss uuuuuuuuuppppppppppppppppppppppppppppppppooooooooorrrrrrrrrttttttttt ttttttttthhhhhhhhheeeeeeeee SSSSSSSSSSTTTTTTTTTSSSSSSSSSS dddddddddeeeeeeeeeppppppppppppppppaaaaaaaaarrrrrrrrrtttttttttmmmmmmmmmeeeeeeeeennnnnnnnnttttttttt sssssssssooooooooo ttttttttthhhhhhhhheeeeeeeee cccccccccaaaaaaaaannnnnnnnn
aaaaaaaaaaaaaaaaaaarrrrrrrttttttttthhhhhhhhhaaaaaaaaa
sssssss iiiiiiiiiiiiiinnnnnnnnnnnndddddddeeeeeeeeeyyyyyyyyyyyyyyyyyyyyyyyyyyyyy ccccccccc
hhhhhhheeeeeeeeeeeeeeeeeeee sssssssss sssssssssuuuuuuuuu Managing Employees
mmmmmmmpppppppllllllloooooooyyyyyyyeeeeeeeeeeeeeesssssss,,, cccccccooooooolllllllllllllleeeeeeeccccccctttttttiiiiiiinnnnnnn aaaaaaannnnnnnddddddd rrrrrrreeeeeeepppppppooooooorrrrrrrtttttttiiiiiiinnnnnnnggggggg dddddddaaaaaaatttttttaaaaaaa,,, cccccccooooooonnnnnnntttttttrrrrrrriiiiiiibbbbbbbuuuuuuutttttttiiiiiiinnnnnnnggggggg tttttttooooooo RRRRRRRIIIIIII aaaaaaaccccccctttttttiiiiiiivvvvvvviiiiiiitttttttiiiiiiieeeeeeesssssss nd ensuringgggggggggggg regggggggggggggulatoryyyyyyyyyyyyy comppppppppppppliance are all Supppppppppppppppppppppppport pppppppppppprocesses that
i b b l th C t ith i di ti
eeeeeeeeeeeeeeeeemmmmmmman
ooooooo LLLLLLLLLLLLLLLLLRRRRRRRces
iiiiii d
ggggggggg aaaaaaatoryyyyyyyyyyyyyh
Managing Financial Reimbursement for Consumer Services
Contributing to LRI Activities Su
pp
ort
C
ust
om
er
SSSSSSlllllliiiiiiiiiiiiiiiiidddddddddddddddddeeeeeeeeeeeeeeeeeeee sssssssssssssssssssshhhhhhhhhhhhhhhhhoooooooooooooooooooowwwwwwwwwwwwwwwwwwwwssssssssssssssssssss aaaaaaaaaaaaaaaaaaaa pppppppppppppppppppprrrrrrrrrrrrrrrrrrrroooooooooooooooooooocccccccccccccccccccceeeeeeeeeeeeeeeeeeeessssssssssssssssssssssssssssssssssssssss mmmmmmmmmmmmmmmmmmmmaaaaaaaaaaaaaaaaaaaapppppppppppppppppppp wwwwwwwwwwwwwwwwwwwwiiiiiiiiiiiiiiiiittttttttttttttttthhhhhhhhhhhhhhhhh hhhhhhhhhhhhhhhhhiiiiiiiiiiiiiiiiigggggggggggggggggggghhhhhhhhhhhhhhhhh lllllllllllllllll eeeeeeeeeeeeeeeeeeeelllllllllllllllll ccccccccccccccccccccuuuuuuuuuuuuuuuuuuuusssssssssssssssssssstttttttttttttttttoooooooooooooooooooommmmmmmmmmmmmmmmmmmmeeeeeeeeeeeeeeeeeeeerrrrrrrrrrrrrrrrrrrr aaaaaaaaaaaaaaaaaaaannnnnnnnnnnnnnnnnnnnddddddddddddddddd ssssssssssssssssssssuuuuuuuuuuuuuuuuuuuuppppppppppppppppppppppppppppppppppppppppoooooooooooooooooooorrrrrrrrrrrrrrrrrrrrttttttttttttttttt s map ith high le el c stomer and sBuilding Relationships with and for Consumers
Ensuring Regulatory Compliance
p
prrrrrroooooocccccccccccccceeeein theeeeeeerelattttiipreppppptranssssssssprocccceeeedeveeeeeeeeconssssssssspecccccccctranssssssssss
ltra
Prep
arin
g Con
sum
ers
for
Tran
sition
tiiiiiiiiiiiiiiiiiiiiiiiiiooooooonnnnnnn aaaaaaaccccccctttttttiiiiiiivvvvvvviiiiiiitttttttyyyyyyy cccccccaaaaaaannnnnnn aaaaaaappppppppppppppeeeeeeennnnnnn aaaaaaattttttt aaaaaaannnnnnnyyyyyyy aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaassssssssssss. The other boxes within custoooooooooooooooooooooooooooopppppppppppppinggggggggggggg action ppppppppppppplans which impppppppppppppacttttttttttttttttts
t iti d t iti i
ther boxes witPreparing for Consumer Transition
sssssssssssssssssssses andddddd hhhhhhow iiiiiinfffffformattttttiiiiiion ffffffllllllows a ong tttttthhhhhhe processes. SSSSSSttttttarttttttiiiiiing cccccccccccccccccccccccccccuuuuuuuuuuuuusssssssssssssttttttttttttooooooooooooommmmmmmmmmmmeeeeeeeeeeeeerrrrrrrrrrrr ssssssssssssseeeeeeeeeeeeecccccccccccccttttttttttttiiiiiiiiiiiiooooooooooooonnnnnnnnnnnn – iiiiiiiiiiiinnnnnnnnnnnnffffffffffffffooooooooooooorrrrrrrrrrrrmmmmmmmmmmmmaaaaaaaaaaaaattttttttttttiiiiiiiiiiiiooooooooooooonnnnnnnnnnnn fffffffffffffflllllloooooowwwwwwwwwwwwsssssssssssss ffffffffffffffrrrrrrrrrrrrooooooooooooommmmmmmmmmmm tttttttttttthhhhhhhhhhhheeeeeeeeeeeee bbbbbbbbbbbbbuuuuuuuuuuuuuiiiiiiiiiiiilllllllllllldddddddddddddiiiiiiiiiiiinnnnnnnnnnnnggggggggggggggggggg
mation flows among the procinformation flows from the bAssessing Consumer Needs
onnnnnnnnnnnnnnnnnnnnnnnnnnssssshhhhhhiiiiiipppppsssss wwwwwiiiiiitttttthhhhhh cccccooooonnnnnsssssuuuuummmmmeeeeerrrrrsssss bbbbbboooooxxxxx ttttttooooo tttttthhhhhh aaaaasssssssssseeeeessssssssssiiiiiinnnnnggggg cccccooooonnnnnsssssuuuuummmmmeeeeerrrrrsssss aaaaannnnndddddd nggggggggggggggg consumers for transition box. The pppppppppppppreppppppppppppparinggggggggggggggg consumers for
ti ti it h t d ll i t i th STS
gon box The preparinDeveloping Action Plans
mmmmmmmmmmmmmmmmmmmmmmmmmmmmmmeeeeeeerrrrrrr tttttttrrrrrrraaaaaaannnnnnnsssssssiiiiiiitttttttiiiiiiiooooooonnnnnnn ddddddd tttttttrrrrrrraaaaaaannnnnnnsssssssiiiiiiitttttttiiiiiiiooooooonnnnnnniiiiiiinnnnnnnggggggggggg caaaaaaaalized services plans also feedsssssssss tiiiiiion pppppppppppprocess. Managgggggggggggginggggggggggggg financiaaaaaaaaaaaaaaaal
ll ti d ti dMan
ces plans alTransitioning Consumers
eeeeeeeeeeeeeeeeeeeeeeeeeeeeevvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvveeeeeeeeeeeeeeeeeeeee eammmmmmoamo
SSSSSSSSSSSSSSSSSSSSSSSSSSSSSllllllllllllllllpppppppppppppppppprrrrrr
eeeeeeeee affffffflllllllooooooooowwwwwwweeeeeeeeeeeeeeeeeee aaaaa
g Ac
n hhhhhhhhhhhhhhhhhhhannnnnnn hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhaaaaaaaibbhhhhhhh
aaaaaaaaaaaaannnnnnnnnnnnnnnnnnnddaaaaaaaaaaaaaaaaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnndddddddlplapla
SSSSSSTe SSSSSSSSSSSSSTerrrrrrrrrrrrrrrr ppprrroooccceeessssss ssseeeccctttttttiiiiiii aaarrreee rrrrrrr flows to preparing for nnnnnsssssssumer. Implementing e preparing for consumer immmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmbbbbbbbbbbbbbbbbbbbbuuuuuuuuuuuuuuuuuuuurrrrrrrrrrrrrrrrrrrrsssssssssssssssssssseeeeeeeeeeeeeeeeeeeemmmmmmmmmmmmmmmmmmmmeeeeeeeeeeeeeeeeeeeennnnnnnnnnnnnnnnnnnntttttttttttttttttttt, mmmmmmmmmmmmmmmmmmmm nnnnnnnnnnnnnnnnnnnnaaaaaaaaaaaaaaaaaaaaggggggggggggggggggggiiiiiiiiiiiiiiiiiiinnnnnnnnnnnnnnnnnnnngggggggggggggggggggggmmmmmmmmmmmmmmmmmmmmaaaaaaaaaaaaaaaaaaaaaaaaaaannnnnnnnnnnnnnnnnnnn
ooonnn
Implementing Special Services Plans
omesssssssssss or
stoooooooooooooooooctttttttttttttttttttttttttts
errrrrrrrrrrrrrrr
eseeee
cccceeeeheeeeeee
ssssssssssssscccccccccccccuuuuu
oaaaaaaaaaaaaaaaaa
ttttiipppppppppppppppppppppaaaaaaaaaaaaa
onnnnnnnnnnnsrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrin
eeeeeeeeeeeeeesssssssssssslo
ccccceeeeeeeeeeeeeeee
ssssssssssssssooooooooooop
iaaaaaaaaaasitccccccccccsssssssss
aaaaaaaaliztiiiiiio
“ Slide shows a process map with high level customer and support processes and
how information flows among the processes. Starting in the customer section –
information flows from the building relationships with consumers box to the assessing
consumers and preparing consumers for transition box. The preparing consumers
for transition activity can happen at any and all points in the STS process. The other
boxes within customer process section are developing action plans which impacts or
flows to preparing for consumer transition and transitioning consumer. Implementing
specialized services plans also feeds the preparing for consumer transition process.
Managing financial reimbursement, managing employees, collecting and reporting data,
contributing to Liberty activities and ensuring regulatory compliance are all Support
processes that are in boxes below the Customer processes with arrows indicating that
these processes support the STS department so they can support the consumer.”
Ray Crawford John MarateaBruce Connus Gretchen Bell
Key Observations During WorkshopsUnaware of actual workload
Feeling separate from organization as a whole
Understaffed or unable to work as efficiently as possible/needed
Eager to converse about responsibilities and point of views
Frustrated with the task of the process workshops
Focused on the improving of their department
Works directly with consumers
Collaborates with many other departments
Works with external entities
Demonstrates great authority over others
Who and what we observed
The first process meeting we attended
was for Retreads, a department that
repairs and loans durable medical
equipment. Gretchen Bell, the Program
Coordinator, attended this meeting on
behalf of her department. During this
session, we were just observers. We
were able to grasp how the workshops
were facilitated. We also understood
the type of information that should be
gathered at the end of the workshop.
Gretchen expressed her concerns
during the workshop. She felt as if many
of the departments in Liberty were
unaware that Retreads existed.
We seen this as a major issue because
Retreads is responsible for repair and
donation of durable medical equipment
(D.M.E) to many Liberty consumers. If
these matters are not being directed to
Retreads, who is handling these issues?
After the Retreads workshop our team
was trusted to facilitate the Workshops
ourselves. We ran workshops for
three more departments, Liberty
Housing Development Corporation,
Liberty Wheels, and Facilities. During
these workshops we met several very
interesting people. Many of these
individuals shared similar feelings and
concerns, which they expressed during
the workshop.
The four representatives of the different departments we worked with during our process workshops and a visualization of our observations.
29PROCESS
Seeing with our own eyes
Following the approval of our design proposal,
we were given permission to shadow various
Liberty employees in order to gain a better
understanding of the processes. We felt
that shadowing would allow us to gain a
better understanding of Liberty’s services
through a consumer’s point of view. Our
shadowing phase began with the Specialized
and Transitioning Services (STS) department,
more specifically Support Coordinators.
STS aims to increase awareness and assist
consumers regarding transitioning from a
nursing facility into the community. STS also
offers and provides specialized services to
consumers who are in nursing homes and
choose to remain there.
We decided to shadow the Supports
Coordinators in this department. A
Supports Coordinator (SC) acts as the
liaison between the consumer and Liberty,
informing the consumer of all the services
SHADOWING& INTERV IEWING
The Philadelphia Nursing Home, one of institutions we visited while shadowing Tameka Blackwell.
31PROCESS
Liberty Resources offers. SCs are also
responsible for keeping the consumer
abreast with where they are in the
process and inform them as to what
is needed to advance to the next step
towards independence.
Empathy in Action
We shadowed Tameka Blackwell,
a Supports Coordinator, on two
occasions. The two facilities we visited
were Philadelphia Nursing Home
(PNH) and Somerton Rehab Center.
In both instances, she went to visit her
consumers, checking up on them and
updating them on their status towards
independence.
A critical piece of Tameka’s job is to be
empathic to each consumer’s situation.
Tameka embodies empathy. She is
disabled and completely understands the
difficulty associated with it. She takes the
time to gather the information needed
for the process but also to really gets
to know her consumer and reassures
them that their goals for independence
will be reached. From our shadowing
experience, we could really see that
her consumers knew she was trying
her best to allow them to experience
independence as soon as possible.
Our visits to the Nursing Facilities had a
huge impact on our group. Being able to
listen in on the conversations between
Tameka and the consumer really
strengthened our argument that the
process needs to be examined from the
consumer’s point of view. The consumer
brings in a new perspective on how the
services that Liberty offers are received.
Tameka Blackwell, Supports Coordinator, Specialized and Transitioning Services.
32 PROCESS
Liberty’s services are not your typical
“off the shelf ” services. Everything they
offer is life changing. So much so that,
it is important that Liberty receive
feedback from consumers as to how to
improve and suggest new ideas to be
considered for implementation..
Identifying shared concerns
Along with shadowing Tameka, we also
interviewed her and her two colleagues:
Jamie and Ridshedia, who are also
Supports Coordinators within the STS
department. Their feedback offered
us a better insight into the day to day
interaction with the consumer. We were
also able to identify particular issues
and concerns that were shared among
the three women in regards to how
the consumer experience is affected by
internal processes.
Jamie Palagruto
Ridshedia Emmens
34 PROCESS
When asked “what is was the most
difficult thing for the consumer”,they
explained,
“ The waiting is the hardest for the consumer, sometimes it is hard to find out where they [the consumer] are in the process”The consumer should know where
they are in the transitioning process at
all times. The current system does not
afford this. How can we, as designers,
help in this situation?
Another concern of theirs was the fact
that departments were not actively
collaborating with each other. When
asked, “What she would like to see
change at Liberty?” Tameka answered,
“ better communication... one hand and doesn’t know what the other is doing”
STS relies on many other departments
to get the consumer the services they
need. When the communication and
collaboration between departments is
not efficient, the process of consumer
independence, which can often take
a long time, can become even more
lengthy.
This is very unfortunate for the
consumer who obviously, and as we had
the opportunity to see with our own
eyes, is very eager to move forward with
living independently.
We began to see a clear connection
between these two concerns of the
Service Coordinators. In fact we
began to wonder whether there was
a mystery to where the consumer is
in the process because of a lack of
communication and collaboration or if
there was a insufficient communication
and collaboration because of a lack
35
of understanding the process. We
concluded that it was in fact both.
This realization really stuck out to us
as designers.
Why is this occurring?. . How can we assist in cross-departmental collaboration and tracking consumer progress?
Seeing what others see
Within Liberty are various types of
disabilities. We developed a sense of
appreciation for many daily tasks that
we so often overlook. We also began to
be more cognisant of our designs and
their accessibility. With this in mind, we
decided to meet with Fran and Cecilia
from the Independent Living Services
department. Both of these women are
blind and we felt it would be a great
opportunity to get some feedback on
some of the solutions we had in mind.
They provided insight as to how to
write and present information to
individuals who are visually impaired.
This was intriguing because we had not
realized some of the difficulties they
encounter day to day. We were able to
take their feedback and use it to better
inform our concept directions.
Perhaps the most important thing that
they had brought to our attention was
their frustration with the process maps
being generated by Quality Management.
While the process mapping that was
being done could be read by a screen
reader by adding the white text in
the background, the content itself was
difficult to understand. The language
used and the fact that it was more
of a description of a visual than
a communication of ideas made
comprehension of the content difficult.
36 PROCESS
They further explained that persons
who are visually impaired are not the
only ones who would have difficulty
comprehending these process maps.
There are also persons with cognitive
disabilities who would have even more
trouble understanding just what the
maps are supposed to
be communicating.
We found this information to be
very insightful and wondered, in an
organization where more than 51% of
employees have some disability, how
many would struggle to comprehend
the information the process maps hold?
“ make the language simple... the less words the better”
Cecilia Ramnathsingh
Fran Fultan
37
Chapter 4 CONCEPTSAreas of Focus
Deliverables
Impact
Moving Forward
what?
Throughout our experience at Liberty,
the people we interacted with, and the
actions we observed led us to three
main areas of focus:
I. Collaboration
There are many departments involved in
the process of providing independence
to consumers. With that being said,
internal collaboration is key. As it
currently stands, there is not a sufficient
amount of transparency within
departmental functions. Liberty needs
a way to more directly collaborate with
each other in order to better serve the
consumer and further more they must
broaden the scope of collaborative
parties. The more that different
departments corroboratively work
to one end the more informed and
successful that end will be.
AREAS OF FOCUS
40 CONCEPTS
II. Knowledge
One of the larger issues we discovered
is the lack of a broader understanding
as to how the organization functions,
and just how much Liberty offers both
employees and consumers. Although
each employee must take part in a
three-day orientation session, it is
impossible for everything to be covered.
It is also, as we have learned first hand,
very difficult to comprehend all of the
information in the orientation manual.
Aside from new employees, current staff
must also gain a better understanding
of other departmental functions and
specialties. Only then could departments
and individuals appropriately use others
as resources.
In respect to both the consumers and
Liberty staff, it is also necessary for the
process of consumer independence as
a whole to be clearly understood. Only
then can it be accurately communicated
and efficiently executed in a
timely fashion.
III. Empowerment
Perhaps one the most important aspects
of the role Liberty plays in the disabled
community is empowerment. In order
to provide the consumer with the rights
and capabilities the same as anyone
else, Liberty encourages the consumer
to take matters into their own hands
and makes very clear that every move
in the process to independent living is a
choice to be made by them. We wanted
to bring this notion to our designs and
provide the consumer with even more
tools to empower them and make
clear their choices in the process of
independent living.
41
Next, we needed to define more
precise design directions, what exactly
should we address and what form
would these solutions take. At this point
we began to brainstorm what designs
would be most impactful in improving
the processes in regards to both the
employee and consumer experience. We
decided to incorporate 4 main design
directions to fit our areas of focus:
1. Addressing the accessibility of the process maps.
2. Tools for collaboration between departments.
3. Tools for tracking a consumer’s progress.
4. Tools for empowering the consumer.
42 CONCEPTS
Communicating complex ideas
With the information we learned from
Fran and Cecelia regarding the process
mapping, we developed an alternate
mapping technique to accompany the
graphic representations. The original
maps that had been developed show the
connection between each process and
their dependency on each other, but upon
first glance, this is hard to see because the
maps are extremely complex. The multiple
slides representing the information do not
allow for broad comprehension. Even after
a more detailed look, it is still difficult to
understand exactly what message is
being conveyed.
We developed a narrative version of
the maps in order to aid in a better
understanding of exactly what the
processes maps were communicating. We
wrote it to read as a story, delivering all
content on one level. This way, whether
using a screen reader or not, everyone
DEL IVERABLES
43
was able to understand exactly what is
being mapped. Following is an example
of the narrative we developed:
There are 5 main consumer focused task
groups (or processes) under Liberty Housing
Development Corporation (also known as LHDC).
These are:
Developing Accessible Housing
Options for Consumers.
Obtaining Funding for Housing
Projects.
Managing LHDC Controlled Units.
Developing Relationships with New
Landlords.
Assisting with placing consumers in
accessible housing.
All of these groups are dependent
on each other.
The primary operation of LHDC is to Develop
Accessible Housing Options for Consumers.
This is done through:
Developing LHDC Controlled Units.
Acquiring Existing Subsidized
Properties
Managing relationships with
existing landlords.
LHDC Obtains Funding for Housing
Projects by Applying for Funding and
Monitoring Funding.
LHDC Manages LHDC Controlled Units by doing
the following 6 tasks:
Insuring compliance with HUD
regulations.
Overseeing construction/guiding
architects.
Property management.
Assessing properties to meet HUD
environmental standards.
Managing environmental issues for LHDC
properties.
AnnualrecertificationforLHDCtenants.
44 CONCEPTS
LHDC Develops Relationships with New
Landlords by Filing Existing Accessible Properties
and Advocating for New Properties.
Finally, LHDC Assists with placing consumers in
accessible housing by doing the following 4 tasks:
Providing Status of available housing to
STS and HAD.
Process LHDC owned consumer
application.
Screening consumer criminal background
for HUD compliance.
Advocating for the consumer to the
landlords.
There are 4 main support task groups (or
processes) under Liberty Housing Development
Corporation (also known as LHDC). These are:
Managing LHDC Property Income.
Managing Employees.
Developing and Monitoring Budgets.
Reporting and Strategizing Projects.
LHDC manages LHDC property income by
collecting rent and managing income from LHDC
properties.
LHDC managing employees by managing
schedules, assessing employee performance and
obtaining new employees.
LHDC develops and monitoring budgets by
managing HUD and LHDC budgets and by
obtaining budget increases.
Finally, LHDC reports and strategizes projects
by reporting updates on existing projects and
developing strategies for new projects.
While this narrative may not be the
ideal means for conveying information
to every one. The combination of
this narrative along with the graphic
representation is a great first step
toward a universal method of
communicating the complex processes
of the departments within Liberty
Resources. The idea is to bring the
necessary methods together to allow for
accessibility on all levels of ability.
45
Departmental Reference Guide
This interactive tool can be used to inform
all employees of the different services
and offerings within Liberty. As Gretchen,
from Liberty Retreads, mentioned
during her process workshop, many
liberty employees are unaware of her
department’s services. This tool offers a
solution to this problem.
The main page gives a graphical overview
of all the department and services. Each
department is represented by an icon.
Once an icon is selected, the user will be
directed to another page which gives a
detailed outline of each department. This
outline includes information concerning
that department, their speciality and
offerings. This interactive document has
been made accessible and mobile as it
allows for screen reader navigation and
can be used on the go with any mobile
phone with a PDF reader.
The Cross–Departmental Resources interface as seen on a mobile phone.
A view of the Cross–Departmental Resources interface.
CONCEPTS 47
Having all departments in one location
and giving each department its own
identity provides a sense of equality
among the many departments,
emphasizing the fact that each plays an
important role in the organization.
Testing for accessibility
We researched and experimented
with many different ways to create
accessible interactive documents. Fran
and Cecelia were the first to test out
this tool for accessibility. This was very
insightful, seeing the tool being used
in action. Even more interesting, Fran
suggested that we wear blind folds and
listen to the screen reader navigate the
document, to hear what she hears. This
further informed us of the importance
of accessible design for interactive
computer based tools.
Design team member, Jake Wells, wearing his blind fold as we listen to our interface design in action.
We wore blind folds to better understand how a visually impaired person uses a screen reader.
Fran navigating our initial prototype for the Cross–Departmental
Resources interface.
48 CONCEPTS
The Road to Independence Package
This Package has 3 components:
1. Map of Liberty consumer offerings.
2. Consumer Course of Action Cards.
3. Consumer Course of Action
Tracking Map.
All three components are made to work
together. The map of Liberty offering
is designed to be used during the
initial conversation with the consumer.
During this dialogue, the map allows the
consumer see the different paths that
can be taken to attain independence.
In addition, the map shows all of the
options Liberty offers. Because Liberty
serves consumers with all kinds and
levels of disabilities we conceptualized
and prototyped different methods of
delivering the information. Along with the
standard map and cards, we developed a
screen reader accessible interactive digital
tool for creating and tracking consumer
A mocked up prototype of the Consumer Course of Action Cards.
A prototype of the complete tactile version of the Road to Independence Map, made from laser cut ply.
A view of the Consumer Course of Action interface for tracking consumer progress.
CONCEPTS 51
progress and a tactile braille version
of the Road to independence Map.
The starting point is represented by
tri-directional arrow. Each direction
represents the paths for : simply using
services that are available to all at all
times, to transition from facility to
community, and those who are already
in the community but need further
assistance. There is a color distinction
between services that are available at
any point in the independence process
and those that are only available during
specific stages in the process (orange
and green, respectively) Independence
is represented by a blue star. With all
this information, the consumer can then
decide which path they would like to
take and the options that they will take
advantage of.
Once the consumer decides on their
preferred path towards independence,
an individual map, customized to
include all the choices made by the
consumer will be made by the SC. This
digital map will allow the SC to click
(to add or remove) all the services
chosen by the consumer. Each option
chosen is hyperlinked to a document
which provides more detail about
the consumer and their needs. If the
needs of the consumer change during
the process, the change can be easily
made. This document will be made
available to the consumer as well as all
departments involved in the consumer’s
process. Having this information in one
location allows different departments
to efficiently collaborate and share
important information regarding exactly
where the consumer is in the process at
any given time.
52 CONCEPTS
Prior to this, each department saved
information about the consumer either
on their own computers or somewhere
on the a shared drive. In some cases,
other departments were not able
to access this information and if the
information could be accessed, it would
be like “looking for a needle in
a hay sack”.
Empowering the Consumer
The customized map that is provided
to the consumer reiterates the choices
made during the initial conversation
with the Supports Coordinator. Along
with the map, a deck of Consumer
Course of Action Cards will be given
to the consumer. These two-sided cards
provide more information about the
options chosen.
On the front of each card is a summary
of the offerings of the given service. On
the back, is a list of information needed
from the consumer in order for them
to advance to the next stage on the
road to independence process. This is an
empowerment tool for the consumer.
They now have a better understanding
of what is expected from them and are
an active participant in their road
to independence.
Our prototype of the Consumer Course of Action Cards.
CONCEPTS 55
Testing for accuracy
We showed Tameka our Road to
Independence package in order to check
for accuracy and usability. We explained
to her the different areas which it
addressed and allowed her to interact
with it. The package was well received.
Tameka loved the idea of the central
tracking. She expressed that with the
old system, she was less likely to “track”
down people or search through the
system for the information she needed.
With this new design, “everything is just
a mouse click away.”
Showing our initial consumer tracking interface concept to Tameka.
Tameka, providing feedback regarding our initial Road to Independence Map.
Showing our initial Road to Independence Map concept to Tameka.
56 CONCEPTS
Cecilia, reading the information on our acrylic Braille prototype.
Feeling information
We also showed a Braille prototype to
Fran and Cecilia in order to see if it met
the needs of the visually impaired. Both
loved the idea. They especially liked the
durability of the product. The material
used was able to withstand wear and tear,
unlike what they are currently using. The
traditional paper that Braille is printed on
tends to significantly wear over time.
Cecilia, feeling one of our paper braille prototypes.
Cecilia, testing the readability of some of our braille prototypes.
CONCEPTS 59
Delivering our concepts to the client
We presented our designs on two
separate occasions. Our first audience was
the Process & Measures team. The team,
though aware of our interactions with
staff members outside of the team and
our active research in shadowing service
coordinators, had really no idea of the
concepts we had been developing. The
team was very pleased,
Michael Smith,
“ You showed us how they (the process maps) relate to the consumer which is very helpful information for us as a group: to see how what we are doing relates back to what will ultimately be the impact of the processes on the individual.”
IMPACT
Mike Smith, Director of Quality Management, during our final presentation to the process and measures team.
Tom Earl commenting on our design concepts during our final presentation.
CONCEPTS 61
Linda – COO,
“ It expresses to them, (the consumer) the individual, step-by-step, where they are (in the process).... I love the cards. The
cards are great!” Tom – CEO,
“ It’s interesting... Consumers will have access to their information and not anyone else’s. That is pretty neat.... I like it. Excellent job!”
Tom Earl, CEO, during our final presentation.
Linda Dezenski, COO, during our final presentation.
62 CONCEPTS
Next steps
We would like to continue developing
tools to aid the consumers on their path
to independence. Further research in
accessibility and interactive technologies
will be our main focus. We believe bringing
the prototypes and concepts to the
consumers will further inform our designs
and allow for the necessary iterations to
achieve the most effective solutions.
What we learned
Perhaps one of the most important
things we have gained as designers
is the realization of our impact on a
larger community. We had very little
understanding as to how persons with
disabilities are left out of so many of the
designs today. We now must challenge our
selves to design for accessibility from the
beginning of our creations and not as a
second thought.
MOVING FORWARD
63
top related