John Patrick Publishing - St. William the Abbot

Post on 31-Dec-2021

6 Views

Category:

Documents

0 Downloads

Preview:

Click to see full reader

Transcript

SERVED BY: Rev. Thomas Maher, Pastor Rev. James Redstone, Weekend Assistant Deacon Michael Abatemarco Deacon George Prevosti Deacon Kevin Smith SACRAMENT OF BAPTISM Baptisms may be arranged for most Sundays of the year at 1:00PM. Please call the parish office to schedule a Baptism. SACRAMENT OF RECONCILIATION Confessions are heard every Saturday after The 9:00AM Mass, 1/2 hour before each weekend Mass and Wednesday evenings at 6:00PM. RITE OF CHRISTIAN INITIATION OF ADULTS Those who wish to enter the Catholic faith and Catholics who wish to complete the sacraments of First Communion and Confirmation are most welcome to begin the journey at any time. Please call the parish office if interested. SACRAMENT OF MARRIAGE Engaged couples should call the parish office for an interview appointment one year before the wedding date. SACRAMENT OF THE SICK The Sacrament of the Anointing of the Sick will be administered at anytime. Please call the parish office. OBTAIN A MASS CARD During office hours we welcome those who would like to request that their special intentions or deceased loved ones be prayed for particularly at a weekday or weekend Mass. We ask for a donation of $10 per Mass. OBTAIN A CERTIFICATATE OF ELIGIBILITY: Registered parishioners who have been asked to be a Godparent or Confirmation Sponsor, should call the parish office to request a certificate of eligibility. REGISTER FOR THE PARISH We are so happy to welcome new members of our Parish Family! Please come to the parish office so that we can get your information and meet you. OFFICE HOURS: Monday thru Friday 9:30AM to 3:00PM

The Parish Family of

ST. WILLIAM THE ABBOT 2740 Lakewood Allenwood Road, Howell, NJ 07731

732-840-3535 www.stwilliamtheabbot.com

email: stwilliam@optonline.net

Our Mission We, the parish family of St. William the Abbot, a welcoming Catholic community, led by the Holy Spirit, are called to proclaim, and to witness to,

the Good News of Salvation, so that we may grow together, among all generations, and

advance the Kingdom of God, in our love and service of God and neighbor.

COME WORSHIP WITH US

Weekends Saturday: 5:00PM

Sunday: 8:00AM, 10:15AM, 11:45AM

Weekdays Monday & Tuesday: 9:00AM

Wednesday: 9:00AM & 7:00PM Thursday, Friday & Saturday: 9:00AM

The Most Holy Trinity May 30, 2021

Why is it so important to register with a parish? Registration is the official way we join a parish community. Some people think that because they attend a particular parish they automatically belong. Registering as parishioners requires signing up, formally enrolling yourself in a parish. Registration is a commitment to a community, a way to be included in the religious, social and ministerial activities of your parish. Registration shows you belong. It is also necessary for cer-tain benefits, like scheduling sacraments, obtain-ing a sponsor certificate, and getting donation statements for your taxes. Most importantly, it lets the parish count on you, to call on you to assist in its mission. Registering in your parish is a statement of faith and confidence in the life and work of your parish.

Rosary Thank you to everyone who handed in their tally sheets for praying the rosary. So far we have prayed the rosary 2,536 times. Congratulations! Keep up the good work! Remember

to pray one decade for St. William the Abbot Parish. The Rosary is also prayed here in the church after the 9AM Mass everyday. Join us in person or online.

Here is the link to our Facebook page: https://m.facebook.com/Saint-William-the-Abbot-Catholic-Church-174135519840986/?tsid=0.37482415393666724&source=result

May 30, 2021 Page 1 #566

Weekly Collection for May 23 $4,272 Vigil Candles 364 Total $4,636 93 Envelopes Thank you for your generosity! If you are inter-ested in our online giving program, please go to our website and click on the link for WeShare.

Requirements to Obtain a Sponsor Certifi-cate/Letter of Eligibility The godparents, together with the parents, must be willing to help the baptized grow in love for Christ and neighbor. By word and example, the godparents will encourage the candidate to live the Christian life and fulfill faithfully the obliga-tions connected with it. (cf. Code of Canon Law, c. 872-874)

A sponsor must have received the Sacra-ments of Baptism, Holy Eucharist, Confirma-tion, and if married, married in the Catholic Church. A sponsor must be at least 16 years old. A sponsor attends Mass faithfully participat-ing in the life and support of the Church, receiving the Eucharist, and leading a life according to the teachings of the Church. A sponsor must be registered here at St. William. If he/she received all his/her sacra-ments here at St. William, but does not live here, they are not a member of this parish but a member of the parish whose territory he/she now resides in. That parish is the one to go to, to receive a sponsor certificate.

Catholic Charities provides as-sistance with food, housing, drug addiction, domestic vio-lence and immigration services. If you know of a parishioner needing help, please contact us

at www.catholiccharitiestrenton.org or call 800-360-7711.

REST IN PEACE Please pray for those who have recently died, may they rest in peace. Eternal rest grant unto them, O Lord, and let thy perpetual light shine upon them. And may the souls of all the faithful departed, through the mercy of God, rest in peace. Amen

Choose weekly or monthly do-nation

Update desired offering any time

And, print your year-end state-ment in seconds—at any time!

Online giving is the best way to support St. Wil-liam the Abbot—now more than ever! It pro-vides steady support, it’s environmentally friend-ly, and less costly than using envelopes. Look for the WeShare link on our website.

Please bring health, healing and hope to those in our community who are sick especially Ana Guillermo, Jonathon Capriotti, Emily Capriotti, Dakota Schick, Judy O’Connor, Anna O’Connor, Evelyn Zeliff, Robby Isabella, Liz Czar, Michele Barbito, Maribel Mejias, Nuala Brennan, Ann Murphy, Yuri Turchin, we also ask you Lord, to watch over all those with incurable autoim-mune diseases and for all those who are afflict-ed with MS, CF, Lou Gehrig’s disease, for those who suffer from Alzheimer disease, dementia, addictions, and their families. God of all consolation, give life and health to our sisters and brothers for whom we

pray in your Holy Name. Amen.

“It is a holy and wholesome thing to pray for the living and the dead.” II Mac. 12:46

Saturday, May 29 St. Paul VI, Pope 5:00 People of the parish Sunday, May 30—The Most Holy Trinity + 8:00 Bob & Ellamae New req The New Family +10:15 Peter Cerreta, Sr. req Deacon George +11:45 Stella & John Jankowski req Terry Kelly Monday, May 31—Memorial Day + 9:00 John Lonergan, an Army Veteran req Loving Friends Tuesday, June 1 St. Justin + 9:00 Diane Davalos req Luann Clarkson Wednesday, June 2 Sts. Marcellinus and Peter, Martyrs + 9:00 Thomas Gaven, Jr. req Charlie & Debbie Garofano 7:00 Special Intention for Joe Nitti req M/M Charlie Vitale and family Thursday, June 3 St. Charles Lwanga and Companions, Martyrs + 9:00 Paul May req M/M Charlie Vitale and family Friday, June 4 9:00 Special Intention for Fr. Jim req M/M Ron Neal Saturday, June 5 St. Boniface, Bishop & Martyr + 9:00 Peter Cerreta, Sr. req M/M Billy Lawler + 5:00 Dennis Gilbert req Deborah & Danny Pfeiffer Sunday, June 6 8:00 People of the parish 10:15 Special Intention req The Pangaro Family +11:45 Brian O’Reilly req the Cantone Family

May 30, 2021 Page 2 #566

The Annual Catholic Appeal has begun. Let’s make our goal again!

Why is the Annual Catholic Appeal important? As members of our diocesan family, we are called upon to love and serve all of our brothers and sisters – both within our Catho-lic community and beyond. Your contribution to the Annual Cath-olic Appeal allows our diocese to continue to serve as a resource to the parishes and other organizations in their efforts to provide service, evangelization and outreach to people throughout Bur-lington, Mercer, Monmouth and Ocean Counties.

Thank you to the 113 donors who have already donated. They have given $22,487, which is 80% of our goal of $28,000. If you haven’t given yet, please consider it. Pledge cards are in the parish office.

The Word Among Us is available in the parish office for purchase. It is a monthly publication that has the Mass, readings and medita-tions. It is $5.

May 30, 2021 Page 3 #566

M n d y Or n T

This closing section of Matthew’s gospel comprises what has come to be called “The Great Commission.” By reason of their baptism, future converts will be able to share God the Son’s life. Additionally, they will acknowledge the fact that, according to Jesus, God is three Persons yet One. “Be who God meant you to be and you will set the world on fire!” St. Catherine of Siena

Sunday May 30 The Most Holy Trinity

Monday May 31 Memorial Day

THE VISITATION OF THE BLESSED VIRGIN MARY With hospitality and affection, Elizabeth greets her cousin Mary, the bearer of the Mighty Savior. Pray the Rosary today for our country. Happy Memorial Day!

Tuesday June 1 St. Justin

St. Justin, philosopher and martyr, was born of pagan parents at Flavia Neapolis in Samar-ia at the beginning of the second century. Following his conversion to the faith he wrote many works in defense of religion, of which we have only two: the Apology and the Dia-logue with Trypho. He also opened a school at Rome in which public debates were held. Justin was martyred along with several companions during the reign of Marcus Aurelius around the year 165.

Wednesday June 2 Sts. Marcellinus and Peter

Pope Damasus is our authority for the martyrdom of Saints Marcellinus and Peter during the Diocletian persecution. He received this information from the executioner himself. They were beheaded in a grove, but their bodies were moved and buried in the cemetery Ad duas Lauros on the Via Labicana. Once peace had been restored, the Church built a basilica over their tombs.

Thursday June 3 St. Charles Lwanga and Companions

Owing to religious hatred, many faithful Christians were killed in Uganda by King Mwanga during the years 1885-87. Some of them had enjoyed the good graces of the king at his court, and some were even related to him. Among them, Charles Lwanga and his twenty-one companions, adhering steadfastly to the Catholic faith, were put to death, some by sword, others by burning, because they would not accede to the king’s unreasonable de-mands. Pray for all the people in the world who are still being persecuted for their faith.

Friday June 4 First Friday

What am I supposed to do on First Fridays? Go to Mass and receive Holy Commun-ion with the intention of honoring Christ’s Sacred Heart. If you are not in a state of grace, and thus unable to receive, you will also need to go to confession. What are the “promises” connected to this devotion? Jesus said to St. Margaret Mary, “In the excess of the mercy of my heart, I promise you that my all powerful love will grant to all those who will receive communion on the First Fridays, for nine consecutive months, the grace of final repentance: they will not die in my displeasure, nor without re-ceiving the sacraments; and my heart will be their secure refuge in that last hour.” This means that if a person faithfully receives communion for nine consecutive months on First Fridays, Jesus will grant that person extra graces at the time of their death, making it pos-sible to repent of theirs sins and receive the last rites (if needed).

St. Boniface was born in England about the year 673. He was first professed in the monas-tic life at Exeter but in 719 went to Germany to preach the Gospel. He made many con-verts there and was consecrated bishop, ruling over the church at Mainz. He attracted many companions by whose help he founded or restored dioceses in Bavaria, Thuringia and Franconia. He also convened councils and promulgated laws. While preaching the Gospel to the Frisians, St. Boniface was killed by pagans in 754. His body is buried in the monastery of Fulda. Ask God for a new grace today that will bring you closer to him.

Saturday June 5 St. Boniface

May 30, 2021 Page 4 #566

From the Catechism of the Catholic Church I. "IN THE NAME OF THE FATHER AND OF THE SON AND OF THE HOLY SPIRIT" 232 Christians are baptized "in the name of the Father and of the Son and of the Holy Spirit" Before receiving the sacrament, they respond to a three-part question when asked to confess the Father, the Son and the Spirit: "I do." "The faith of all Christians rests on the Trinity."

233 Christians are baptized in the name of the Father and of the Son and of the Holy Spirit: not in their names, for there is only one God, the almighty Father, his only Son and the Holy Spirit: the Most Holy Trinity. 234 The mystery of the Most Holy Trinity is the central mystery of Christian faith and life. It is the mystery of God in himself. It is therefore the source of all the other mysteries of faith, the light that enlightens them. It is the most fundamental and essential teaching in the "hierarchy of the truths of faith". The whole history of salvation is identical with the history of the way and the means by which the one true God, Father, Son and Holy Spirit, reveals himself to men "and reconciles and unites with himself those who turn away from sin".

May 30, 2021 Page 5 #566

St. Leo the Great Religious Store They are honoring Mary during the month of May. And are featuring devotionals for Our Lady, rosaries from Italy, statuary, Miraculous Medals, wall plagues, holy cards and many books to help you grow in prayer and faith. The store is located in the lower level of the Parish Center, in Lincroft. Their number is 908-770-1989. Website: www.stleothegreat.com/store

Catholic Charites Covid Outreach Update The primary goal of Catholic Charities’ Covid19 vac-cination outreach is to reduce barriers such as trans-portation, language, lack of health insurance etc., in the black and Hispanic communities. These commu-nities have been disproportionately impacted by the pandemic and are lagging well behind the vaccina-tion rate of the white population. Catholic Charities is educating communities about vaccines, recruiting and training community healthcare workers and hosting clinics at which to date, over 600 people have been vaccinated. To learn more about this work or to register to re-ceive a vaccination click on: https://www.catholiccharitiestrenton.org/covid19-community-outreach/

Blessed be the Holy Trinity and its undi-vided Unity; we shall ever give him thanks, for he has dealt with us according to his mercy. O Lord, our Governor, how admi-rable is your name in all the earth!

566 St. William the Abbot, Howell, NJ (inside) Sh John Patrick Publishing Company (800) 333-3166 • www.jppc.net

Quail Creek Pharmacy2 Ramtown-Greenville Rd

Corner Newtons Corner Rd., Howell785-9711 • Fax 785-1543

Open EverydayMona Salama - PharmacistRaouf Salama - Pharmacist

Personalized Service • Gifts • Greeting Cards

Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Work-ers - Critical Manufacturing - Chemi-cal & Hazardous Materials Financial Service - Private & Public Healthcare - Law Enforcement, Public Safety - Of-fi cers & First Responders - Food & Agriculture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & G W k C i i l M

To all those essential workers keeping us safe,

yourservice is

invaluable & appreciated.

afety --- OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOf cercercercercececeFirst Responders - Food & d & d & d &d &d &d &d &d &d d d d d d AgAgAAAAgAgAgAgrAgrAgrAgAgAgrAg

y Sector - WaWaWaWaWaWaWaWaWaWaWaWaWaWaWastestestestestesteteestestestestestestest &Waterwaste - Transportatatatttttttttion ionion ionioionion ioniononion onion & L& L& L& L& L& L& L& Lo& L& L& L& L& & gis

cs - Public Works & - Infrnfrnfrnfrnfrnfrnfnfnfnfnfrnfrnfrnfrnfrastructuucucucucucucuc rCommunications & IIIIIIIIIIIIIIInfornfornfornfornfornfornfornfonfornfornfornfornfornfornformatimammmmmmammmmmm o

echnology Workers - ComComComComComComComComComComComComComComCommunimumumummmmmmm ty &Workers -s -s -s -s -s -s -s -s -s -s --- CriCriCriririririiiiriiticacaticacacaticaticaticaticaticaticaticaticaticatical Ml Ml Ml Ml Ml Ml Ml Ml Ml Ml Mal l Ml M n

acturing - Chemical &&&&&&&&&&&l & l & l &l & HazaHazaHazaHazaHazaHazaHazaHazaHazaHazaHHHH rdourdrdrdrdrdrdrrdrdrdrdncial Services - DDDDDDDDDefeeeeeeefefens

dustrial Base - Commercial Faciles Workerssrssssss - RResidesidesidesidesidesidesidesididesidesidesidesideentientientientientientientientientiential &aaaaaaaa Shelteervices & FFFFFFFFFFFFFFFaciaciacilacilacilacilacilacilacilcilaciacilacilacilacilitieitieitieitieitieitietieitietieitieies -s -s - - - - - HyHyHygiHyHyHyHyHyHyHyHyHH ene Prodcts & Services es esesesesesesesesessss - Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Priiiiivivivivivivivaivaivativ e & Publiealthcare - Lawawawawawawawawawaw EnfEnfEnfnfnfnffnfnffffffforcorcorcorcorcorcorcorcorcorcorcorceorc ment, Publiafety - Officercercercercerererercercers &&&s &s &s &s &s &s &s &s &s &s &s &s & FiFiFiFFirsFFFFFFFFF t ResponderFood & Agrgrgrgrrrrriculiculiculiculiculiculiculiculiculiculicuiculiculicic turturturturturturureturturturturturtutut - Energy Secr - Waste e eee ee & Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& ttttterwtttettt aste - Trans

ortation &&&&& & & & & &&&&&& LogiLogiLogiLogiLogiogiogiogiLogiLogLogLogiLogLogLog stististststststisticststststsss s - Public Work- Infrastrtrrrrrrrrrrrrrrucucucucucuctctctuucucucucuctucuc re -e e e ee e CommunicationInformatioatioatioiooooooioooooonnn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Technology Worker

CoCoCoCoCoCoCoCoCoCoCoCoCoCoCommunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunity ity ity ity ity ity ity ity ity ity ity ity ityityity & Go&&&&&&&&&&& vernment Works - CrCrCrCrCrCrCrCrCrCrCrCrCrCrCriticiticiticticiticiticticiticiticticiiticiticiticitical al Mal Mal Mal Mal Mal Mal Mal a anufacturing - Cheml l ll & Ha& Ha& H& H& H& H& H& H& H& H&&&&& zardzardzardzardzardzardardardardardardardzardardardooooooous ooooooo Materials Financia

ervrvrvvvvice ice ice ice ice iceicicice icicicicicic - P- Pr- Pr- P- P- P- P- - - P- - - - ivativaivivvvvvvv e & Public HealthcarLaw EnEEE forcforcforcffforcforcforforcforcforcforceement, Public Safety - O

To all those nforcement, Public Sanforcement, Public Sa

essentiallture - Energylture - EnergyWater aste TraWater aste Tra

workerscs - Public Wors - Public WorCommunicatioCommunicatio

keepingechnology Wochnology Woovernment Wovernment W

us safe,acturing Caterials Finanaterials Finan

yournicationnicationWorkerWorke

service isovernment Workovernment Workacturing Chemacturing Chem

invaluable &us Materials Financiaus Materials Financiae & Public Healthcare & Public Healthcar

ment, Public Safety - OSafety - Othan

k yo

u

g gyWatateatttatatatattaaaaaa rwaswaswawaswwaswwwwaswwaswwwwasswasawawaw ste -tettttttetttee Transportation & Log

cccscccccc - PPPPPPPPPPPPPPPubliubliubliubliublililublibubbliubuubuuubu c c WoWoc WoWWWoWoWoWWoWWWoWc oc WoWWc Woc WWc WWWWccc rks rksrrksrkskrrkkkkrrk & - & -& -&& -&& -&&&&&&& --&&&& -&&& -&&& InfrInfInfrnfrInfInfrnfrII ffI ffInI fnfI fInfnfInnfnfn astructuCCoCoCoCoCoCoCCoCCoCCCCoooCCCCCCC mmunmmunmmmmmmunmm nmmmm nmmmmm nmmmm nnm nm nmmmm nicaticacaticaticatcatcatcatcattcatcatcatcattcatcatcatccacatcccatcc ionsionsionsnsionononsonsiooionssonsonsonsionoonoooon & I&&& I&& I&&& I& II& I& I& I&& nfornfornfornfornfornforforfornfornfoforfnfnfornfornfornfornforfofornfornforrrrnnffforrrmatimatimatmatmatiamatimatmattimatiatitimatiattatmatmatimattattmattmmmati

echhhhhhhhhnolonononoonnoloonolonnoln lonnolonooolonolonolonnnn on oonoo ggy Wgggg orkers - Community

WORSHIP

WITH US

Local, trusted, proven, effective, supportive, referrals, relationships, affordable, repetitious, versatile, lasting.

This describes the power of...

Placing an ad in the parish bulletin supports the parish while building your business - THAT’S A WIN WIN!

Call 1.800.333.3166 TODAY!

RIDESHAREZONES

A

M

I#WHATSMYNAME

toptop

sksk

atchatch

nformnform

566 St. William the Abbot-Howell, NJ (BACK) Sh John Patrick Publishing Company (800) 333-3166 • www.jppc.net

Kevin C. O’Brien, Manager - NJ Lic. No. 4805Kevin C. O’Brien, Manager - NJ Lic. No. 4805www.obrienfuneralhome.comwww.obrienfuneralhome.com

505 Burnt Tavern Road • Brick, NJ 08724505 Burnt Tavern Road • Brick, NJ 08724732-899-8600732-899-8600

2028 Highway 35 • Wall Twp., NJ 077192028 Highway 35 • Wall Twp., NJ 07719732-449-6900732-449-6900

Family Owned-Family Owned-Family FirstFamily First-Family Operated-Family Operated

FUNERAL HOME

Residential & Commercial

751-1560~ Parishioner ~NJ State Lic. #10329

LANGAN’SLANGAN’S P

H LLC

EmergencyService

Fully Insured

Atlantic Medical ImagingThe region’s premier medical imaging experts

MRI • CT • Coronary CTA • UltrasoundNuclear Medicine • DexaMammography • PET/CT

Centers of Excellence:Wall, Brick, Toms River, Galloway, Mays Landing, Egg Harbor Township, Northfi eld, Somers Point, Cape May, Hammonton

(732) 223-XRAY (9729)

Mark A. Santomenna, D.D.S.

Experience Positive, Personalized CareRamtown Plaza • 137 Newton’s Corner RoadHowell, New Jersey 07731

Tel 732-206-0408Fax 732-206-9807 www.RamtownDental.com

BASEMENT WATERPROOFINGMOLD REMEDIATIONFOUNDATION REPAIR

732-308-9988www.RightwayWaterproofi ng.com

RIGHTWAY WATERPROOFING CO.

FREE INSPECTIONLicensed & Insured

Family Owned and Operated Since 1987

Church

Member

Discounts

Mallory’s Army FoundationUnited Together In The Fight Against Bullying...

Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com

(973) 440-8657 • info@mallorysarmy.org It’s easy to join our mailing list! Just send

your email address by text message: Text MALLORYSARMY to 22828 to get started.

Message and data rates may apply.

Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if we can help Save you moneywith your monthly payments on your

commercial property. Multi-Family, Retail, Offi ce Building, Apartment and Condos.

Can close in as little as 45 days! Four season customer service is our top priority.

www.duqfunding.com1650 Market Street - Suite 3600

Philadelphia, PA 19103

Advertise Your Business Here800-333-3166

ext. 161or visit

www.jppc.net

Connecting businesses to customers in realtime!

top related