Improving protein content in cassava storage roots
Post on 31-Dec-2016
216 Views
Preview:
Transcript
Research Collection
Doctoral Thesis
Improving protein content in cassava storage roots
Author(s): Stupak, Martin
Publication Date: 2008
Permanent Link: https://doi.org/10.3929/ethz-a-005555839
Rights / License: In Copyright - Non-Commercial Use Permitted
This page was generated automatically upon download from the ETH Zurich Research Collection. For moreinformation please consult the Terms of use.
ETH Library
Diss. ETH No. 17557
Improving protein content in cassava storage roots
A dissertation submitted to
ETH Zurich
For the degree of
Doctor of Sciences
Presented by
Martin Stupak
Diplom-Lebensmittelchemiker Universität Karlsruhe (TH), Germany
Born January 2nd, 1978 Citizen of Germany
Accepted on the recommendation of:
Professor W. Gruissem, examiner Professor R. Amadò, co-examiner Professor P. Zhang, co-examiner
1
2008
I. Table of contents
I. TABLE OF CONTENTS 2
II. ABSTRACT 4
III. ZUSAMMENFASSUNG 5
IV. ABBREVIATIONS 6
V. INTRODUCTION 8
CASSAVA AND NUTRITION 8 BIOTECHNOLOGICAL APPROACHES TO CASSAVA PROTEIN IMPROVEMENT 11 AIMS OF THE THESIS 30
VI. X-RAY FLUORESCENCE SPECTROSCOPY AS A NEW METHOD TO DETERMINE SULFUR AMINO ACIDS IN CASSAVA STORAGE ROOTS 31
ABSTRACT 31 INTRODUCTION 31 MATERIAL AND METHODS 32 RESULTS 34 DISCUSSION 37 ACKNOWLEDGEMENTS 39 REFERENCES 39 FIGURES AND TABLES 41
VII. ER-RETAINED ASP1 INCREASES PROTEIN CONTENT IN CASSAVA STORAGE ROOTS 44
ABSTRACT 44 INTRODUCTION 44 RESULTS 46 DISCUSSION 49 EXPERIMENTAL PROCEDURES 53 ACKNOWLEDGEMENTS 55 REFERENCES 56 FIGURES AND TABLES 59
2
VIII. IMPORT OF A STORAGE PROTEIN INTO PLASTIDAL STROMA IS INHIBITED IN CASSAVA 66
ABSTRACT 66 INTRODUCTION 66 MATERIAL AND METHODS 67 RESULTS 68 DISCUSSION 71 REFERENCES 72 FIGURES AND TABLES 74
IX. EVALUATION OF VACUOLES AS A SUITABLE PROTEIN STORAGE PLACE IN CASSAVA 78
INTRODUCTION 78 MATERIAL AND METHODS 79 RESULTS 81 DISCUSSION 82 ACKNOWLEDGEMENTS 83 REFERENCES 84 FIGURES AND TABLES 86
X. DISCUSSION AND PERSPECTIVES 88
XI. VECTOR OVERVIEW 93
XII. ACKNOWLEDGMENTS 94
XIII. CURRICULUM VITAE 95
3
II. Abstract Cassava is one of the most important crops in tropical and sub-tropical developing
countries, providing a vital source of calories for over 600 million people. Despite the
high starch content, cassava roots are deficient in nutritional value, lacking significant
amounts of vitamins and protein. Here we show that Agrobacterium-directed
transformation of cassava with the heterologous storage proteins ASP1 and
sporamin leads to increases up to 3.2-fold in root total protein content and increases
in certain amino acids up to 9.6-fold, respectively, when retained within the
endoplasmic reticulum. Transient over-expression of zeolin in vitro resulted in stable
protein accumulation in vacuoles and ER. Furthermore, we demonstrate using
constructs of sporamin tagged to a signal sequence that the endoplasmic reticulum
and vacuoles are likely to be suitable organelles for protein storage, yet similar
experiments using ASP1 showed a lack of import into the plastids. We propose that
this is due to structural properties of the protein or otherwise construct derived.
These findings significantly enhance our understanding of protein content in cassava
roots and, moreover, offer scope for the development of cassava varieties to aid in
overcoming malnutrition in developing countries.
4
III. Zusammenfassung Cassava ist eine der wichtigsten Nahrungsmittelpflanzen in Entwicklungsländern der
Tropen und Subtropen und dient für mehr als 600 Millionen Menschen als
lebensnotwendige Kalorienquelle. Trotz des hohen Stärkegehalts haben
Cassavawurzeln einen verminderten Nährwert, da die vorhandenen Mengen an
Vitaminen und Proteinen die Schwellenwerte deutlich unterschreiten. Wir können hier
erstmals zeigen, dass die Agrobacterium-vermittelte Cassavatransformation der
beiden heterologen Speicherproteine ASP1 und Sporamin zu einer Steigerung des
Gesamtproteingehaltes um das bis zu 3.2-fache und einzelner Aminosäuren um das
bis zu 9.6-fache führt, wenn Proteinretention im Endoplasmatischen Retikulum (ER)
angewendet wird. Bei Überexpression des Proteins Zeolin in vitro konnte eine stabile
Proteinakkumulation in Vakuolen und im ER festgestellt werden. Ausserdem können
wir hier durch den Einsatz von Konstrukten, bei denen Sporamin mit
Signalsequenzen gekoppelt wurde, aufzeigen, dass das ER und die Vakuolen
höchstwahrscheinlich geeignete Organellen zur Proteinspeicherung darstellen.
Ähnliche Versuche mit ASP1 führten allerdings zu einem inhibierten Plastidimport,
vemutlich aufgrund struktureller Eigenschaften des Proteins oder durch andere
Nebeneffekte des Konstruktes. Diese Ergebnisse verbessern unser Verständnis der
Proteinspeicherung in Cassavawurzeln erheblich und eröffnen uns darüberhinaus
neue Möglichkeiten, die Mangelernährung in Entwicklungsländern erfolgreich zu
bekämpfen.
5
IV. Abbreviations
AA Amino Acid
AAA Amino Acid Analysis / Aromatic Amino Acids
AmA1 Amaranth Seed Albumin
ASP1 Artificial Storage Protein 1
AOAC Association of Official Analytical Chemists
BW Body Weight
BiP Immunoglobulin Heavy Chain Binding Protein
CLSM Confocal Laser Scanning Microscopy
DHPS Dihydrodipicolinate Synthase
EAA Essential Amino Acid
ER Endoplasmic Reticulum
FAO Food and Agriculture Organisation
FEC Friable Embryogenic Callus
FRAP Fluorescence Recovery after Photobleaching
GFP Green Fluorescent Protein
GUS β-glucuronidase reporter gene
KDEL Tetrapeptide comprised of Lys-Asp-Glu-Leu
PCR Polymerase Chain Reaction
PEM Protein-Energy-Malnutrition
PP2A Serine/Threonine protein phosphatase catalytic subunit 2A
PSV Protein Storage Vacuole
rbcS Ribulose Bisphosphate Carboxylase Small Subunit
RDI Recommended Daily Intake
RER Rough Endoplasmic Reticulum
RFP Red Fluorescent Protein
RNAi RNA Interference
RT Room Temperature
RV A series of transformation constructs “Ready Vectors”
SAA Sulfur-containing Amino Acid
SAM S-Adenosyl-Methionine
SAMS S-Adenosyl-Methionine Synthetase
6
SKL Tripeptide comprised of Ser-Lys-Leu
SS Signal sequence
SSA Sunflower Seed Albumin
TP Transit peptide
TS Threonine Synthase
USDA United States Department of Agriculture
WD-XRF Wave-length dispersive X-ray fluorescence
WHO World Health Organisation
WT Wildtype
XRFS X-ray Fluorescence Spectroscopy
7
V. Introduction
Cassava and Nutrition Cassava (genus Manihot; family Euphorbiaceae) is a shrub that is commonly known
as manioc, tapioca, mandioca and yucca. The genus comprises about 100 species
but only Manihot esculenta Crantz is commercially cultivated and is widely grown for
its starchy storage roots as a source of food. In 2004 more than 195 million tonnes
were harvested from approximately 17 million hectares of land, providing a staple
food for more than 600 million people living in tropical and sub-tropical developing
countries (FAO, 2005). Cassava plays a major role in food security due to its high
tolerance towards poor soil conditions, its flexible harvesting time throughout the year
and its easy vegetative propagation via stem cuttings (Cock, 1982).
The storage root of cassava - a true root and therefore cannot be propagated –
comprises the bark (periderm), peel (cortex) and parenchyma, which is the edible
part (Ceballos et al., 2004). A report from the United States Department of
Agriculture showed that an average storage root contains about 60% water, 38%
carbohydrates, but only about 1% lipids and 1% total protein (USDA, 2005). Other
reports have supported this finding, showing protein levels varying from below 1% to
8% dry weight (Ceballos et al., 2006). This low abundance of protein can lead in the
long term to severe problems, such as Protein-Energy-Malnutrition (PEM). This
occurs particularly in areas where consumers rely primarily on cassava as a food
source and where high-protein foods are not readily available for complementation
and diversification of their diet. The human body cannot synthesize all amino acids
itself so therefore requires uptake in our daily diet. In general, 8 out of 20 natural
amino acids are considered essential, including isoleucine, leucine, lysine, threonine,
tryptophan and valine. The sulfur amino acids (SAA) methionine and cysteine and
the aromatic amino acids (AAA) phenylalanine and tyrosine, are to a certain degree
interconvertible but nevertheless essential (FAO, 1991). Under certain clinical
conditions like prematurity or illness even histidine or other dispensable amino acids
can be considered essential (Laidlaw and Kopple, 1987). Unfortunately, cassava
storage roots are particularly deficient in lysine, leucine and SAA, which has major
implications on their nutritional value. However, the abundance of cyanogenic
glycosides results in the production of the poisonous hydrogen cyanide and needs to
8
be considered. Ordinarily, consumers overcome this problem by washing, drying or
boiling the roots but these processes also degrade labile amino acids (Ngudi et al.,
2002, 2003). Additionally, ingested compounds derived from remaining cyanogenic
glycosides in food require the presence of SAA for physiological detoxification and
consequently secretion of the metabolic compounds in humans (Cliff et al., 1985;
Rosling, 1994). So particularly SAA levels are crucial because they are generally low,
degraded during processing, and depleted for physiological detoxification thus
resulting in very low amounts available for essential body functions.
Currently, a number of approaches could be adopted to tackle the problems
associated with protein deficiency in cassava roots. Firstly, a general improvement in
the nutritional situation through the broadening of the daily diet would be most
desirable. This is a global objective that could, in part, be achieved via the
establishment of other crops or food sources to complement dietary protein
deficiency derived from excessive cassava consumption. Secondly, food fortification
programs could tackle specifically the problem of PEM in those areas affected by
malnutrition. The distribution of concentrated protein additives would be one of the
program options.
Thirdly, the introduction of elite cassava cultivars with increased protein content in
cassava storage roots (Biofortification) is a promising strategy. This approach has
been followed using both classical breeding programs and biotechnological tools. In
cassava breeding, some progress has recently been made with the generation of an
interspecific hybrid which shows elevated levels of amino acids such as methionine
and lysine, and an increased total protein content (Ceballos et al., 2004; Nassar and
Sousa, 2007). The ongoing characterisation of this hybrid will provide further
information in order to assess its real potential to counterbalance malnutrition. A
biotechnological breakthrough instead has still not been found although the resulting
high-protein cassava cultivar would have a significant impact on the nutritional quality
of consumers (Taylor et al., 2004). The research presented in this thesis should
contribute to such a breakthrough, with the ultimate aim to generate awareness of
nutritional problems associated with cassava consumption and to enhance protein
content in cassava storage roots.
9
Ceballos H, Iglesias CA, Perez JC, Dixon AG (2004) Cassava breeding: opportunities and challenges. Plant Molecular Biology 56: 503-516
Ceballos H, Sanchez T, Chavez AL, Iglesias C, Debouck D, Mafla G, Tohme J (2006) Variation in crude protein content in cassava (Manihot esculenta Crantz) roots. Journal of Food Composition and Analysis 19: 589-593
Cliff J, Lundqvist P, Martensson J, Rosling H, Sorbo B (1985) Association of high cyanide and low sulphur intake in cassava-induced spastic paraparesis. Lancet 2: 1211-1213
Cock JH (1982) Cassava - a Basic Energy-Source in the Tropics. Science 218: 755-762
FAO (1991) Protein quality evaluation. Joint FAO/WHO. FAO Food and Nutrition Paper 51: 1-66
FAO (2005) FAOSTAT data. In, Vol 2006 Laidlaw SA, Kopple JD (1987) Newer concepts of the indispensable amino acids.
American Journal of Clinical Nutrition 46: 593-605 Nassar NM, Sousa MV (2007) Amino acid profile in cassava and its interspecific
hybrid. Genetics and Molecular Research 6: 192-197 Ngudi DD, Kuo YH, Lambein F (2002) Food safety and amino acid balance in
processed cassava "Cossettes". Journal of Agricultural and Food Chemistry 50: 3042-3049
Ngudi DD, Kuo YH, Lambein F (2003) Amino acid profiles and protein quality of cooked cassava leaves or 'saka-saka'. Journal of the Science of Food and Agriculture 83: 529-534
Rosling H (1994) Measuring effects in humans of dietary cyanide exposure from cassava. Acta Horticulturae 375: 271-284
Taylor N, Chavarriaga P, Raemakers K, Siritunga D, Zhang P (2004) Development and application of transgenic technologies in cassava. Plant Molecular Biology 56: 671-688
USDA (2005) U.S. Department of Agriculture, Agricultural Research Service. National Nutrient Database for Standard Reference, Release 18. In Nutrient Data Laboratory Home Page, http://www.nal.usda.gov/fnic/foodcomp,
10
Biotechnological approaches to cassava protein improvement
Published in:
Trends in Food Science and Technology (2006) 17, 634-641
Authors’ contribution: M.S. wrote the review
H.V. edited and corrected the manuscript
W.G. edited and corrected the manuscript
P.Z. edited, corrected and submitted the manuscript
11
Biotechnological approaches to cassava protein improvement
Martin Stupaka, Hervé Vanderschurena, Wilhelm Gruissema and Peng Zhanga, b,*
a Institute of Plant Sciences, ETH Zurich, Universitätstrasse 2, 8092 Zurich,
Switzerland
b Institute of Plant Physiology and Ecology, Chinese Academy of Sciences, 300
Fenglin Road, 200032 Shanghai, China
* To whom correspondence should be addressed, e-mail: pzhang@ethz.ch;
Correspondence may also be addressed to Martin Stupak, e-mail: mstupak@ethz.ch
Abstract Cassava starchy storage roots are an excellent source of carbohydrates but lacking
in protein. To enhance their nutritional quality, here we discuss several
biotechnological strategies that might be used to increase protein levels as well as
improved essential amino acid content in transgenic cassava. Application of such
strategies in this major crop could, in the long term, help to fight against malnutrition
in those regions which depend heavily on cassava consumption.
Keywords: Manihot esculenta Crantz; protein improvement; essential amino acids;
genetic engineering; metabolic pathway
Introduction Cassava (Manihot esculenta Crantz), also called manioc, tapioca or yucca, is
one of the most important food crops in tropical developing countries. Because of its
high drought tolerance and low demand for nutrients, it can produce acceptable
yields even under marginal environmental conditions (Cock, 1982). Vegetative
propagation via stem cuttings as well as a flexible harvesting time make cassava an
excellent famine reserve which is highly appreciated among subsistence farmers,
particularly in sub-Saharan African countries (FAO, 2004). The annual production of
this cheap food source has been constantly rising and increased by nearly 19% over
the last ten years. In 2004, more than 195 million tonnes were harvested from more
than 17 million hectares (FAO, 2005) so that at present, more than 600 million people
12
rely on cassava as a vital food source. Unfortunately, many developing countries
suffer from Protein-Energy-Malnutrition (PEM), while relying on cassava as an
important energy source in their daily diet (Fig. 1), Especially in these countries the
elevation of cassava’s protein content could play a crucial role in the fight against
PEM.
Figure 1 Impact of improving protein content in cassava storage roots on Protein-Energy-Malnutrition (PEM) (FAO, 2005). Y-axes: energy gained from cassava per day in relation to total daily energy intake. X-Axes: PEM Severity calculated for a 75kg person as ratio of total daily protein intake to recommended daily intake of 1g protein /kg bodyweight /day. Most recent available data used (2003).
The Key-Problem: Low protein content High levels of cyanogenic glucosides like linamarin are present within the whole
plant which can trigger toxic responses in consumers (reviewed in Siritunga & Sayre,
2004). Thus proper processing is absolutely required to render cassava storage roots
and leaves edible. The large storage root provides a rich source for carbohydrates
but is low in vitamins and proteins (Fig. 2). Depending on cultivars, the protein
content in cassava storage roots ranges from below 1 to 5% (dry weight). The
nutritional value of this very low protein amount is further reduced by the particularly
low levels of the essential amino acids (EAA) lysine and leucine and of the sulfur-
containing EAA (SAAs) methionine and cysteine (Yeoh and Chew, 1977; Gomez and
Noma, 1986; Ngudi et al., 2002). According to the U.S. Department of Agriculture, a
60 kg person has to consume at least 1.3 kg cassava storage roots per day to meet
13
Figure 2 Fully developed cassava plant with its edible parts. Top: Leaves are relatively rich in protein but poor in terms of nutritionally relevant quantities. Bottom: Storage roots provide large amounts of carbohydrates but do not offer enough protein to consumers to meet minimum requirements. the recommended daily requirement of all essential amino acids (Fig. 4) (USDA,
2005). Regionally, cassava leaves are used as a dietary supplement for proteins and
vitamins (Eggum, 1970; Bokanga, 1994). The total protein content of leaves ranges
from 23 to 35% of dry weight (Yeoh and Chew, 1976; Yeoh and Paul, 1989;
Awoyinka et al., 1995). The non-essential amino acids alanine, aspartic acid and
glutamic acid are most prominent and account for more than 10% of the dry weight.
Also in leaves, the levels of EAAs lysine, leucine and histidine are low (Lancaster and
Brooks, 1983) and SAAs are limiting with a maximum amino acid score of 0.5
compared to the Food and Agriculture Organisation reference values (FAO, 1991;
Ngudi et al., 2003). With these amino acid contents, a 60 kg adult has to consume
140 to 211 g of raw cassava leaves per day to meet the minimum requirements for
limiting amino acids such as lysine, cysteine and methionine (Gomez and Noma,
1986; Friedman, 1996; Millward, 1999).
Prolonged cooking of cassava leaves is essential to minimize toxic
concentrations of emerging cyanide, but EAAs and SAA (such as cysteine) are
14
degraded during this processing. These oxidative processes generally effect the
nutritional quality of any food but in the case of cassava this is particularly detrimental
since cysteine is also required for the conversion of remaining dietary cyanide to
isothiocyanate by rhodanese in the detoxification process (Cliff et al., 1985; Rosling,
1994). To compensate for low EAA and SAA levels and loss during cooking
processing, more leaves need to be consumed. However, due to the fact that
cassava is cultivated for its storage roots, leaves can only be harvested every two to
three months without affecting storage root production significantly, which constrains
the amount of available leaves for consumption (Bokanga, 1994). In addition, the
short lifespan of cassava leaves, especially during the dry season, restrains the
usage of cassava leaves as a food source (El-Sharkawy et al., 1992). Recently, we
had successfully produced transgenic cassava showing prolonged leaf life by
cytokinin-mediated inhibition of leaf senescence (Zhang et al., unpublished data).
This technology may allow us to consume more leaves from cassava plants.
Although cassava leaves may serve as an important source of proteins, the
above described compositional and agricultural constraints make it impossible to
provide a sustained, adequate daily intake level of all essential amino acids, as long
as other high-protein sources such as meat, fish, or soybean are not readily available
for supplementation (Friedman, 1996; Ngudi et al., 2003).
Due to the genetic nature of cassava, classical breeding could not offer a
promising strategy to alleviate this problem. Recently, cassava transformation
technology has been developed in several laboratories (Taylor et al., 2004). In the
following discussion, we review several biotechnological strategies that could be
used to improve the nutritional value of cassava via transgenesis with a focus on
elevating protein levels and quality.
Exogenous storage proteins Because cassava roots have a low protein and EAA content in comparison with
other root crops, the identification of an endogenous protein with a typical storage
function is a challenging task. Various proteins involved in storage organ formation
have been already identified using sophisticated proteomics approaches (De Souza
et al., 2002; Zhang et al., 2003; De Souza et al., 2004; Sheffield et al., 2006).
Isolation of corresponding genes and promoters as well as unraveling of their
physiological functions will help to understand and possibly overcome the low protein
15
content. But so far endogenous storage proteins could not be pinpointed.
Consequently, strategies to overexpress and/or nutritionally optimize such proteins
(Wallace et al., 1988; e.g. De Clercq et al., 1990) or altering their relative expression
levels (Segal et al., 2003), as demonstrated in other crops, are not feasible for
cassava, yet. At present, expression of valuable storage proteins from other plants
appears to be the most practical strategy to accomplish nutritional biofortification of
cassava roots. Reliable transformation systems have been established in cassava for
this purpose (reviewed in Zhang and Gruissem, 2004).
Plant storage proteins Transfer and expression of heterologous plant storage proteins has been widely
applied already for improving protein quality in crop plants. When choosing a putative
storage protein for cassava storage roots, several important factors need to be
considered, such as allergenicity, nutritional value, stability and storability in target
tissues. For example, Acha (Digitaria exilis), commonly known as “hungry rice”,
contains several seed storage proteins with a particularly high SAA content that could
be used for nutritional enhancement of various crops (Delumen et al., 1993; Jideani,
1999). The sunflower seed albumin (SSA) could be a suitable candidate since it does
not show any allergenic effects and is rich in SAAs (Kortt et al., 1991). The gene has
been already transferred and expressed in narrow leaf lupin (Molvig et al., 1997), rice
endosperm (Hagan et al., 2003; Islam et al., 2005), and chickpea seeds (Chiaiese et
al., 2004). Surprisingly, transgenic plants showed no or only little increase in total
seed sulfur probably because grain legumes and cereals are able to modulate their
seed storage protein composition in response to sulfur and nitrogen availability
(reviewed in Tabe et al., 2002). The protein has not been tested yet in those crops
with larger starchy storage organs like tubers of potato and yam, or roots of sweet
potato and cassava and might be a putative storage protein for cassava storage
roots. Another promising seed storage protein is the nonallergenic amaranth seed
albumin (AmA1) from Amaranthus hypochondriacus. The protein exhibits AA scores
above 1.0 for all EAAs when compared to the standards of WHO (Raina and Datta,
1992) and has been already successfully expressed in the starchy tissue of potato
tubers (Chakraborty et al., 2000). An increase of total protein and of most EAAs up to
8 fold was observed in transgenic potato and, thus, its suitability as a heterologous
storage protein for cassava roots should be considered.
16
In addition, a number of storage proteins from starch-rich organs have been
identified and might prove useful such as patatin, sporamin and dioscorin (Shewry,
2003). Sporamin contributes to more than 80% of the total protein content in sweet
potato roots (Maeshima et al., 1985). No allergenicity has been reported for this
protein, thus making it a suitable candidate for cassava roots. Sporamin represents a
family of proteins that is composed of two major classes termed A and B, which differ
mainly in their protein mass. Sporamin A has a high content of sulfur-containing
EAAs with a score of more than 1.8 for SAAs (FAO, 1991). Nevertheless, its protein
score for lysine covers only 60% of FAO’s reference values for 2-5 year old children.
It was shown that the protein is active as Kunitz-type trypsin inhibitor with a protective
function for the plant against herbivores (Yeh et al., 1997; Ding et al., 1998; Cai et al.,
2003) and its expression is stimulated by wounding (Wang et al., 2002). The trypsin
inhibitor activity can be readily inactivated during heat processing (van den Hout et
al., 1998). Due to this property, sporamin could protect cassava cultivars, particularly
those with reduced levels of cyanogenic glucosides, as a potential pest deterrent
from pests like root weevils.
Another suitable protein candidate can be found in the tuberous storage organ of
yam. Dioscorin contributes to more than 80% of the total protein content (Conlan et
al., 1995). Its two subclasses A and B differ mainly in the presence or absence of a
single disulfide bond (Conlan et al., 1998). The protein size of dioscorin A and its
function as storage protein in yam tubers has been confirmed recently
(Gaidamashvili et al., 2004). Dioscorin has antioxidative properties (Hou et al., 2001)
with radical scavenging activity, which is similar to glutathione at the same protein
concentrations (Liu et al., 2004). Lysine is the only limiting amino acid in dioscorin
with an amino acid score of 0.9 (FAO, 1991). Because cassava and yam storage
organs show structural similarities, putative expression of this valuable protein in
cassava storage roots could provide a significant health benefit to consumers.
Proteins optimized for EAAs Although many storage proteins have been identified in plants, most of them
have an inadequate amino acid composition when compared to reference proteins
from e.g., egg, bovine milk, or beef (FAO, 1991; Millward, 1999). However, such
proteins could be adapted to human or animal nutritional needs by mutagenesis or
even by a complete re-design of novel proteins with a ratio of EAAs according to
17
WHO nutritional recommendations. Expression of such proteins in crop plants would
provide a safe and effective means to increase their nutritional value.
Such a kind of protein has been de novo designed, based on the structure of
maize zein proteins and optimized for human EAAs needs (Kim et al., 1992). After
design and DNA synthesis, this artificial storage protein (ASP1) has been shown to
be expressed in E. coli and tobacco at high levels. Recently, we reported expression
of ASP1 in cassava (Zhang et al., 2003), in which expression levels were higher in
leaves than in primary roots. While these plants did not show a significant increase in
total protein content in storage roots compared to the wild-type plants, post-
hydrolysis measurements revealed that the levels of amino acids like Hyp, Pro, and
Ser were increased and those of Asn, Ala, and Met were decreased. We concluded
that expression of ASP1 seems to have an indirect effect on AA metabolism because
of its high EAA content.
Interestingly, the semi-artificial storage protein “Zeolin”, a recombinant storage
protein constructed using maize γ-zein and bean phaseolin, could accumulate to very
high amounts in leaves of transgenic tobacco (Mainieri et al., 2004). This chimeric
storage protein complements the set of putative nutritionally optimized candidates,
hence, providing a new tool for genetic improvement of those crops which are
characterized by a low abundance of endogenous storage proteins.
Specific expression of EAA-optimized proteins Tissue specific expression, especially root-specific expression can be an
important aspect for nutritional improvement of cassava. Exclusive expression of the
transgene in storage roots would limit facultative side-effects on untargeted tissues,
therefore, resulting in a normal phenotype development of cassava plants.
The choice of the most suitable promoters is important for efficient expression of
EAA rich proteins in cassava storage roots. The most widely used promoter for
expression of genes in transgenic plants is the cauliflower CaMV 35S promoter,
which is strongly and constitutively expressed in most tissues (Odell et al., 1985).
Many cassava transformation vectors were constructed using this promoter for the
expression of reporter genes (e.g. Franche et al., 1991; Raemakers et al., 1996;
Zhang et al., 2000) and functional genes (Zhang et al., 2003; Siritunga et al., 2004).
Tissue-specific expression in cassava has been achieved in leaves with the cab1
promoter from Arabidopsis (Siritunga and Sayre, 2003), and in roots with a patatin
18
promoter from potato (Siritunga and Sayre, 2004). We have isolated two endogenous
cassava promoters from a genomic library after differential screening of a storage
root cDNA library with cassava leaf- and root-transcripts (Zhang et al., 2003).
Expression of the GUS gene under control of these promoters in transgenic cassava
plants showed that their activity is strongest in vascular tissues and in parenchyma
cells of storage roots. Their expression scenario suggests that they are important
candidates for regulating transgene expression in cassava storage roots.
The importance of subcellular targeting So far the expression of ASP1 is the only reported transgenic approach to
increase the nutritional value of cassava. If N- or C-terminal signal sequences for
subcellular targeting are fused to ASP1 it could most likely be deposited within their
corresponding organelles instead of cytosolic accumulation (Hadlington and
Denecke, 2000). Recently, an endogenous maize storage protein, which usually
accumulates within the ER, was targeted both to the cytosol and to the chloroplasts
using the transit peptide from tobacco ribulose bisphosphate carboxylase small
subunit (rbcS) (Bellucci et al., 2005). However, their data suggest that both locations
are rather unsuitable for accumulation of this protein. This is not the case in other
studies (Yang et al., 2005; Glenz et al., 2006). Furthermore, the vacuole (Streatfield
et al., 2003) or retention within the ER (Denecke et al., 1992; De Jaeger et al., 2002)
were suggested to be the best subcellular locations for storage proteins.
Based on information from the current literature, we believe that for expression of
an exogenous storage protein in cassava storage roots the most suitable subcellular
localization still needs to be determined empirically. We have already confirmed the
functionality of several signal sequences that target to plastids or vacuoles or trigger
ER retention in cassava BY2-like protoplasts (unpublished data) and are presently
testing whether localization to these compartments may increase protein levels in
cassava storage roots.
Engineering amino acid metabolism Protein accumulation in storage roots might not only depend on promoter
strength and protein stability but also on protein synthesis capacity. It is generally
assumed that low levels of certain free amino acids in cassava storage roots leads to
their low protein content. Therefore, engineering amino acid metabolism might offer
19
an alternative or additive strategy to promote storage protein expression in cassava
roots, thus finally resulting in increased protein content.
The aspartate family pathway Lysine, methionine and cysteine are limiting amino acids in cassava storage roots
(Ngudi et al., 2002) . These EAAs are synthesized via the aspartate family pathway
(Fig. 3). It has been proposed that certain key EAAs can be enriched by regulating
appropriate steps in the pathway through molecular engineering (Galili et al., 2005),
however, due to the complexity of the biochemical pathway no breakthrough has
been reported so far.
Figure 3 Aspartate metabolism pathway in planta. Not all enzymes and intermediates are shown. Used colours: EAAs (light yellow), negative feedback regulation (red), positive feedback regulation (green), metabolites (blue). Used abbreviations: aspartate kinase (AK), homoserine dehydrogenase (HSD), dihydrodipicolinate synthase (DHPS), threonine synthase (TS), cystathionine γ-synthase (CgS), S-adenosylmethionine synthetase (SAMS). * found in A. thaliana but not in S. tuberosum L.
20
Lysine biosynthesis is of primary interest in metabolic engineering. It requires the
formation of 2,3 dihydrodipicolinate from aspartate-β-semialdehyde by
dihydrodipicolinate synthase (DHPS) as illustrated in Fig. 3. This enzyme is lysine-
feedback sensitive and regulates lysine formation in plants (Galili, 1995). However,
DHPS from bacteria is less sensitive to lysine (Cohen and Saint-Girons, 1987) and
strategies could be developed to increase lysine levels in transgenic plants through
constitutive expression of the bacterial enzyme. Other approaches, such as inhibition
of key enzymes involved in lysine catabolism may also be considered (Capell and
Christou, 2004). The successful expression of bacterial DHPS has been reported for
several plants, but has not yet been attempted in cassava (Shaul and Galili, 1992;
Karchi et al., 1994; Falco et al., 1995; Mazur et al., 1999). Lysine levels could even
be increased by up to 100 fold, but this enormous lysine production triggered severe
phenotypic changes, e.g. an arrest of seed germination (Galili and Hofgen, 2002). To
solve this problem, plants with moderate DHPS expression could develop normally
(Zhu and Galili, 2003; Zhu and Galili, 2004). These data suggest that amino acid
levels in plants need to be carefully adjusted. A potential solution to boost lysine
accumulation without reduced fertility might be achieved with the co-expression of a
protein rich in lysine that serves in plants as a lysine sink (Keeler et al., 1997).
Biosynthesis of methionine is the second potential target for the engineering of
cassava’s aspartate family pathway. Similar to lysine, no research has been done in
cassava so far, but results from other plants are available and could be applicable to
cassava. The carbon skeleton for the sulfur-containing amino acids is derived from
the intermediate metabolite o-phospho-homoserine and hence from aspartate. The
sulfur-group is donated by cysteine, which is itself subjected to metabolic regulations
during its own biosynthesis from sulfate and serine. The methionine content in
cassava might be increased by modifying the speed of formation of the carbon
skeleton, as shown in potato (Nikiforova et al., 2002; Hesse et al., 2004), if sulfur
uptake (as SO42-), processing, and integration into the cysteine precursor is not rate-
limiting for methionine formation.
O-phospho-homoserine is also an intermediate in threonine synthesis (Bryan, 1980;
Anderson, 1990; Matthews, 1999; Galili and Hofgen, 2002). The substrate
competition between cystathionine γ-synthase and threonine synthase (TS) for the
common branch point intermediate (Fig. 3) can be used to redirect carbon flux in the
direction of methionine (Karchi et al., 1993; Galili, 1995). Reduction of threonine
21
synthase led to increased methionine levels in potato and Arabidopsis (Bartlem et al.,
2000; Zeh et al., 2001). The efficacy of this approach is compromised by the
feedback inhibition of cystathionine γ-synthase by methionine in Arabidopsis
(Nikiforova et al., 2002). Threonine synthase can be reduced directly with antisense
or RNAi approaches (Bartlem et al., 2000; Zeh et al., 2001) or indirectly by inhibiting
the production of S-adenosyl-methionine (SAM) from methionine (Boerjan et al.,
1994; Shen et al., 2002) since SAM strongly stimulates its activity (Curien et al.,
1996).
Potential applications Metabolic engineering of the aspartate pathway in cassava has not been
reported yet. To increase lysine accumulation, the DHPS strategy can be adapted to
cassava. At the same time, the inhibition of TS or SAMS coupled with a root-specific
expression has the potential to influence the pool size of free amino acids thus
increasing the nutritional value.
To minimize the chance of any phenotypic disorders in transgenic plants, a
synergistic biotechnological approach can be tested (Hesse et al., 2004). This means
that certain key steps in the aspartate metabolism are engineered to create a “push”
force into EAAs while at the same time some proteins with a high content of EAAs
are expressed to create a “pull” force on the pathway. This would eliminate the
negative effects associated with e.g. high lysine levels by packing and storing excess
lysine within appropriate proteins. For targeted interference with cassava amino acid
synthesis pathways, increased knowledge about the involved genes and proteins will
be required.
With ongoing research in cassava genomics, proteomics and metabolomics,
development of a strategy based on the modification of transcription factors becomes
possible in order to increase the pool of certain amino acids. The maize opaque-2
mutant (Schmidt et al., 1992) is a well-studied example for improving a plants
nutritional value by modifying its expression of a transcription factor which itself
controls the expression of endogenous storage proteins. This elegant approach
opens the opportunity to control several genes simultaneously with only one single
trigger.
22
Summary and outlook Cassava is a staple crop in tropical developing countries. Low protein content of
its storage roots can lead to qualitative Protein-Energy-Malnutrition (PEM) among
consumers in areas where their diet is based predominantly on cassava (as shown in
Fig. 1). Therefore, protein-improved cassava provides a useful tool in the fight
against PEM in these regions. To reach this goal, several biotechnological tools are
available for cassava. Firstly, expression or over-expression of plant derived storage
protein genes can be tested, from either cassava itself or other plants with similar
starch-rich organs like sweet potato or yam. Secondly, artificially designed proteins
with an optimized EAA composition should be considered, such as ASP1. By the
adaptation of optimized tissue-specific expression and intracellular targeting, the
protein content can be improved by at least 1%. This would reduce the minimal
amount of cassava that needs to be consumed to get all EAAs by up to 64% (Fig. 4).
Figure 4 Minimum amount of cassava storage roots that need to be consumed to obtain recommended levels of all EAAs (FAO, 1991; USDA, 2005). The proposed impact of transgenic cassava on available EAA levels is visible at moderate and elevated levels of ASP1. As comparison protein-values for egg and beef are shown.
As a final option, a combined approach of storage protein expression, cellular
targeting and metabolic engineering of key enzymes of the aspartate pathway like
DHPS, TS, or SAMS might even lead to cassava storage roots with levels of up to
5% dry weight. These levels are already present in some South American cassava
23
cultivars and would reduce the threshold by even 86% to a minimal amount of 150g
cassava per day that needs to be consumed to be not deficient (Fig. 4).
As a consequence, cassava biotechnology has the potential to reduce PEM
severity e.g. in Democratic Republic of Congo from 67% to 18% and in Sub-Sahara
Africa (average) from 29% to 12% (compare to Fig. 1) thus helping consumers to
approach recommended daily protein intake levels.
Acknowledgements We thank Dr. Johannes Fütterer for helpful discussions. This work was funded by
a grant from the Bill & Melinda Gates Foundation through the Grand Challenges in
Global Health Initiative and by a grant from the Swiss Centre for International
Agriculture (ZIL).
Literature cited Anderson JW (1990) Sulfur metabolism in plants. In B Miflin, P Lea, P Conn, W
Stumpf, eds, Biochemistry of Plants, Vol 16. Academic Press, San Diego, pp 327-381
Awoyinka AF, Abegunde VO, Adewusi SR (1995) Nutrient content of young cassava leaves and assessment of their acceptance as a green vegetable in Nigeria. Plant Foods for Human Nutrition 47: 21-28
Bartlem D, Lambein I, Okamoto T, Itaya A, Uda Y, Kijima F, Tamaki Y, Nambara E, Naito S (2000) Mutation in the threonine synthase gene results in an over-accumulation of soluble methionine in Arabidopsis. Plant Physiology 123: 101-110
Bellucci M, De Marchis F, Mannucci R, Bock R, Arcioni S (2005) Cytoplasm and chloroplasts are not suitable subcellular locations for beta-zein accumulation in transgenic plants. Journal of Experimental Botany 56: 1205-1212
Boerjan W, Bauw G, Van Montagu M, Inze D (1994) Distinct phenotypes generated by overexpression and suppression of S-adenosyl-L-methionine synthetase reveal developmental patterns of gene silencing in tobacco. Plant Cell 6: 1401-1414
Bokanga M (1994) Processing of Cassava Leaves for Human Consumption. Acta Horticulturae 375: 203-208
Bryan J (1980) Synthesis of the aspartate family and branched-chain amino acids. In B Miflin, ed, The biochemistry of plants: a comprehensive treatise, Vol 5. Academic Press, New York, p 403–452
Cai DG, Thurau T, Tian YY, Lange T, Yeh KW, Jung C (2003) Sporamin-mediated resistance to beet cyst nematodes (Heterodera schachtii Schm.) is dependent on trypsin inhibitory activity in sugar beet (Beta vulgaris L.) hairy roots. Plant Molecular Biology 51: 839-849
Capell T, Christou P (2004) Progress in plant metabolic engineering. Current Opinion in Biotechnology 15: 148-154
Chakraborty S, Chakraborty N, Datta A (2000) Increased nutritive value of transgenic potato by expressing a nonallergenic seed albumin gene from
24
Amaranthus hypochondriacus. Proceedings of the National Academy of Sciences of the United States of America 97: 3724-3729
Chiaiese P, Ohkama-Ohtsu N, Molvig L, Godfree R, Dove H, Hocart C, Fujiwara T, Higgins TJ, Tabe LM (2004) Sulphur and nitrogen nutrition influence the response of chickpea seeds to an added, transgenic sink for organic sulphur. Journal of Experimental Botany 55: 1889-1901
Cliff J, Lundqvist P, Martensson J, Rosling H, Sorbo B (1985) Association of high cyanide and low sulphur intake in cassava-induced spastic paraparesis. Lancet 2: 1211-1213
Cock JH (1982) Cassava - a Basic Energy-Source in the Tropics. Science 218: 755-762
Cohen GN, Saint-Girons I (1987) Biosynthesis of threonine, lysine and methionine. In Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology. American Society of Microbiology, Washington, pp 429-444
Conlan RS, Griffiths LA, Napier JA, Shewry PR, Mantell S, Ainsworth C (1995) Isolation and Characterization of Cdna Clones Representing the Genes Encoding the Major Tuber Storage Protein (Dioscorin) of Yam (Dioscorea-Cayenensis Lam). Plant Molecular Biology 28: 369-380
Conlan S, Griffiths LA, Turner M, Fido R, Tatham A, Ainsworth C, Shewry P (1998) Characterisation of the yam tuber storage protein dioscorin. Journal of Plant Physiology 153: 25-31
Curien G, Dumas R, Ravanel S, Douce R (1996) Characterization of an Arabidopsis thaliana cDNA encoding an S-adenosylmethionine-sensitive threonine synthase. Threonine synthase from higher plants. FEBS Letters 390: 85-90
De Clercq A, Vandewiele M, Van Damme J, Guerche P, Van Montagu M, Vandekerckhove J, Krebbers E (1990) Stable accumulation of modified 2S albumin seed storage proteins with higher methionine contents in transgenic plants. Plant Physiology 94: 970-979
De Jaeger G, Scheffer S, Jacobs A, Zambre M, Zobell O, Goossens A, Depicker A, Angenon G (2002) Boosting heterologous protein production in transgenic dicotyledonous seeds using Phaseolus vulgaris regulatory sequences. Nature Biotechnology 20: 1265-1268
De Souza CR, Carvalho LJ, De Almeida ER, Gander ES (2002) Towards the identification of cassava root protein genes. Plant Foods for Human Nutrition 57: 353-363
De Souza CR, Carvalho LJ, de Mattos Cascardo JC (2004) Comparative gene expression study to identify genes possibly related to storage root formation in cassava. Protein and Peptide Letters 11: 577-582
Delumen BO, Thompson S, Odegard WJ (1993) Sulfur Amino Acid-Rich Proteins in Acha (Digitaria-Exilis), a Promising Underutilized African Cereal. Journal of Agricultural and Food Chemistry 41: 1045-1047
Denecke J, De Rycke R, Botterman J (1992) Plant and mammalian sorting signals for protein retention in the endoplasmic reticulum contain a conserved epitope. EMBO Journal 11: 2345-2355
Ding LC, Hu CY, Yeh KW, Wang PJ (1998) Development of insect-resistant transgenic cauliflower plants expressing the trypsin inhibitor gene isolated from local sweet potato. Plant Cell Reports 17: 854-860
Eggum BO (1970) Protein Quality of Cassava Leaves. British Journal of Nutrition 24: 761-768
25
El-Sharkawy MA, Hernandez AD, Hershey C (1992) Yield Stability of Cassava During Prolonged Mid-Season Water-Stress. Experimental Agriculture 28: 165-174
Falco SC, Guida T, Locke M, Mauvais J, Sanders C, Ward RT, Webber P (1995) Transgenic Canola and Soybean Seeds with Increased Lysine. Bio-Technology 13: 577-582
FAO (1991) Protein quality evaluation. Joint FAO/WHO. FAO Food and Nutrition Paper 51: 1-66
FAO (2004) Agricultural biotechnology Meeting the needs of the poor? Food and Agriculture Organization of the United Nations FAO, Rome
FAO (2005) FAOSTAT data. In, Vol 2006 Franche C, Bogusz D, Schopke C, Fauquet C, Beachy RN (1991) Transient Gene-
Expression in Cassava Using High-Velocity Microprojectiles. Plant Molecular Biology 17: 493-498
Friedman M (1996) Nutritional value of proteins from different food sources. A review. Journal of Agricultural and Food Chemistry 44: 6-29
Gaidamashvili M, Ohizumi Y, Iijima S, Takayama T, Ogawa T, Muramoto K (2004) Characterization of the yam tuber storage proteins from Dioscorea batatas exhibiting unique lectin activities. Journal of Biological Chemistry 279: 26028-26035
Galili G (1995) Regulation of Lysine and Threonine Synthesis. Plant Cell 7: 899-906 Galili G, Amir R, Hoefgen R, Hesse H (2005) Improving the levels of essential
amino acids and sulfur metabolites in plants. Biological Chemistry 386: 817-831 Galili G, Hofgen R (2002) Metabolic engineering of amino acids and storage
proteins in plants. Metabolic Engineering 4: 3-11 Glenz K, Bouchon B, Stehle T, Wallich R, Simon MM, Warzecha H (2006)
Production of a recombinant bacterial lipoprotein in higher plant chloroplasts. Nature Biotechnology 24: 76-77
Gomez G, Noma AT (1986) The Amino-Acid-Composition of Cassava Leaves, Foliage, Root Tissues and Whole-Root Chips. Nutrition Reports International 33: 595-601
Hadlington JL, Denecke J (2000) Sorting of soluble proteins in the secretory pathway of plants. Current Opinion in Plant Biology 3: 461-468
Hagan ND, Upadhyaya N, Tabe LM, Higgins TJ (2003) The redistribution of protein sulfur in transgenic rice expressing a gene for a foreign, sulfur-rich protein. Plant Journal 34: 1-11
Hesse H, Kreft O, Maimann S, Zeh M, Hoefgen R (2004) Current understanding of the regulation of methionine biosynthesis in plants. Journal of Experimental Botany 55: 1799-1808
Hou WC, Lee MH, Chen HJ, Liang WL, Han CH, Liu YW, Lin YH (2001) Antioxidant activities of dioscorin, the storage protein of yam (Dioscorea batatas Deene) tuber. Journal of Agricultural and Food Chemistry 49: 4956-4960
Islam N, Upadhyaya NM, Campbell PM, Akhurst R, Hagan N, Higgins TJ (2005) Decreased accumulation of glutelin types in rice grains constitutively expressing a sunflower seed albumin gene. Phytochemistry 66: 2534-2539
Jideani IA (1999) Traditional and possible technological uses of Digitaria exilis (acha) and Digitaria iburua (iburu): a review. Plant Foods for Human Nutrition 54: 363-374
26
Karchi H, Shaul O, Galili G (1993) Seed-Specific Expression of a Bacterial Desensitized Aspartate Kinase Increases the Production of Seed Threonine and Methionine in Transgenic Tobacco. Plant Journal 3: 721-727
Karchi H, Shaul O, Galili G (1994) Lysine Synthesis and Catabolism Are Coordinately Regulated During Tobacco Seed Development. Proceedings of the National Academy of Sciences of the United States of America 91: 2577-2581
Keeler SJ, Maloney CL, Webber PY, Patterson C, Hirata LT, Falco SC, Rice JA (1997) Expression of de novo high-lysine alpha-helical coiled-coil proteins may significantly increase the accumulated levels of lysine in mature seeds of transgenic tobacco plants. Plant Molecular Biology 34: 15-29
Kim J, Cetiner S, Jaynes JM (1992) Enhancing the nutritional quality of crop plants: design, contruction and expression of an artificial plant storage protein gene. In D Bhatnagar, TE Cleveland, eds, Molecular approaches to improving food quality and safety. Van Nostrand Reinhold, New York, pp 1-36
Kortt AA, Caldwell JB, Lilley GG, Higgins TJ (1991) Amino acid and cDNA sequences of a methionine-rich 2S protein from sunflower seed (Helianthus annuus L.). European Journal of Biochemistry 195: 329-334
Lancaster PA, Brooks JE (1983) Cassava Leaves as Human Food. Economic Botany 37: 331-348
Liu DZ, Lin YS, Hou WC (2004) Monohydroxamates of aspartic acid and glutamic acid exhibit antioxidant and angiotensin converting enzyme inhibitory activities. Journal of Agricultural and Food Chemistry 52: 2386-2390
Maeshima M, Sasaki T, Asahi T (1985) Characterization of Major Proteins in Sweet-Potato Tuberous Roots. Phytochemistry 24: 1899-1902
Mainieri D, Rossi M, Archinti M, Bellucci M, De Marchis F, Vavassori S, Pompa A, Arcioni S, Vitale A (2004) Zeolin. A new recombinant storage protein constructed using maize gamma-zein and bean phaseolin. Plant Physiology 136: 3447-3456
Matthews B (1999) Lysine, threonine, and methionine biosynthesis. In B Singh, ed, Plant Amino Acids: Biochemistry and Biotechnology. Marcel Dekker, New York, pp 205-225
Mazur B, Krebbers E, Tingey S (1999) Gene discovery and product development for grain quality traits. Science 285: 372-375
Millward DJ (1999) The nutritional value of plant-based diets in relation to human amino acid and protein requirements. Proceedings of the Nutrition Society 58: 249-260
Molvig L, Tabe LM, Eggum BO, Moore AE, Craig S, Spencer D, Higgins TJV (1997) Enhanced methionine levels and increased nutritive value of seeds of transgenic lupins (Lupinus angustifolius L) expressing a sunflower seed albumin gene. Proceedings of the National Academy of Sciences of the United States of America 94: 8393-8398
Ngudi DD, Kuo YH, Lambein F (2002) Food safety and amino acid balance in processed cassava "Cossettes". Journal of Agricultural and Food Chemistry 50: 3042-3049
Ngudi DD, Kuo YH, Lambein F (2003) Amino acid profiles and protein quality of cooked cassava leaves or 'saka-saka'. Journal of the Science of Food and Agriculture 83: 529-534
Nikiforova V, Kempa S, Zeh M, Maimann S, Kreft O, Casazza AP, Riedel K, Tauberger E, Hoefgen R, Hesse H (2002) Engineering of cysteine and methionine biosynthesis in potato. Amino Acids 22: 259-278
27
Odell JT, Nagy F, Chua NH (1985) Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter. Nature 313: 810-812
Raemakers CJJM, Sofiari E, Taylor N, Henshaw G, Jacobsen E, Visser RGF (1996) Production of transgenic cassava (Manihot esculenta Crantz) plants by particle bombardment using luciferase activity as selection marker. Molecular Breeding 2: 339-349
Raina A, Datta A (1992) Molecular cloning of a gene encoding a seed-specific protein with nutritionally balanced amino acid composition from Amaranthus. Proceedings of the National Academy of Sciences of the United States of America 89: 11774-11778
Rosling H (1994) Measuring effects in humans of dietary cyanide exposure from cassava. Acta Horticulturae 375: 271-284
Schmidt RJ, Ketudat M, Aukerman MJ, Hoschek G (1992) Opaque-2 Is a Transcriptional Activator That Recognizes a Specific Target Site in 22-Kd-Zein Genes. Plant Cell 4: 689-700
Segal G, Song R, Messing J (2003) A new opaque variant of maize by a single dominant RNA-interference-inducing transgene. Genetics 165: 387-397
Shaul O, Galili G (1992) Increased Lysine Synthesis in Tobacco Plants That Express High-Levels of Bacterial Dihydrodipicolinate Synthase in Their Chloroplasts. Plant Journal 2: 203-209
Sheffield J, Taylor N, Fauquet C, Chen S (2006) The cassava (Manihot esculenta Crantz) root proteome: Protein identification and differential expression. Proteomics
Shen B, Li C, Tarczynski MC (2002) High free-methionine and decreased lignin content result from a mutation in the Arabidopsis S-adenosyl-L-methionine synthetase 3 gene. Plant Journal 29: 371-380
Shewry PR (2003) Tuber storage proteins. Annals of Botany 91: 755-769 Siritunga D, Arias-Garzon D, White W, Sayre RT (2004) Over-expression of
hydroxynitrile lyase in transgenic cassava roots accelerates cyanogenesis and food detoxification. Plant Biotechnology Journal 2: 37-43
Siritunga D, Sayre R (2004) Engineering cyanogen synthesis and turnover in cassava (Manihot esculenta). Plant Molecular Biology 56: 661-669
Siritunga D, Sayre RT (2003) Generation of cyanogen-free transgenic cassava. Planta 217: 367-373
Streatfield SJ, Lane JR, Brooks CA, Barker DK, Poage ML, Mayor JM, Lamphear BJ, Drees CF, Jilka JM, Hood EE, Howard JA (2003) Corn as a production system for human and animal vaccines. Vaccine 21: 812-815
Tabe L, Hagan N, Higgins TJ (2002) Plasticity of seed protein composition in response to nitrogen and sulfur availability. Current Opinion in Plant Biology 5: 212-217
Taylor N, Chavarriaga P, Raemakers K, Siritunga D, Zhang P (2004) Development and application of transgenic technologies in cassava. Plant Molecular Biology 56: 671-688
USDA (2005) U.S. Department of Agriculture, Agricultural Research Service. National Nutrient Database for Standard Reference, Release 18. In Nutrient Data Laboratory Home Page, http://www.nal.usda.gov/fnic/foodcomp,
van den Hout R, Pouw M, Gruppen H, van't Riet K (1998) Inactivation Kinetics Study of the Kunitz Soybean Trypsin Inhibitor and the Bowman-Birk Inhibitor. Journal of Agricultural and Food Chemistry 46: 281-285
28
Wallace JC, Galili G, Kawata EE, Cuellar RE, Shotwell MA, Larkins BA (1988) Aggregation of lysine-containing zeins into protein bodies in Xenopus oocytes. Science 240: 662-664
Wang SJ, Lan YC, Chen SF, Chen YM, Yeh KW (2002) Wound-response regulation of the sweet potato sporamin gene promoter region. Plant Molecular Biology 48: 223-231
Yang J, Barr LA, Fahnestock SR, Liu ZB (2005) High yield recombinant silk-like protein production in transgenic plants through protein targeting. Transgenic Research 14: 313-324
Yeh KW, Lin MI, Tuan SJ, Chen YM, Lin CY, Kao SS (1997) Sweet potato (Ipomoea batatas) trypsin inhibitors expressed in transgenic tobacco plants confer resistance against Spodoptera litura. Plant Cell Reports 16: 696-699
Yeoh HH, Chew MY (1976) Protein-Content and Amino-Acid Composition of Cassava Leaf. Phytochemistry 15: 1597-1599
Yeoh HH, Chew MY (1977) Protein content and acid composition of cassava seed and tuber. Malaysian Agricultural Journal 51: 1-6
Yeoh HH, Paul K (1989) Variation in Leaf Protein Contents and Amino-Acid Compositions of Cassava Cultivars. Biochemical Systematics and Ecology 17: 199-202
Zeh M, Casazza AP, Kreft O, Roessner U, Bieberich K, Willmitzer L, Hoefgen R, Hesse H (2001) Antisense inhibition of threonine synthase leads to high methionine content in transgenic potato plants. Plant Physiology 127: 792-802
Zhang P, Bohl-Zenger S, Puonti-Kaerlas J, Potrykus I, Gruissem W (2003) Two cassava promoters related to vascular expression and storage root formation. Planta 218: 192-203
Zhang P, Gruissem W (2004) Production of transgenic cassava (Manihot esculenta Crantz). In Transgenic Crops of the World - Essential Protocols. Curtis, Ian S., pp 301-319
Zhang P, Jaynes JM, Potrykus I, Gruissem W, Puonti-Kaerlas J (2003) Transfer and expression of an artificial storage protein (ASP1) gene in cassava (Manihot esculenta Crantz). Transgenic Research 12: 243-250
Zhang P, Legris G, Coulin P, Puonti-Kaerlas J (2000) Production of stably transformed cassava plants via particle bombardment. Plant Cell Reports 19: 939-945
Zhu X, Galili G (2003) Increased lysine synthesis coupled with a knockout of its catabolism synergistically boosts lysine content and also transregulates the metabolism of other amino acids in Arabidopsis seeds. Plant Cell 15: 845-853
Zhu XH, Galili G (2004) Lysine metabolism is concurrently regulated by synthesis and catabolism in both reproductive and vegetative tissues. Plant Physiology 135: 129-136
29
Aims of the thesis The aim of the research was to increase the total protein content in cassava storage
roots via the expression of ASP1 (an artificial storage protein based on the structure
of a maize zein protein that has an increased content of essential amino acids) and
sporamin (storage protein of sweet potato) in cassava. Despite the considerable
importance regarding protein malnutrition in developing countries, there is only
sparse information and scientific data pertaining to strategies aimed at relieving the
problem. The use of biotechnological applications was deemed a key approach and
used as the basis of my research.
Cassava plants transformed with ASP1 as part of an earlier investigation were
analysed using molecular and biochemical techniques to identify and quantify
changes in protein and amino acid content in leaves and storage roots compared
with untransformed plants. This study formed a vital platform for our understanding of
the effect of introduced storage protein genes in cassava. This data further enabled
experiments for ASP1 and sporamin to be coupled to targeting signals to direct
protein accumulation in plastids, vacuoles and the endoplasmic reticulum in
transformed cassava. To supplement this work, visualisation of the accumulation
patterns was achieved through the development of a cassava protoplast
transformation assay that used fluorescently labelled transgenes. In addition,
transformation vectors that comprised the endogenous cassava promoter p54/1.0
were designed to explore the root expression potential of the promoter. Storage root
composition was quantified using amino acid analyzing techniques. The sum of these
aims and experiments provides a significant advancement in tackling the problems
associated with protein malnutrition.
30
VI. X-ray fluorescence spectroscopy as a new method to determine sulfur amino acids in cassava storage roots
Target Journal: Journal of Food Composition and Analysis Authors: Stupak M, Gruissem W, Zhang P
Abstract Cassava is the fifth most important staple crop in the world. Therefore, improvement
of its nutritional quality will be of great importance. Especially the enhancement of
protein quantity and quality in storage roots of this crop is currently a major target in
cassava research programs. In this context reliable determination of protein and
amino acid composition is required to determine the impact of improved varieties.
Here we demonstrate that determination of sulfur amino acids (SAA) using
conventional ion exchange chromatography without pre-oxidation results in a
significant underestimation of their amount in cassava. We therefore developed an
efficient and reliable alternative method based on X-ray fluorescence spectroscopy
(XRFS). Applying this method to cassava revealed 4-8 times higher levels of SAA
than previously reported. We propose that XRFS should be used in the cassava
community to facilitate the assessment of the nutritional value of cassava storage
roots.
Introduction Cassava (Manihot esculenta Crantz) is the most important staple crop of the tropics
and is mainly appreciated by farmers and consumers for its flexible harvesting time
and its high tolerance to drought and poor soil conditions (Cock, 1982). More than
600 million people rely on it as a staple food source (FAO, 2005) since it serves as
an excellent famine reserve particularly for subsistence farmers in sub-Saharan
African countries (FAO, 2004). Unfortunately, protein levels in cassava storage roots
are extremely low, which reduces the nutritional value of this food source. True
protein contents, meaning the sum of all amino acids, range from below 1 to 5% (dry
weight) depending on the cultivar. In particular lysine, leucine and the sulfur-
containing essential amino acids methionine and cysteine are limiting. Reliable
measurements of these amino acids are crucial for the assessment of the nutritional
31
value of cassava cultivars and the evaluation of approaches for its improvement
(Yeoh and Chew, 1977; Gomez and Noma, 1986; Ngudi et al., 2002).
In order to define the protein and amino acid composition in cassava storage roots
robust results are needed that take biological variation into account. Within this paper
the magnitude of biological variation in cassava was determined and discussed for
the first time by analysing leaves and storage roots of cassava plants from both
transgenic and non transgenic background (Zhang et al., 2003). For this purpose
samples were harvested at two time-points in order to identify time-dependent
changes. Consequently, this illustrated the importance of multiple sample analysis to
compensate for biological variation.
The reliable measurement of methionine and cysteine, the carriers of organic sulfur
in cassava storage roots, is particularly demanding. Two cysteine monomers
additionally can be oxidised to a sulphide-bridged dimer called cystine. Chemical
stability of many amino acid monomers during analysis is rather low due to non-
quantitative oxidation or acidic degradation. Thus SAA currently need to be indirectly
quantified in amino acid analysis via their oxidation products methionine sulfoxide,
methionine sulfone, and cysteic acid (AOAC, 1997). However, this method requires a
separate oxidation step using performic acid which doubles the costs of analysis and
the method can be subject to variation coefficients exceeding 20% (Parvy et al.,
1993). For this reason, a new routine screening method based on X-ray fluorescence
spectroscopy (XRFS) was evaluated here for its reproducibility and usefulness.
Material and Methods Plant Material Cassava plants of cultivar TMS60444 (Nig11) and of transgenic lines expressing an artificial storage protein (Zhang et al., 2003) were used in this study. For mature leaf analysis 3 week old in vitro plants were transferred to soil and grown in a growth chamber at constant conditions for 3 months (30º C, 80-90% humidity, 100.000 Lux, Day/Night Cyclus: 16/8h). After three months all leaves of transgenic ASP1 cassava lines 1-5 (n=2), 1-8 (n=3), 1-13 (n=3), 1-11 (n=7), and wildtype TMS60444 (n=3) were collected, pooled for each plant, and analyzed for their protein and amino acid content. Cassava storage roots were harvested from greenhouse grown plants after 16 and 26 months. At the first time-point transgenic ASP1 cassava lines 1-1, 1-3, 1-5, 1-8, 1-11, and 1-13 were harvested (n=2 each), at the second time point lines 1-1 (n=2), 1-3 (n=2), 1-5 (n=2), 1-8 (n=3), 1-11 (n=3), 1-13 (n=3), 1-16 (n=2) and wildtype plants (n=3) were harvested and prepared for amino acid analysis. For spiking experiments one wildtype plant (35R6) was harvested after 12 month. One cassava plant was grown in Ivory Coast under field conditions for 15 months (F35R1). Three of its storage roots were harvested and a central, lateral cut of each root was prepared for amino acid analysis.
32
More transgenic cassava plants of lines 1-11, RV3-R1, RV3-R6, and RV9-R5 were harvested after 5 months growth in the green-house (n=2 each) together with WT plants (n=3) and their storage roots were prepared for amino acid analysis. Amino Acid Analysis Storage roots were peeled at the root cortex, sliced and freeze-dried for 24h while leaves were lyophilized directly. All plant material was ground afterwards to a homogenous powder and stored at -80◦C until use. Samples containing 1mg total protein were weighed and hydrolyzed with 2ml of 6M HCl for 24h at 110◦C in an oil bath using Argon as inert gas. After hydrolysis samples were evaporated (Rotavapor, BÜCHI Labortechnik AG, Switzerland) at ≤ 50°C, resuspended in 5ml sample buffer (0.16M Li-acetate-buffer, pH 2.20; No. 5.403.047, Laborservice Onken GmbH, Gründau-Breitenborn, Germany) and filtered through a 0.45-µm PVDF membrane (Millipore AG, Switzerland). 50µl of the solution were injected into an automated Biochrom30 Analyser (Laborservice Onken) and separated afterwards by ion exchange chromatography (Lithium High Resolution Column, 4.0x125mm, No. 5.503.611, Laborservice Onken) based on a 5 buffer system. Following separation, amino acids were derivatized with ninhydrin and detected at 570nm and 440nm. Quantification was based on external standards (Cat-No. 20088ZZ, Pierce, Perbio Science Switzerland SA, Lausanne, Switzerland) consisting of a mixture of 5.0nmol of each amino acid in 50µl loading buffer. Each analysis was performed with two technical replicates and several biological replicates (as described in section “plant material“). Spiking Experiment 50mg of pure methionine (Sigma-Aldrich Chemie GmbH, Switzerland) was weighed exactly in a 50ml volumetric flask which was filled with 6M HCl (25◦C). This solution (c=1mg/ml) was diluted 40x using the same solvent (c=25µg/ml). From the latter solution 2ml, 1ml, and 0.2ml were used for amino acid hydrolysis and spiked samples were treated as above. For XRFS, 5mg methionine and 5mg cysteine (Sigma-Aldrich Chemie GmbH, Switzerland) were added to 10g pure cellulose powder (Merck KgaA, Darmstadt, Germany). Powder was mixed in a mortar and treated as described below. XRFS Sample and standard treatment was mainly performed according to (Pinkerton et al., 1989). Pure cysteine (Sigma-Aldrich Chemie GmbH, Switzerland) was dissolved in water (c=20mg/ml). Amounts equivalent to 10, 50, 100, 200, and 500mg/kg sulfur were pipetted to 10g cellulose powder. The damp powder was shaken thoroughly and freeze-dried overnight. 10g of each reference powder and cassava sample powder were weighed exactly into a beaker. 2ml of a 10% Elvacite solution dissolved in acetone (ICI Acrylics Inc, Cordova, USA) was added in four parts of 500µl each. After addition of each part powder was stirred with a thick glass rod until acetone had evaporated. Dried powders were compressed to pills using a hydraulic press (400bar, 1min) and stored in an exsiccator until use. For analysis a wave-length dispersive X-ray fluorescence spectrometer (WD-XRF, Axios, PANalytical B.V., The Netherlands) was used (Start:110.000°0.535nm, End:111.500°0.540nm, Step width:0.002°, Time/point: 2.00s, Scan speed: 0.001°/s, Intensity: 0.1-1.9kcps, kV:24, mA:100, Collimator.:1/150µm, X-tal:Ge, Order:1, 2d:0.6532nm, Detector:Flow, Pulse height distribution (PHD) levels:25-75). Data was analyzed using Microsoft Excel and final values at wavelengths of interest (SKα lines) were obtained by averaging corresponding intervals ±0.010°. In order to calibrate our instrument a sample containing 1% sulfur (as pure cysteine from above) in oxidation state 6+ (S6+) was measured and found to have a fluorescence intensity maximum at 110.655 º2θ. The corresponding sample with 1% carbon-bonded sulfur (SC, as pure Na2SO4, Sigma-Aldrich Chemie GmbH, Switzerland) peaked at 110.745 º2θ. Measuring count rates at these two SKα lines in both samples resulted in background noise factors k1=0.743 and k2=0.838 that were subsequently used in order to calculate the true part of the
33
signal of carbon-bonded sulfur in all samples of interest (Table 2). A linear calibration line was established between 10-500mg/kg SC (r2=0.993) and reliability was confirmed in an F-test (α<0.01) and t-test (α<0.001).
Results
The magnitude of biological variation In a previous analysis of transgenic plants we reported significant changes in levels
of certain amino acids but not in total protein in leaves of plants grown in vitro (Zhang
et al., 2003). Here we extended this analysis using conventional ion-exchange
chromatography to a larger sample set of mature leaves of greenhouse grown plants
and could show that biological variation is too large to detect any differences
between lines, no matter if they were transgenic or not (p>0.05). The average protein
content of all 18 biological samples was 8.8(±1.4)g per 100g dried leaf material
corresponding to 16% variation (Table 1). Levels of most amino acids varied between
15% and 20%. Three amino acids varied exceptionally high, methionine (25%),
cystine (44%), and hydroxyproline (146%), respectively.
In order to extend the experiment to storage roots 18 plants of several transgenic and
non transgenic cassava lines were harvested and their amino acid profile was
determined after a growth period of 26 months in the greenhouse (the sum of all 18
plants was referred to as “set 1”). Differences between individual lines in protein or
amino acid content were not significant (p>0.05). Interestingly, the average protein
content of set 1 was measured to be 0.55(±0.08)g per 100g dried cassava flour which
is lower than expected. This variation of 14% is comparable to protein variation in
leaves (see above). Levels of most amino acids in roots were determined with
variation coefficients between 13% and 25% (Table 1). Again, three amino acids
varied considerably, methionine (35%), cystine (61%), and hydroxyproline (77%).
We concluded that biological variation can explain minor differences between
independent lines in leaves and roots for both true protein and most individual amino
acids. Exceptionally high variation was observed in particular in sulfur amino acids
and hydroxyproline when using conventional amino acid determination.
34
Time-dependent changes By extending our experiment to a temporal parameter we wanted to find out if
biological variation is different at an earlier time-point and if absolute values of protein
and amino acids remain constant. For this purpose 12 more storage roots (set 2)
were harvested at the age of 16 months (Table 1). We measured in set 2
0.94(±0.21)g total protein in 100g flour of storage roots corresponding to 22%
variation thus being slightly higher than variation in set 1. Most amino acids were
quantified with variation coefficients between 12% and 30% resulting in a biological
variation comparable to set 1. Here values of three amino acids showed significantly
higher variation than the others such as hydroxyproline (37%), arginine (74%), and
methionine (88%). Cystine was not detectable in any sample of set 2.
Regarding absolute values for total protein content as well as for most amino acids
set 2 differed significantly from set 1 (Figure 1). For protein we found an increase of
42% (p<0.001) compared to set 1 while most amino acids were increased by 14-
35%. Only aspartate/asparagine, glutamate/glutamine, arginine and histidine were
increased strongly by 42-81% in set 2.
Biological variation does not seem to be considerably affected by the age of cassava
storage roots. We could show that in particular methionine is difficult to quantify and
that cystine levels are probably below detection limits in younger storage roots.
External supplementation of methionine was considered in order to determine the
extent of destroyed methionine.
Recovery of methionine in spiked samples Methionine quantification without performic acid pre-oxidation led not only to a high
biological variation between plants but also to large technical errors when analysing
the sample repeatedly. These errors between analytical duplicates ranged from 1-
87% of each mean value thus weakening reliability of the measured result. The
lowest level of methionine determined in a single sample was 0.94mg/100g sample
while the highest was 15mg/100g sample (individual samples not shown). The
difference of average methionine content in set 1 [4.19(±1.49)mg/100g sample] was
not significant (p>0.05) compared to set 2 [4.83(±4.26)mg/100g sample] because
35
both confidence intervals were too large (α=0.05) which makes it impossible to detect
small but significant differences between sample groups.
In order to evaluate the reliability of methionine quantification based on the standard
protocol, one cassava storage root sample (35R6) was spiked with pure methionine
before acid hydrolysis in amounts of 5, 25, and 50mg per 100g sample. In the
unspiked sample 5.90(±1.38)mg methionine per 100g sample were found. After
addition of 5, 25 and 100mg methionine only 2.53(±0.97)mg, 12.05(±3.96)mg and
37.55(±1.84)mg per 100g sample, respectively, could be recovered. Thus recovery
rates of methionine were calculated as 23%, 39%, and 67%. As a consequence the
calculation of a correction factor seems inappropriate, in particular at low methionine
concentrations, and would require more points of measurement and repetitions.
Alternative determination of sulfur amino acids As an alternative to the standard protocol, we used X-Ray Fluorescence
Spectrometry (XRFS) for a spectroscopic and non-destructive determination of sulfur
amino acids in cassava storage roots thus bypassing partial degradation in acid
hydrolysis. The system required calibration of the instrument (see Material and
Methods) and measured carbon-bonded sulfur in powder pills made of cassava flour
which has been shown to correlate directly to sulfur present in methionine, cysteine,
and cystine (Pinkerton et al., 1989).
Root sample 35R6 which was previously used for spiking experiments was spiked
here, too, with 50mg methionine and 50mg cysteine per 100g sample and revealed a
recovery rate exceeding 90%. Compared to the previously determined SAA content
of sample 35R6 XRFS values were more than 5 times higher (Figure 2).
Another single sample (F35R1) contained 95mg/kg sulfur, which is equivalent to
40.28mg SAA in 100g sample, resulting in a value 8 times higher than previously
determined with conventional AAA.
Four more independent transgenic cassava lines (1-11, RV3-R1, RV3-R6, RV9-5)
and wildtype (WT) were measured as biological replicates in order to check for
variability of the method and its comparability to standard AAA. Errors between all
biological replicates of these lines (in above order) for SAA were decreased from 45,
5, 26, 45, and 43% to 13, 10, 4, 3 and 6% when subjecting the same samples first to
the standard protocol and then to XRFS (Figure 2). Remarkably, absolute SAA levels
36
calculated here from XRFS measured sulfur were 4-6 times higher than those levels
measured with standard AAA.
Our XRFS data suggests that true SAA levels might be much higher in cassava
samples than previously assumed and that with XRFS these values can be detected
and quantified reliably regardless which SAA is predominant.
Discussion We have adapted XRFS for a more accurate and reliable determination of SAA in a
large cassava sample set of cultivar TMS60444. Additionally, protein levels and
amino acids were determined and revealed the importance of biological variation in
cassava leaves and roots. Average protein contents measured in this study are
determined as sum of all individual amino acids obtained after acid hydrolysis
(AOAC, 1997). This method is seen as one of the most reliable ways of protein
determination in contrast to faster spectroscopic methods (Crabb et al., 1997; FAO,
2003). To date, studies have not applied uniformed standards for protein
determination, often opting to determine crude protein content using the Kjeldahl
Nitrogen method (Yeoh and Chew, 1977; Gomez and Noma, 1986; Velmurugu,
1993; Awoyinka et al., 1995; Akinfala et al., 2002; Ceballos et al., 2006). This
provides only an estimate since nitrogen to protein conversion factors have been
shown to vary significantly in cassava (Yeoh and Truong, 1996). But even those
protein values determined as sum of amino acids are obtained using non-
standardized procedures. For example, Ngudi et al. (2002) and our own lab
subjected lyophilized cassava flour to acid hydrolysis, whereas Nassar and Sousa
(2007) first extracted root proteins that were then hydrolyzed. It is apparent that a
standardized protocol describing protein analysis which is based on established
protocols (AOAC, 1997) is critical to normalize results obtained from different
laboratories.
For the analysis of individual amino acids hydroxyproline determination resulted in
high variation coefficients. This is due to the measurement of hydroxyproline being
close to technical detection limits (Fountoulakis and Lahm, 1998). It is known that
plants contain only minimal amounts of hydroxyproline (mainly in cell wall proteins) in
contrast to animal derived tissue (e.g. collagen in connective tissue) rendering
37
determination of this amino acid difficult in cassava (Showalter, 1993). Variation
during determination of SAA has been described already before when using
conventional analysis of amino acids by ion-exchange chromatography after acidic
hydrolysis (Ozols, 1990; Darragh et al., 1996). However, in this paper cysteine
signals could never be recorded as such or as cysteic acid even when pure cysteine
in amounts of up to 50mg /100g sample were added to the hydrolysis solution (data
not shown) which is not in accordance to the literature (Fountoulakis and Lahm,
1998). It seems that cysteine oxidative degradation besides partial dimerisation to
cystine happens quickly and quantitatively resulting in a loss of cysteine signal.
Our data further supports the results of Ngudi et al. (2002) who found high cysteine
levels in African cassava cultivars. Compared to methionine cysteine levels in their
cultivars were up to 10 times higher. Here, 4-8 times higher values of SAA were
detected with XRFS than with AAA while our recovery rate experiments suggest that
only a minor part of this increase is due to destroyed methionine. Consequently, we
interpret our XRFS results in a way that cassava storage roots in fact contain
significant amounts of cysteine.
After dimerisation cystine was more resistant to oxidative degradation in our AAA
experiments. This was in particular evident for storage roots of set 1 where
abundance of cystine was confirmed. Currently, we can only speculate whether the
age of plants at harvest is related to cystine levels but it is a fact that in 10 month
younger storage roots (set 2) cystine could not be detected. This finding is contrary to
the fact that all other amino acids show higher levels in these younger storage roots
of set 2 compared to set 1. We think this anti-correlation could be further clarified in
the future by determination of monomeric cysteine levels in both sets because we
hypothesize that cysteine levels are lower when cystine levels are higher due to an
increased dimerisation. XRFS is not suitable for this purpose because only the sum
of all SAA can be detected. Furthermore XRFS leads to a slight overestimation of
SAA since some other sulfur-containing molecules like enzymes or thioglucosides
are detected, too. And in terms of processing and shelf life of cassava derived
products knowledge of the specific levels of methionine and cysteine would provide
an even better estimation due to unequal chemical properties of these amino acids.
However, XRFS is superior to conventional determination of amino acids from a
nutritional point of view because there the sum of all SAA is more important than
individual levels due to their metabolic inter-convertibility.
38
Based on limitations discussed here during determination of SAA we would like to
indicate the need for new approaches and XRFS has been evaluated here as a fast,
easy and reliable alternative suitable for nutritional characterisation of cassava
storage roots. We could show that analytical specificity of the method and linearity of
the signal is given according to the recovery rate of >90% and the statistical
robustness of the calibration line used. So far only one laboratory reported use of this
method for analysis of plant material (Tabe and Droux, 2001, 2002; Chiaiese et al.,
2004) achieving a similar high specificity (Tabe, pers. Comm.).
Consequently, in particular cassava researchers should consider complementing
their protein and amino acid determination with XRFS in order to bypass losses of
SAA due to hydrolysis.
Acknowledgements We would like to thank Dr. Zohouri Pierre & Mr. Boni Nzué (Centre National de
Recherches Agronomiques, CNRA, Abidjan Côte d'Ivoire) for providing us with field-
grown storage roots of TMS60444, Hanna Schneider for her technical help with the
Amino acid analyses, Lydia Zehnder for her support in XRFS.
References Akinfala EO, Aderibigbe AO, Matanmi O (2002) Evaluation of the nutritive value of
whole cassava plant as replacement for maize in the starter diets for broiler chicken. Livestock Research for Rural Development 14
AOAC (1997) Official methods of analysis of AOAC international, Ed 16 Vol 3. Elsevier, Amsterdam
Awoyinka AF, Abegunde VO, Adewusi SR (1995) Nutrient content of young cassava leaves and assessment of their acceptance as a green vegetable in Nigeria. Plant Foods for Human Nutrition 47: 21-28
Ceballos H, Sanchez T, Chavez AL, Iglesias C, Debouck D, Mafla G, Tohme J (2006) Variation in crude protein content in cassava (Manihot esculenta Crantz) roots. Journal of Food Composition and Analysis 19: 589-593
Chiaiese P, Ohkama-Ohtsu N, Molvig L, Godfree R, Dove H, Hocart C, Fujiwara T, Higgins TJV, Tabe LM (2004) Sulphur and nitrogen nutrition influence the response of chickpea seeds to an added, transgenic sink for organic sulphur. Journal of Experimental Botany 55: 1889-1901
Cock JH (1982) Cassava - a Basic Energy-Source in the Tropics. Science 218: 755-762
Crabb JW, West KA, Dodson WS, Hulmes JD (1997) Amino Acid Analysis. In JE Coligan, ed, Current Protocols in Protein Science. Wiley-Interscience, pp 11.19.11-11.19.42
39
Darragh AJ, Garrick DJ, Moughan PJ, Hendriks WH (1996) Correction for amino acid loss during acid hydrolysis of a purified protein. Analytical Biochemistry 236: 199-207
FAO (2003) Food energy - methods of analysis and conversion factors: Report of a technical workshop - Rome, 3–6 December 2002, Vol 77. Food and Agriculture Organization of the United Nations, Rome
FAO (2004) Agricultural biotechnology Meeting the needs of the poor? Food and Agriculture Organization of the United Nations FAO, Rome
FAO (2005) FAOSTAT data. In, Vol 2006 Fountoulakis M, Lahm HW (1998) Hydrolysis and amino acid composition analysis
of proteins. Journal of Chromatography A 826: 109-134 Gomez G, Noma AT (1986) The Amino-Acid-Composition of Cassava Leaves,
Foliage, Root Tissues and Whole-Root Chips. Nutrition Reports International 33: 595-601
Nassar NM, Sousa MV (2007) Amino acid profile in cassava and its interspecific hybrid. Genetics and Molecular Research 6: 192-197
Ngudi DD, Kuo YH, Lambein F (2002) Food safety and amino acid balance in processed cassava "Cossettes". Journal of Agricultural and Food Chemistry 50: 3042-3049
Ozols J (1990) Amino-Acid-Analysis. Methods in Enzymology 182: 587-601 Parvy P, Bardet J, Rabier D, Gasquet M, Kamoun P (1993) Intra- and
interlaboratory quality control for assay of amino acids in biological fluids: 14 years of the French experience. Clinical Chemistry 39: 1831-1836
Pinkerton A, Randall PJ, Norrish K (1989) Estimation of Sulfate and Amino-Acid Sulfur in Plant-Material by X-Ray Spectrometry. Communications in Soil Science and Plant Analysis 20: 1557-1574
Showalter AM (1993) Structure and function of plant cell wall proteins. Plant Cell 5: 9-23
Tabe LM, Droux M (2001) Sulfur assimilation in developing lupin cotyledons could contribute significantly to the accumulation of organic sulfur reserves in the seed. Plant Physiology 126: 176-187
Tabe LM, Droux M (2002) Limits to sulfur accumulation in transgenic lupin seeds expressing a foreign sulfur-rich protein. Plant Physiology 128: 1137-1148
USDA (2005) U.S. Department of Agriculture, Agricultural Research Service. National Nutrient Database for Standard Reference, Release 18. In Nutrient Data Laboratory Home Page, http://www.nal.usda.gov/fnic/foodcomp,
Velmurugu R (1993) Cassava leaves as animal feed: Potential and limitations. Journal of the Science of Food and Agriculture 61: 141-150
Yeoh HH, Chew MY (1977) Protein content and acid composition of cassava seed and tuber. Malaysian Agricultural Journal 51: 1-6
Yeoh HH, Truong VD (1996) Protein contents, amino acid compositions and nitrogen-to-protein conversion factors for cassava roots. Journal of the Science of Food and Agriculture 70: 51-54
Zhang P, Jaynes JM, Potrykus I, Gruissem W, Puonti-Kaerlas J (2003) Transfer and expression of an artificial storage protein (ASP1) gene in cassava (Manihot esculenta Crantz). Transgenic Research 12: 243-250
40
Figures and Tables Table 1
Tabl
e 1:
Am
ino
acid
ana
lysi
s of
cas
sava
leav
es a
nd s
tora
ge ro
ots.
Ave
rage
val
ues
(in g
/100
g sa
mpl
e) c
onsi
st o
f sev
eral
in
depe
nden
t lin
es b
eing
bio
logi
cal
repl
icat
es (
n).
All
sam
ples
wer
e ad
ditio
nally
ana
lyze
d as
tec
hnic
al d
uplic
ates
. S
tand
ard
devi
atio
n is
sho
wn
as a
bsol
ute
valu
e (S
D)
and
rela
tive
to a
vera
ge (
varia
tion)
. S
ome
amin
o ac
ids
wer
e no
t de
tect
able
(ND
). Tr
ypto
phan
e w
as n
ot d
eter
min
ed (n
.det
.)
41
Figure 1
Figu
re 1
: G
raph
ical
com
paris
on o
f am
ino
acid
pro
files
in c
assa
va s
tora
ge r
oots
har
vest
ed a
fter
26 m
onth
(se
t 1)
and
afte
r 16
mon
th (
set
2) g
row
th.
Leve
ls o
f al
l am
ino
acid
s ar
e in
crea
sed
in s
et 2
com
pare
d to
set
1 e
xcep
t C
ys-C
ys.
Ave
rage
tota
l pro
tein
is il
lust
rate
d as
frac
tion
repr
esen
ting
one
tent
h of
real
val
ue (P
/10)
.
42
Figure 2
Figu
re 2
: Gra
phic
al c
ompa
rison
of S
AA
det
erm
inat
ion
in s
ever
al c
assa
va s
ampl
es u
sing
XR
FS a
nd c
onve
ntio
nal A
AA. F
or d
escr
iptio
n of
sa
mpl
es r
efer
to te
xt. E
rror
bar
s re
pres
ent s
tand
ard
devi
atio
n of
bio
logi
cal r
eplic
ates
whe
re a
vaila
ble.
Sam
ple
“spi
ke”
depi
cts
mea
sure
d va
lues
of s
piki
ng e
xper
imen
t whi
le b
lue
bar i
n sa
mpl
e “r
efer
ence
” dep
icts
cor
resp
ondi
ng e
xpec
ted
valu
e. G
reen
bar
in s
ampl
e “r
efer
ence
” w
as o
btai
ned
usin
g co
nven
tiona
l AA
A a
nd p
erfo
rmic
-aci
d pr
etre
atm
ent
as r
elia
ble
liter
atur
e re
fere
nce
valu
e fo
r ca
ssav
a flo
ur.
(U
SDA,
43
VII. ER-retained ASP1 increases protein content in cassava storage roots
Target Journal: Plant Biotechnology Journal Authors: Stupak M, Faso C, Gruissem W, Zhang P
Abstract Cassava is regarded as a food crop of global relevance for human nutrition. Millions
of consumers rely on its storage roots as a good source of carbohydrates but they
may develop severe protein deficiency because endogenous root protein levels are
very low. In this report we present a significant improvement of cassava root protein
and amino acid content by gene transfer and expression of the following
heterologous storage proteins: ASP1, sporamin, and zeolin. All proteins were
coupled to an endoplasmic reticulum retention signal and successfully accumulated
in this organelle. We could observe this by using a newly established transient
protoplast expression system for cassava. Finally, analysis of transgenic plants stably
expressing the ASP1 protein showed significant increases in levels of essential
amino acids, up to 35%. Our data suggests that ER retention is more efficient than
cytosolic protein accumulation in cassava storage roots and that this approach
should be adopted in the near future for the nutritionally most relevant protein
candidate.
Introduction Cassava (Manihot esculenta Crantz) is one of the most important food crops in
tropical developing countries since more than 600 million people rely on it as a staple
food source (FAO, 2005). It is highly tolerant to drought and poor soil conditions while
producing acceptable yields (Cock, 1982). Cassava serves as an excellent famine
reserve particularly for subsistence farmers in sub-Saharan African countries (FAO,
2004). Unfortunately, many communities relying on a cassava-based diet suffer from
Protein-Energy-Malnutrition (PEM) because their daily food intake does not contain
enough protein with essential amino acids (EAAs). PEM most likely leads to
Kwashiorkor or Marasmus - two of the most severe malnutrition-derived medical
conditions (Scrimshaw, 2007). Disturbance of growth, amyosthenia, fermentation-
44
induced diarrhoea, and fatty liver are common symptoms but far more attention has
been given to symptomatic children with a swollen belly and a senile facial
expression. A correlation between nutritional cassava dependency and PEM has
been found to be due to the very low protein content of cassava storage roots and
therefore strategies have been recently considered to increase its protein levels.
Such approaches could impact and in the long term reduce prevalence of PEM in
areas where cassava is the main staple crop (Stupak et al., 2006).
In our laboratory we have adopted heterologous expression of nutritional storage
proteins as a strategy to increase protein content and our previous results have
already provided a proof of concept for the feasibility of expression and accumulation
in cassava (Zhang et al., 2003).
Within this paper we make use of a well established transient GFP reporter system
and apply it to cassava allowing confirmation of functional targeting in cassava
protoplasts in a quick and easy way. We report the transient transformation of
cassava callus-derived protoplasts with several constructs. Their expression profile is
discussed with the aim to understand if certain cassava cellular compartments can
be suitable for storage protein accumulation. We investigated the accumulation
pattern of 3 proteins, namely ASP1 (Kim et al., 1992), sporamin (Maeshima et al.,
1985), and zeolin (Mainieri et al., 2004).
The rough endoplasmic reticulum (RER) has been successfully used in the past
years for protein storage and accumulation (Denecke et al., 1992; De Jaeger et al.,
2002; Mainieri et al., 2004). We also decided to target the cassava RER to
understand if this organelle in cassava can be used for the same purpose. High
protein levels in cassava storage roots have been achieved by accumulating one of
our chosen storage proteins (ASP1) within the RER. All our constructs include the
p54 promoter, an endogenous cassava promoter which is stronger than the
constitutive CaMV 35S promoter in directing gene expression in cassava roots
(Zhang et al., 2003). Our combined data provides evidence that protein targeting to
the RER in cassava is more efficient than untargeted cytosolic protein deposition for
protein accumulation in planta.
45
Results
Functional ER retention can be visualized in cassava protoplasts using GPF reporter fusions
Transformation vectors were generated with a prolamin signal sequence preceding
the storage protein coding sequence at its 5’ and a KDEL endoplasmic reticulum
retention signal (Denecke et al., 1992) at the 3’ end. The first 20 amino acids of the
signal sequence were predicted to trigger entrance into the secretory pathway and to
be cleaved off by peptidases co-translationally (Nielsen et al., 1997; Emanuelsson et
al., 2000). In order to visualize storage protein deposition within cassava cells we
generated N-terminal eGFP fusions. We decided to integrate the reporter gene
between the signal sequence and storage protein-gene to minimize disturbance of
protein-KDEL tertiary structure and thus putative influence on ER-retention (see
chapter XI for vector maps). After transforming protoplasts with vector RV3
containing ASP1 Confocal Laser Scanning Microscopy (CLSM) detected green
fluorescence in filament-like structures surrounding the nucleus and expanding
throughout the cytosol (Figure 1, A1-E1). Fluorescence co-localized with an ER-
resident chaperone (BiP) fused to RFP when co-transforming protoplasts with both
plasmids.
In order to find out whether the C-terminal retention signal is mandatory for protein
accumulation or ASP1 alone would be able to form stable protein aggregates within
the ER lumen, a TAG stop codon was cloned between ASP1 and KDEL genetic
sequences. The control vector (RV3-) was repeatedly used for cassava protoplast
transformation together with the BiP-RFP control plasmid and this protoplast
suspension was split in two parts. Prior to microscopic observation one half of the
suspension was treated with Brefeldin A in order to disrupt the Golgi apparatus while
the other half remained untreated. Protoplasts in the untreated half never resulted in
a positive green fluorescence signal though RFP fluorescence could be observed
(data not shown). Those protoplasts subjected to Brefeldin A treatment had restored
a green signal that co-localized with BiP-RFP (Figure 1, A2-E2).
In order to check whether the storage protein itself had a significant impact on protein
retention and accumulation we exchanged ASP1 with sporamin and zeolin,
respectively. Sporamin (RV6) co-localized with our BiP-RFP control indicating ER
retention comparable to ASP1 (Figure 1, A3-E3). Since zeolin had been reported to
46
exhibit a cryptic ER retention signal we omitted in this vector the C-terminal KDEL
sequence. After transient protoplast expression of this vector (RV14) significant
levels of green fluorescence were detected both in ER lumen and in the vacuole
(Figure 1, A4-E4).
Stable cassava transformation and transgene integration Following transient expression, one of the successful constructs (RV3) was used for
stable cassava transformation in order to obtain functional ER retention of a
heterologous storage protein in planta. We managed to regenerate 7 independent
transgenic lines that had stably integrated the transgene (Figure 2). Lines RV3-1a, -
1b, and -R4 had the cassette integrated once while RV3-6 and -R5 obtained two
copies. Lines RV3-R1 and -R6 showed integration of multiple (>3) or partial copies.
As a control, one of our previously regenerated lines (1-11) was included.
ASP1 gene has a higher expression in leaves than in roots in vitro After confirming that all lines had integrated the cassette into their genome we
wanted to quantify expression levels of the transgene. Relative ASP1 expression of
all 7 lines normalized to an internal reference gene (PP2A) was quantified using
Real-time PCR (Figure 3). Lines RV3-R1 and RV3-R6 showed no significant ASP1
expression both in roots and in leaves. All other transgenic lines showed ASP1
expression in both leaves and roots at various levels. Four lines showed higher ASP1
expression in leaves than in roots and one line (RV3-R5) had ASP1 expressed
equally in both organs. Leaf-expression in general was found to be significantly
higher (p<0.05) than root-expression in the same line in a paired two-tailed t-test.
Technical reproducibility of these results was achieved with a confidence interval of
<6%.
ER retention constructs trigger increased ASP1 Protein accumulation
Protein levels of transgenic cassava roots were visualized and compared on a
Western blot (Figure 4). Integrated densities of the bands were measured (ImageJ)
and are displayed in the same figure to ease semi-quantitative conclusions. Lines
RV3-R1 and RV3-R6 showed no detectable protein levels of ASP1 which correlates
with transcript levels. Root levels of our control line 1-11 expressing ASP1 without
47
any targeting signals and being driven by a CaMV 35s promoter instead of p54
(Zhang et al., 2003) were below the sensitivity of our assay. Compared to that control
all lines expressing the transgene (RV3-1a, -1b, -6, -R4, -R5) showed increased
protein abundance with RV3-R5 and RV3-1b having the highest level of ASP1.
A phenotypic disorder could be observed When mature plants of transgenic and wildtype cassava lines were analysed five out
of seven transgenic lines exhibited a distinct phenotypic difference in their
morphology. In these transgenic lines average leaf-size was reduced, leaf shape was
wrinkled, plants were stunted and total root weight was reduced (Figure 5). At
harvest some plants had not developed storage roots. Out of six plants of line RV3-
1b only three had developed storage roots (50% storage root formation frequency),
for lines RV3-1a, -6, -R4, and -R5 frequency of storage root formation was even
lower than for line RV3-1b (38%, 20%, 0%, 0%). Lines RV3-R1 and RV3-R6 were the
only transgenic lines having formed storage roots in all observed plants (frequency of
100%) like wildtype and control line 1-11.
Total root weight (fresh) of all plants was determined after harvest and was ranging
from 1g to 325g. Fresh weight of fibrous roots was quite low and never exceeded
14g. We observed a significant difference between the root weight of three lines
(RV3-1a, -1b, -6) which were all lighter than 72 g, and the root weight of two lines
(RV3-R1 and –R6) which were all heavier than 79 g. These two lines RV3-R1 and –
R6 were morphologically indifferent to wildtype plants.
Leaf size of five transgenic lines (RV3-1a, 1b, -6, -R4, and -R5) was smaller than WT
with a wrinkled leaf shape while in two lines (RV3-R1 and –R6) leaf size and shape
was indifferent to WT (Figure 5).
Plant height was measured at 25cm intervals. RV3-R5 was less than 25cm in height
and thus much shorter than all other lines. RV3-1a, -1b, and
-R4 had heights of less than 75cm. RV3-6, -R1, and -R6 were less than 125cm high
and thus comparable in plant size to wildtype and control line 1-11.
48
Total protein content of storage roots is changed In order to check for improvements, protein content and amino acid composition was
determined in all available storage roots using an amino acid analyser. We
discovered major differences in total protein content at two different time-points of
harvest (Figure 6). Storage roots of five month old WT plants contained 1.33(±0.16)g
total protein in 100g freeze-dried flour and control line 1-11 contained
1.40(±0.09)g/100g. The three transgenic lines analysed here (RV3-1b, -R1, -R6)
contained significantly more protein ranging from 1.55g/100g to 5.62g/100g thus
representing a relative protein increase of 38% (RV3-R1), 82% (RV3-R6), and 3.2
fold (RV3-1b) compared to WT. We checked the same lines 3 months later (after
eight months total growth in the green-house) and discovered a reduction in total
protein content in both transgenic and control lines. Total protein content in WT and
control plants was slightly reduced to 0.79(±0.13)g protein per 100g cassava flour
while protein in all transgenic lines was now ranging from 0.89g/100g to 1.29g/100g.
Compared to control lines these transgenic lines contained slightly more total protein,
in detail 14% (RV3-1A), 64% (RV3-6), 10% (RV3-R1), and 7% (RV3-1B).
Analysis of all amino acids in our samples revealed major differences between
transgenic and control lines. After 5 months arginine content in line RV3-1b was 14-
fold increased compared to WT but 3 month later no significant difference could be
seen anymore. All remaining amino acids in this line were initially increased (after five
months growth) by 1.7 to 9.6-fold compared to controls and showed later (after eight
months) still some improvement compared to controls though less significant with
increases ranging from 5% for tyrosine to 31% for aspartate/asparagine. For lines
RV3-1A and RV3-1B the increase in each amino acid can be seen in Figure 7. Taken
together our data suggests that the point of harvest is critical for relative
measurements of protein and amino acids. So far improvements seem to be
pertinent in transgenic lines but analysis of storage roots at a later time-point might
give us more information about the reasons behind these changes.
Discussion The ER has already been used in many crops for storage protein accumulation (De
Jaeger et al., 2002; Mainieri et al., 2004; Yang et al., 2005). Here we wanted to test
this cellular compartment in cassava for protein accumulation using three different
storage proteins. Since cassava stable transformation is known to require long
49
periods of tissue culture (e.g. Zhang and Gruissem, 2004), establishment of a
functional transient expression system was reasonable in order to process different
transformation constructs in parallel and to screen for the most suitable one. The
system we present here revealed functional targeting of three storage proteins to the
ER as well as to vacuoles and plastids (chapters eight and nine). One of our
candidates (ASP1) was subsequently used for stable transformation. So far, only
qualitative differences in fluorescence could be observed between protein candidates
because the GFP signal could not be normalized to any reference and showed
variation probably due to transformation efficiency or signal stability towards photo-
bleaching. To improve signal quantification the utilization of available quantitative
fluorescence methods like FRAP would be helpful together with the introduction of a
fluorescent reference gene into the same vector (e.g. nuclear-targeted RFP) in order
to compensate for variable transformation efficiency.
Of all three ER-targeted constructs only zeolin (RV14) revealed dual targeting to
vacuoles and ER. But since we could provide evidence (by using RV3- with and
without Brefeldin A) that the prolamin signal sequence triggers secretion unless a
KDEL signal is present, a vacuolar protein deposition was not expected. It has been
reported that both γ-zein in maize and phaseolin in beans, which are the two proteins
zeolin is comprised of, are found in protein storage vacuoles and ER. Only the fusion
protein zeolin appeared to induce protein aggregation and subsequently formation of
insoluble and stable protein bodies in the ER of transgenic tobacco leaves (Mainieri
et al., 2004). This seems not to have happened in cassava. Currently, we do not
know whether this is a transient effect or cassava in general is not able to form
protein bodies. Analysis of stably transformed cassava plants expressing zeolin
would provide further evidence.
Sporamin has never been expressed in cassava so far. In this transient protoplast
system we could show that it forms a stable protein, no matter if targeted to ER,
vacuoles, or plastids (partly discussed in chapters eight and nine). We think that this
protein remains a suitable candidate for stable transformation trials.
ASP1 fused to GFP gave us a very reliable and stable signal. Clearly, only ER was
used as protein storage location and no other cellular organ was affected. This
together with the fact that we had ASP1 already expressed in cassava previously,
convinced us to use this vector for stable transformation trials.
50
Several of these established cassava lines presented here were shown to express
ASP1 constitutively after genomic integration of the transgene. However, two lines
out of 7 (RV3-R1 and RV3-R6) had no detectable expression both on a
transcriptional and a translational level. Although the relationship between transgene
induced gene-silencing and copy numbers is still not fully understood it is generally
assumed that multiple copies can be associated with low expression levels (Flavell,
1994; Vaucheret et al., 1998; Muskens et al., 2000). The two lines showed genomic
integration of multiple copies (>3) which could be the reason for the absence of ASP1
expression. Although a single gene insertion does not guarantee predictable
expression levels either (Elmayan and Vaucheret, 1996; De Wilde et al., 2001; Meza
et al., 2002) a reduced amount of integrated copies should reduce silencing
probability. Besides these two, our transgenic lines did not show any correlation
between expression levels and number of inserts.
We checked the levels of expression in leaves and roots of all our transgenic lines
using Real-time PCR and in order to achieve comparable results we used
Serine/Threonine protein phosphatase catalytic subunit 2A (PP2A) as a
housekeeping gene that was predicted to have equal expression levels in both
organs in A. thaliana according to Genevestigator (Zimmermann et al., 2004;
Zimmermann et al., 2005) and proved to be superior to variable tubulin expression
(Czechowski et al., 2005). After normalization ASP1 expression could be shown to
be significantly stronger in leaves than in roots in 3 week-old in vitro plants. This is in
contrast to our previous findings where gene expression of promoter p54 fused to the
uidA reporter gene was reported to be weaker in leaves than in primary roots (Zhang
et al., 2003). Since this study here is the first and only report where promoter p54
was used for a functional gene we currently cannot conclude whether ASP1 had an
influence on this altered expression pattern, e.g. via mRNA stability, or PP2A
expression behaviour is significantly different between Arabidopsis and cassava. The
ongoing generation of cassava plants with other functional genes driven by p54 will
provide further inside into this question.
At a translational level, semi-quantified protein bands seemed to be comparable to
transcript abundance. Lines RV3-R4 and RV3-R5 showed similar expression levels
both in leaves and roots on a Western blot and thus are in accordance with our Real-
time PCR data (data not shown). Compared to our untargeted control line 1-11
51
protein levels in those two lines were slightly higher in leaves and much higher in
roots.
Unexpectedly, regeneration of our transgenic cassava lines was accompanied by a
morphological phenotypic disorder. Five out of seven regenerated lines (71%)
showed this alteration at variable extent. Because cassava is subjected to a long
period of tissue culture for generation of transformable material and regeneration of
the transformed cells into plantlets, somaclonal variation (Larkin and Scowcroft,
1981) could explain the abnormal phenotype observed in the transgenic lines. From
other plant species low values are reported (0.05%-67%) for somaclonal variation (Li
et al.; Munthali et al., 1996; Polanco and Ruiz, 2002; Bednarek et al., 2007) but they
are probably difficult to compare because of the length of cassava transformation
which goes up to 9 months. Results regarding somaclonal variation directly obtained
from cassava are therefore needed but rather rare. Raemakers et al. (2001) reported
both a genotypic and temporal dependency of abnormal regeneration with cultivar
TMS60444 (the same we used in this study here) showing the best genetic stability.
On a time scale they observed some changes in this cultivar, depending on dwell
time of FECs in liquid cultures. After 6 months 100% of regenerated plants were
found with a normal phenotype. After 24 months the share of normal regeneration
dropped to 85% and reached even 0% after 30 months in one particular case
(Schreuder et al., 2001). Interestingly, the phenotype of these abnormal plants could
be partly restored after greenhouse propagation via stem-cuttings. Recently, the
same group published some more results with cultivar TMS60444 where they claim
to have regenerated even 95% of their plants with a normal phenotype although their
calli were in liquid cultures for 14-18 months (Raemakers et al., 2007). The
transgenic lines we present in this study have been kept in tissue culture for an
average of 5-6 months (Zhang and Gruissem, 2004) and thus a share of tissue
culture derived phenotypic disorder of 71% seems unlikely. Instead we examined
those two out of seven lines with a normal morphology closer and found them to
coincide with those lines that had our transgene silenced (RV3-R1 and RV3-R6).
Further green-house propagation via stem cuttings of all lines did not cause any
morphological improvement (data not shown).
Regardless of the altered phenotype, amino acid analysis could show improvements
in total protein content and most amino acids. Results regarding SAA should be
analysed with care since we could show elsewhere that absolute values are probably
52
more than four times higher (chapter six). Nevertheless, SAA levels might be
improved here, too. The high abundance of arginine in many transgenic plants was
not expected but could be related to the fact that in many plants, arginine serves as a
major nitrogen source preferably for storage. E.g. in Arabidopsis thaliana arginine
accounts for 11% of total seed nitrogen (Vanetten et al., 1967; Polacco and Holland,
1993). We think that our transgenic plants were probably more efficient in nitrogen
storage than our control plants and this consequently led to increased true protein
contents in young storage roots. However, 3 months later roots did not show this
tendency for nitrogen storage anymore leading most probably to the reduced protein
levels we observed. Currently, we do not fully understand the mechanism behind
these observations and need to wait for the regeneration and analysis of more
transgenic plants. Nevertheless, our plants showed at any time of harvest superior
abundance of essential amino acids with increases of up to 35% indicating the
importance of our approach for improving the nutritional value of cassava storage
roots.
Experimental procedures Vector construction Transformation vectors were designed using pCAMBIA1301 (Cambia, Australia) as a backbone (for vector maps see chapter XI). A synthetic oligo (“KDEL oligo”) containing a KDEL sequence followed by a Stop-codon, was digested with PstI and BstEII and cloned into our pCAMBIA backbone. ASP1 gene was amplified from pCASP1 (Zhang et al., 2003) using primers “ASP1 Fwd” and “ASP1 Rev” and cloned into our KDEL-backbone using SmaI/SalI. The 5’-targeting signal of the prolamin gene (Acc.Nr.: NM_001061752) was amplified from genomic DNA of O. Sativa using primers “ProlSS Fwd” and “ProlSS Rev” and cloned into the cassette using KpnI/SmaI. The endogenous cassava promoter p54 was amplified with PCR from pCP54GUS (Zhang et al., 2003) using primers “p54 Fwd” and “p54 Rev” and cloned into the cassette using EcoRI/NcoI (RV3). The sporamin gene was amplified on the plasmid PspoAF-1 (Matsuoka and Nakamura, 1991) (primers “Spor Fwd” and “Spor Rev”) and inserted into the vector backbone RV3 using SmaI/PstI thus replacing ASP1 (RV6). The gene coding for zeolin was amplified from a pDHA vector (Mainieri et al., 2004) (primers “Zeolin Fwd” and “Zeolin Rev”) and cloned into RV3 using SmaI/SalI. The 5’ signal sequence of the sporamin gene (Acc.Nr.: DQ195772) was amplified using PCR (primers “SporSS Fwd” and “SporSS Rev”) on the plasmid PspoAF-1. The PCR product was digested with BspHI/SmaI and cloned into the zeolin containing vector digested with NcoI/SmaI thus replacing the prolamin signal sequence (RV14). Primers Name sequence (5’-3’) KDEL oligo GCCTGCAGGAAGGACGAGCTCTAGAGGTCACCGCG ASP1 Fwd CAGCGCCTCTCCATGGCCCGGGATGCTTGAAG
53
ASP1 Rev CTATGTCGACATTCCCGATCGTTCAAAC ProlSS Fwd GATAGGTACCATGGGGATGAAGATCATTTTCG ProlSS Rev CGCCTCTGCGCCCGGGATAT p54 Fwd TAGAATTCGGATCCACGGGTGTGGGCCAACTC p54 Rev CTATTTCATTTTCTCTTGCTTTCGCCACCATGGAG Spor Fwd AACCCGGGTCCTCTGAAACTCCAGTAC Spor Rev GTCATCAAACCTACCGATGTCTGCAGTG Zeolin Fwd TCACCCGGGACTTCACTCCGGGAGGAGGAAG Zeolin Rev CATCCAAGCCCGTGCCAGTAGTCGACGGC SporSS Fwd CATCATGAAAGCCCTCACACTGG SporSS Rev CCCCACCACACACGAACCCGGGTC Hpt II Fwd TCTCGATGAGCTGATGCTTTGG Hpt II Rev AGTACTTCTACACAGCCATCGG PP2A-RT Fwd TGTGGAAATATGGCATCAATTTTGG PP2A-RT Rev GCAACAGAAAGCCGTGTCAC ASP1-RT Fwd CCCGGGATGCTTGAAGAGC ASP1-RT Rev CTAGAGCTCGTCCTTCCTGC Plant Material Transformation of cassava (cultivar TMS60444) was conducted using Agrobacterium-mediated gene transfer into friable embryogenic callus (FEC) tissue essentially as described by (Zhang and Gruissem, 2004). Hygromycin-resistant transformants were regenerated in vitro. Three-week old plantlets were transplanted to pots and transferred to the greenhouse. Leaves, roots and storage roots were harvested after 5 months and 9 months. Experimental setup included previously established transgenic plants expressing cytosolic ASP1 (Zhang et al., 2003). Protoplast experiments Cell content of one jar cassava callus tissue (1-2g) was treated with 50ml of enzyme solution A under sterile conditions and incubated at 26°C in the dark for 16h (shaking at ~80rpm). Digested solution was filtered (50µm) and filter was washed with 10ml wash solution B. Protoplasts in flow-through were pelleted (15ml Falcon tubes, 70g, 10min) and washed twice with solution B. Protoplasts were counted (Jessen chamber) and resuspended in salt solution C depending on yield (1 to 3x106 protoplasts /ml). To 1ml of protoplast solution 20µg of plasmid DNA were added and gently mixed. Then 1ml of PEG solution D was added slowly and samples were incubated while gently shaking (RT, 5min).Then 6ml of nutrient solution E were added and samples were incubated for recovery (RT, dark, ~80rpm, 40-48h). Protoplasts were concentrated, warmed to 30°C and mixed with an equal part of low-melting-point agarose (2%, 45°C). Final solution was spread on microscopic slides (warmed to 33°C) and cooled to RT. Samples were observed using Confocal Laser Scanning Microscopy (Leica SP1-2) and images were processed using Imaris software (Bitplane AG, Zurich, Switzerland). Each vector was used in at least three independent tranformations and within each batch of transformation several protoplasts were checked for homogenicity and reproducibility of GFP pattern. Solution A (pH=5.7, filter-sterilized) Cellulase RS Onozuka (10g/l), Macerozyme (200mg/l), Pectolyase Y-23 (10mg/l), NAA (1mg/l), 2,4-D (1mg/l), Zeatin (1mg/l), D-Mannitol (91g/l), MES (0.5g/l), Na2 -EDTA (19.3mg/l), FeSO4x7H2O (14mg/l), MgSO4x7H2O (492mg/l), KNO3 (740mg/l), KH2PO4 (34mg/l), CaCl2x2H2O (487.4mg/l). Solution B (pH=5.6-5.8, autoclaved) CaCl2x2H2O (487.4mg/l), KH2PO4 (34mg/l), KNO3 (740mg/l), MgSO4x7H2O (492mg/l), Mannitol (45.5g/l), NaCl (7.3g/l).
54
Solution C (pH=5.8, autoclaved) MgCl2x2H2O (3.05g/l), MES (1g/l), Mannitol (91.1g/l). Solution D (pH=8.0-9.0, autoclaved) PEG 4000 (400g/l), D-Mannitol (72.9g/l), Ca(NO3)2x4H2O (23.6g/l). Solution E (autoclaved) Picloram (10mg/l), MS salts +Vit. (4.4g/l), Glucose (102.6g/l), Mannitol (4.56g/l), Xylitol (30.8g/l), Sorbitol (4.56g/l), Myo-inositol (976mg/l). Molecular analysis Cassava genomic DNA was extracted from freeze-dried leaves according to (Soni and Murray, 1994).Genomic integration was confirmed in cassava plantlets using Southern blot standard protocols (Sambrook et al., 1989) after digestion with HindIII. As probe a genomic region of the HptII gene (450bp) was amplified (pimers “Hpt II Fwd” and “Hpt II Rev”) and labeled with DIGdUTP (F. Hoffmann-La Roche Ltd, Basel, Switzerland) according to the manufacturer’s instructions. Total cassava RNA and protein were extracted from leaves and roots of in vitro plantlets using the TRIZOL extraction protocol (Invitrogen). 2µg total RNA per sample was further treated with Super Script II Reverse Transcriptase (Invitrogen) according to manufacturer’s instructions. Real-time PCR on cassava cDNA samples was carried out on a LightCycler 2.0 machine (F. Hoffmann-La Roche Ltd, Basel, Switzerland) using Serine/Threonine protein phosphatase PP2A catalytic subunit 2A (Acc.Nr. BM259718) as reference gene (primers “PP2A-RT Fwd” and “PP2A-RT Rev”) with ASP1 as gene of interest (primers “ASP1-RT Fwd” and “ASP1-RT Rev”). Results were processed for normalization using Microsoft Excel. Protein extracts were quantified according to (Bradford, 1976) and 10µg total protein were loaded per lane on a Tricine SDS gel (Schagger and von Jagow, 1987). Western blot was performed (Sambrook et al., 1989) and ASP1 bands were detected using a polyclonal antibody and ECL detection kits (Amersham Biosciences, Piscataway, USA). Amino Acid Analysis Storage roots were peeled at the root cortex, sliced and freeze-dried for 24h while leaves were lyophilized directly. All plant material was ground afterwards to a homogenous powder and stored at -80◦C until use. Samples containing 1mg total protein were weighed and hydrolyzed with 2ml of 6M HCl for 24h at 110◦C in an oil bath using Argon as inert gas. After hydrolysis samples were evaporated (Rotavapor, BÜCHI Labortechnik AG, Switzerland) at ≤ 50°C, resuspended in 5ml sample buffer (0.16M Li-acetate-buffer, pH 2.20; No. 5.403.047, Laborservice Onken GmbH, Gründau-Breitenborn, Germany) and filtered through a 0.45-µm PVDF membrane (Millipore AG, Switzerland). 50µl of the solution were injected into an automated Biochrom30 Analyser (Laborservice Onken) and separated afterwards by ion exchange chromatography (Lithium High Resolution Column, 4.0x125mm, No. 5.503.611, Laborservice Onken) based on a 5 buffer system. Following separation, amino acids were derivatized with ninhydrin and detected at 570nm and 440nm. Quantification was based on external standards (Cat-No. 20088ZZ, Pierce, Perbio Science Switzerland SA, Lausanne, Switzerland) consisting of a mixture of 5.0nmol of each amino acid in 50µl loading buffer. Each analysis was performed with two technical replicates and several biological replicates (as described in section “plant material“).
Acknowledgements We would like to thank Prof. Vitale for providing us with the zeolin donor plasmid, Prof. Brandizzi and Prof. Hwang for the BiP::RFP control vector. Hanna Schneider is acknowledged for assistance with amino acid analysis.
55
References Bednarek PT, Orlowska R, Koebner RM, Zimny J (2007) Quantification of the
tissue-culture induced variation in barley (Hordeum vulgare L.). BMC Plant Biology 7: 10
Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry 72: 248-254
Cock JH (1982) Cassava - a Basic Energy-Source in the Tropics. Science 218: 755-762
Czechowski T, Stitt M, Altmann T, Udvardi MK, Scheible WR (2005) Genome-wide identification and testing of superior reference genes for transcript normalization in Arabidopsis. Plant Physiology 139: 5-17
De Jaeger G, Scheffer S, Jacobs A, Zambre M, Zobell O, Goossens A, Depicker A, Angenon G (2002) Boosting heterologous protein production in transgenic dicotyledonous seeds using Phaseolus vulgaris regulatory sequences. Nature Biotechnology 20: 1265-1268
De Wilde C, Podevin N, Windels P, Depicker A (2001) Silencing of antibody genes in plants with single-copy transgene inserts as a result of gene dosage effects. Molecular Genetics and Genomics 265: 647-653
Denecke J, De Rycke R, Botterman J (1992) Plant and mammalian sorting signals for protein retention in the endoplasmic reticulum contain a conserved epitope. EMBO Journal 11: 2345-2355
Elmayan T, Vaucheret H (1996) Expression of single copies of a strongly expressed 35S transgene can be silenced post-transcriptionally. Plant Journal 9: 787-797
Emanuelsson O, Nielsen H, Brunak S, von Heijne G (2000) Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. Journal of Molecular Biology 300: 1005-1016
FAO (2004) Agricultural biotechnology Meeting the needs of the poor? Food and Agriculture Organization of the United Nations FAO, Rome
FAO (2005) FAOSTAT data. In, Vol 2006 Flavell RB (1994) Inactivation of gene expression in plants as a consequence of
specific sequence duplication. Proceedings of the National Academy of Sciences of the United States of America 91: 3490-3496
Kim J, Cetiner S, Jaynes JM (1992) Enhancing the nutritional quality of crop plants: design, contruction and expression of an artificial plant storage protein gene. In D Bhatnagar, TE Cleveland, eds, Molecular approaches to improving food quality and safety. Van Nostrand Reinhold, New York, pp 1-36
Larkin PJ, Scowcroft WR (1981) Somaclonal Variation - a Novel Source of Variability from Cell-Cultures for Plant Improvement. Theoretical and Applied Genetics 60: 197-214
Li X, Yu X, Wang N, Feng Q, Dong Z, Liu L, Shen J, Liu B Genetic and epigenetic instabilities induced by tissue culture in wild barley (Hordeum brevisubulatum (Trin.) Link). Plant Cell, Tissue and Organ Culture
Maeshima M, Sasaki T, Asahi T (1985) Characterization of Major Proteins in Sweet-Potato Tuberous Roots. Phytochemistry 24: 1899-1902
56
Mainieri D, Rossi M, Archinti M, Bellucci M, De Marchis F, Vavassori S, Pompa A, Arcioni S, Vitale A (2004) Zeolin. A new recombinant storage protein constructed using maize gamma-zein and bean phaseolin. Plant Physiology 136: 3447-3456
Matsuoka K, Nakamura K (1991) Propeptide of a precursor to a plant vacuolar protein required for vacuolar targeting. Proceedings of the National Academy of Sciences of the United States of America 88: 834-838
Meza TJ, Stangeland B, Mercy IS, Skarn M, Nymoen DA, Berg A, Butenko MA, Hakelien AM, Haslekas C, Meza-Zepeda LA, Aalen RB (2002) Analyses of single-copy Arabidopsis T-DNA-transformed lines show that the presence of vector backbone sequences, short inverted repeats and DNA methylation is not sufficient or necessary for the induction of transgene silencing. Nucleic Acids Research 30: 4556-4566
Munthali MT, Newbury HJ, FordLloyd BV (1996) The detection of somaclonal variants of beet using RAPD. Plant Cell Reports 15: 474-478
Muskens MW, Vissers AP, Mol JN, Kooter JM (2000) Role of inverted DNA repeats in transcriptional and post-transcriptional gene silencing. Plant Molecular Biology 43: 243-260
Nielsen H, Engelbrecht J, Brunak S, von Heijne G (1997) Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Engineering 10: 1-6
Polacco JC, Holland MA (1993) Roles of Urease in Plant-Cells. International Review of Cytology - a Survey of Cell Biology, Vol 145 145: 65-103
Polanco C, Ruiz ML (2002) AFLP analysis of somaclonal variation in Arabidopsis thaliana regenerated plants. Plant Science 162: 817-824
Raemakers K, Schreuder M, Anggraini V, Putten H, Pereira I, Visser R (2007) Cassava. In Transgenic Crops IV, p 317
Raemakers K, Schreuder M, Pereira I, Munyikwa T, Jacobsen E, Visser R (2001) Progress made in FEC transformation of cassava. Euphytica 120: 15
Sambrook J, Fritsch E, Maniatis T (1989) Molecular Cloning: a laboratory manual. CSH Laboratory Press, Cold Spring Harbor, NY
Schagger H, von Jagow G (1987) Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Analytical Biochemistry 166: 368-379
Schreuder MM, Pereira IJ, Raemakers CJJM, Jacobsen E, Visser RGF (2001) Effects of Somaclonal Variation in Cassava Plants Regenerated from Friable Embryogenic Callus of Increasing Age. In 5th International Scientific Meeting of the Cassava Biotechnology Network, Vol S7-26, Donald Danforth Plant Science Center, St. Louis, Missouri USA
Scrimshaw NS (2007) Fifty-five-year personal experience with human nutrition worldwide. Annual Review of Nutrition 27: 1-18
Soni R, Murray JA (1994) Isolation of intact DNA and RNA from plant tissues. Analytical Biochemistry 218: 474-476
Stupak M, Vanderschuren H, Gruissem W, Zhang P (2006) Biotechnological approaches to cassava protein improvement. Trends in Food Science & Technology 17: 634-641
Vanetten CH, Kwolek WF, Peters JE, Barclay AS (1967) Plant Seeds as Protein Sources for Food or Feed. Evaluation Based on Amino Acid Composition of 379 Species. Journal of Agricultural and Food Chemistry 15: 1077-&
57
Vaucheret H, Beclin C, Elmayan T, Feuerbach F, Godon C, Morel JB, Mourrain P, Palauqui JC, Vernhettes S (1998) Transgene-induced gene silencing in plants. Plant Journal 16: 651-659
Yang J, Barr LA, Fahnestock SR, Liu ZB (2005) High yield recombinant silk-like protein production in transgenic plants through protein targeting. Transgenic Research 14: 313-324
Zhang P, Bohl-Zenger S, Puonti-Kaerlas J, Potrykus I, Gruissem W (2003) Two cassava promoters related to vascular expression and storage root formation. Planta 218: 192-203
Zhang P, Gruissem W (2004) Production of transgenic cassava (Manihot esculenta Crantz). In Transgenic Crops of the World - Essential Protocols. Curtis, Ian S., pp 301-319
Zhang P, Jaynes JM, Potrykus I, Gruissem W, Puonti-Kaerlas J (2003) Transfer and expression of an artificial storage protein (ASP1) gene in cassava (Manihot esculenta Crantz). Transgenic Research 12: 243-250
Zimmermann P, Hennig L, Gruissem W (2005) Gene-expression analysis and network discovery using Genevestigator. Trends in Plant Science 10: 407-409
Zimmermann P, Hirsch-Hoffmann M, Hennig L, Gruissem W (2004) GENEVESTIGATOR. Arabidopsis microarray database and analysis toolbox. Plant Physiology 136: 2621-2632
58
Figures and tables
Figu
re 1
: S
ubce
llula
r lo
caliz
atio
n of
sto
rage
pro
tein
s in
cas
sava
pro
topl
asts
usi
ng a
pro
lam
ine
deriv
ed s
igna
l seq
uenc
e (s
cale
ba
r is
10µm
). (1
) Pro
lSS
:GFP
:AS
P1:
KD
EL
(RV
3) is
targ
eted
to E
R. (
2) P
rolS
S:G
FP:A
SP
1 (R
V3- ) i
s re
tain
ed in
the
ER
onl
y af
ter
Bre
feld
inA
tre
atm
ent.
(3)
Pro
lSS
:GFP
:Spo
ram
in:K
DE
L (R
V6)
is s
ucce
ssfu
lly r
etai
ned
in t
he E
R.
(4)
Pro
lSS
:GFP
:Zeo
lin:K
DE
L (R
V14
) lo
caliz
es t
o E
R a
nd t
he v
acuo
le.
(A)
brig
htfie
ld im
age,
(B)
GFP
:pro
tein
sig
nal,
(C)
BiP
:RFP
con
trol s
igna
l for
ER
, (D
) ov
erla
y of
(B) a
nd (C
), (E
) mag
nifie
d se
ctio
ns o
f sig
nal f
rom
(B)
Figure 1
59
Figure 2
R
V3/1
a
RV3
/1b
RV3
/6
R
V3/R
1
R
V3/R
4
RV3
/R5
R
V3/R
6
1-1
1
W
T
Figu
re 2
: Sou
ther
n bl
ot o
f sev
en c
assa
va li
nes
trans
form
ed w
ith c
onst
ruct
RV
3
60
Figure 3
Figu
re 3
: Rea
l-tim
e PC
R o
f sev
en tr
ange
nic
cass
ava
lines
exp
ress
ing
the
AS
P1
gene
. Tra
nscr
ipt a
bund
ance
w
as d
eter
min
ed in
leav
es a
nd ro
ots
of in
vitr
o pl
ants
.
61
Figure 4
Figu
re 4
: W
este
rn B
lot
of t
otal
roo
t pr
otei
n ex
tract
ions
of
seve
n tra
nsge
nic
cass
ava
lines
. Tw
o lin
es d
o no
t in
dica
te p
rote
in a
ccum
ulat
ion.
RV3
/1a
RV3
/1b
R
V3/6
R
V3/R
1 R
V3/R
4 R
V3/R
5 R
V3/R
6
W
T 1
-11
62
Figure 5
Figu
re 5
: P
heno
typi
c ch
arac
teriz
atio
n of
sev
en t
rans
geni
c ca
ssav
a lin
es.
AS
P1 e
xpre
ssio
n es
timat
ed f
rom
W
este
rn b
lot u
sing
Imag
eJ. E
ach
sym
bol i
n pl
ant h
eigh
t cor
resp
onds
to c
a.25
cm. S
tora
ge ro
ot fo
rmat
ion
refe
rs
to th
ose
plan
ts p
er li
ne th
at w
ere
able
to fo
rm c
lear
ly d
istin
guis
habl
e st
orag
e ro
ots.
63
Figure 6
Figu
re 6
: To
tal p
rote
in c
onte
nt in
cas
sava
sto
rage
roo
ts. P
lant
s w
ere
anal
yzed
afte
r 5
mon
ths
in s
oil a
nd a
fter
8 m
onth
s. W
here
mor
e th
an o
ne s
ampl
e w
as m
easu
red,
sta
ndar
d de
viat
ion
betw
een
biol
ogic
al r
eplic
ates
is g
iven
. Fo
r lin
es R
V3-
1A a
nd R
V3-
6 no
sto
rage
root
s w
ere
avai
labl
e af
ter 5
mon
th, a
s w
as fo
r lin
e R
V3-R
6 af
ter 8
mon
ths.
64
Figure 7
Figu
re 7
: Com
plet
e am
ino
acid
ana
lysi
s of
two
trans
geni
c ca
ssav
a st
orag
e ro
ots
both
exp
ress
ing
the
AS
P1
gene
. Err
or b
ars
depi
ct b
iolo
gica
l sta
ndar
d de
viat
ion
afte
r Gau
ssia
n er
ror p
ropa
gatio
n. T
rp w
as n
ot d
eter
min
ed.
Cha
nges
in C
ys-C
ys c
once
ntra
tion
wer
e no
t sig
nific
ant a
nd o
mitt
ed h
ere.
65
VIII. Import of a storage protein into plastidal stroma is inhibited in cassava
Target Journal: Mol Biol Rep (as short comm.) Authors: Stupak M, Faso C, Gruissem W, Zhang P
Abstract Low protein levels in cassava storage roots have been a primary target of nutritional
improvement in cassava breeding programs. One of the approaches to solve this
problem is to express heterologous storage proteins targeted to suitable subcellular
locations to achieve high levels of protein accumulation. In this report we investigated
the ability of cassava plastids to accumulate ASP1, a recombinant storage protein
designed specifically for nutritional enhancement purposes. To do this, we performed
both transient and stable expression assays in cassava. Surprisingly, ASP1 could
never be successfully imported into plastids and the transit peptide remained
uncleaved. We therefore conclude that plastids are not a suitable place to
accumulate ASP1 in cassava.
Introduction Cassava is one of the five most important food and feed crops in the world and is
mainly grown in tropical developing countries because of its starchy storage roots
(FAO, 2005). However, the presence of cyanogenic glucosides coupled with the
absence of sufficient levels of high quality protein frequently leads to the occurrence
of Protein-Energy-Malnutrition (PEM) in areas where consumers rely mostly or
exclusively on this food source (Cock, 1982; FAO, 2004). We have addressed this
problem in our laboratory by transgenesis, meaning the transfer and expression of
heterologous storage proteins in cassava storage roots (reviewed in Stupak et al.,
2006). Proof of concept for this kind of approach was provided previously with the
stable expression of an untargeted storage protein in cassava (Zhang et al., 2003),
yet significant improvements on a nutritional level could not be observed (Chapter
six).
One of the ways in which recombinant protein production in plants can be increased
is to exploit the existing subcellular targeting mechanisms to promote organelle-
66
specific protein deposition. Plastids have been successfully used for the
accumulation of heterologous proteins in plants. For our purposes, we considered
plastidial targeting as a promising strategy for ASP1 accumulation due to the high
abundance of amyloplasts in cassava storage roots. The well-characterized transit
peptide psrbcS from the P. sativum RuBisCo small subunit (Van den Broeck et al.,
1985) was used to direct our nuclear-encoded protein to plastids. Plastidial targeting
of ASP1 was first evaluated using several subcellular prediction softwares.
Experimental proof was then obtained with both transient (protoplasts) and stable
(plants) expression assays. The establishment of transgenic plants stably expressing
our transgene allowed us to conclude that the plastid-targeted ASP1 protein cannot
be correctly imported into cassava plastids and that this is not dependent on the
origin of the analysed tissue.
Material and Methods Vector construction Transformation vectors were designed using pCAMBIA1301 (Cambia, Australia) as a backbone (for vector maps see chapter XI). A synthetic oligo (“KDEL oligo”) containing a KDEL sequence followed by a Stop-codon, was digested with PstI and BstEII and cloned into our pCAMBIA backbone. ASP1 gene was amplified from pCASP1 (Zhang et al., 2003) using primers “ASP1 Fwd” and “ASP1 Rev” and cloned into our KDEL-backbone using SmaI/SalI. The endogenous cassava promoter p54 was amplified with PCR from pCP54GUS (Zhang et al., 2003) using primers “p54 Fwd” and “p54 Rev” and cloned into the cassette using EcoRI/NcoI. The well characterized transit peptide psrbcS from P. sativum RuBisCo small subunit (Acc.Nr.: X04333) was amplified using PCR with pCL60-srbcS (Bauer et al., 2000) as template vector (primers “psTP Fwd” and “psTP Rev”). The PCR product was cloned into the vector above using NcoI/SmaI. The resulting transformation vector was called RV9. Primers Name sequence (5’-3’) KDEL oligo GCCTGCAGGAAGGACGAGCTCTAGAGGTCACCGCG ASP1 Fwd CAGCGCCTCTCCATGGCCCGGGATGCTTGAAG ASP1 Rev CTATGTCGACATTCCCGATCGTTCAAAC p54 Fwd TAGAATTCGGATCCACGGGTGTGGGCCAACTC p54 Rev CTATTTCATTTTCTCTTGCTTTCGCCACCATGGAG psTP Fwd TCCTCTAGAGTCGACCATGG psTP Rev CAGGTGTGGCCCGGGAAA Transient protoplast assay Cell content of one jar cassava callus tissue (1-2g) was treated with 50ml of enzyme solution A under sterile conditions and incubated at 26°C in the dark for 16h (shaking at ~80rpm). Digested solution was filtered (50µm) and filter was washed with 10ml wash solution B. Protoplasts in flow-through were pelleted (15ml Falcon tubes, 70g, 10min) and washed twice with solution B. Protoplasts were counted (Jessen chamber) and resuspended in salt solution C depending on yield (1 to 3x106 protoplasts /ml). To 1ml of protoplast solution 20µg of plasmid DNA were added and gently mixed. Then 1ml of PEG solution D was added slowly and samples were incubated while gently shaking (RT,
67
5min).Then 6ml of nutrient solution E were added and samples were incubated for recovery (RT, dark, ~80rpm, 40-48h). Protoplasts were concentrated, warmed to 30°C and mixed with an equal part of low-melting-point agarose (2%, 45°C). Final solution was spread on microscopic slides (warmed to 33°C) and cooled to RT. Samples were observed using Confocal Laser Scanning Microscopy (Leica SP1-2) and images were processed using Imaris software (Bitplane AG, Zurich, Switzerland). Each vector was used in at least three independent tranformations and within each batch of transformation several protoplasts were checked for homogenicity and reproducibility of GFP pattern. Solution A (pH=5.7, filter-sterilized) Cellulase RS Onozuka (10g/l), Macerozyme (200mg/l), Pectolyase Y-23 (10mg/l), NAA (1mg/l), 2,4-D (1mg/l), Zeatin (1mg/l), D-Mannitol (91g/l), MES (0.5g/l), Na2 -EDTA (19.3mg/l), FeSO4x7H2O (14mg/l), MgSO4x7H2O (492mg/l), KNO3 (740mg/l), KH2PO4 (34mg/l), CaCl2x2H2O (487.4mg/l). Solution B (pH=5.6-5.8, autoclaved) CaCl2x2H2O (487.4mg/l), KH2PO4 (34mg/l), KNO3 (740mg/l), MgSO4x7H2O (492mg/l), Mannitol (45.5g/l), NaCl (7.3g/l). Solution C (pH=5.8, autoclaved) MgCl2x2H2O (3.05g/l), MES (1g/l), Mannitol (91.1g/l). Solution D (pH=8.0-9.0, autoclaved) PEG 4000 (400g/l), D-Mannitol (72.9g/l), Ca(NO3)2x4H2O (23.6g/l). Solution E (autoclaved) Picloram (10mg/l), MS salts +Vit. (4.4g/l), Glucose (102.6g/l), Mannitol (4.56g/l), Xylitol (30.8g/l), Sorbitol (4.56g/l), Myo-inositol (976mg/l). Plant Material Transformation of cassava (cultivar TMS60444) was conducted using Agrobacterium-mediated gene transfer into friable embryogenic callus (FEC) tissue essentially as described by (Zhang and Gruissem, 2004). Hygromycin-resistant transformants were regenerated in vitro. Three-week old plantlets were transplanted to pots and transferred to the greenhouse. Leaves, roots and storage roots were harvested after 5 months. Previously established transgenic plants expressing cytosolic ASP1 (Zhang et al., 2003) together with wild-type plants (TMS60444) were grown under controlled conditions in a green-house for 3-34 months and harvested at several time points. Molecular analysis Total cassava protein was extracted from leaves and roots of in vitro plantlets using the TRIZOL extraction protocol (Invitrogen). Protein extracts were quantified according to (Bradford, 1976) and 10µg total protein per lane were loaded on a Tricine SDS gel (Schagger and von Jagow, 1987). Western blotting was performed (Sambrook et al., 1989) and ASP1 bands were detected using a polyclonal antibody and ECL detection kits (Amersham Biosciences, Piscataway, USA).
Results
In silico targeting analysis The vector of interest (RV9) was designed using the N-terminal signal sequence of
RuBisCo small subunit in order to localize ASP1 into the plastids. A C-terminal KDEL
sequence was present in the vector which was not predicted to influence plastidal
targeting. Several targeting prediction tools were used in order to confirm in theory
68
the functionality of our construct. All tools used predicted functional targeting to
chloroplasts or plastids (Nielsen et al., 1997; Emanuelsson et al., 2000; Nair and
Rost, 2005; Xie et al., 2005; Hoglund et al., 2006; Pierleoni et al., 2006). LOCtree
was the only software that also predicted the functionality of the KDEL tetrapeptide
as a RER retention signal (Figure 1, A).
TargetP predicted a peptidase cleavage site 56AA downstream of translation
initiation corresponding to the well-characterized cleavage site for the RuBisCo small
subunit. Consequently, a 7AA long linker- peptide (introduced during the cloning
procedure) was predicted to remain attached to the N-terminus of the resulting
protein (Figure 1, B).
Transient expression analysis In order to observe the targeting pattern of plastid-directed ASP1, the gene coding for
eGFP was cloned between the psrbcS transit peptide and our gene of interest. By
using a cassava protoplast transient transformation procedure previously established
in our laboratory (unpublished), a green fluorescence signal could be detected in the
cytosol and in the periphery of the plastid and may be localized primarily in the outer
membrane of the organelle or the intermembrane space. Fluorescence surrounding
plastids was not equally distributed but rather showed distinct spots of high intensity
(Figure 2, A and D).
To understand whether the KDEL signal was involved in this unexpected deposition
pattern, two control vectors were designed and tested. In one of them we removed
the KDEL tetrapeptide and replaced it with an SKL tripeptide (RV9m) which was
reported to have no direct effect on plastidal import while redirecting a fraction of
synthetised pre-proteins to peroxisomes, leading to dual targeting condition
(Hyunjong et al., 2006). Following transient expression of this construct, we observed
a fluorescence pattern similar to the one using the plastid-directed ASP1-KDEL
construct, with fluorescence surrounding spherical organelles and additional
fluorescence from small, unidentified cellular components that we hypothesize could
be peroxisomes (Figure 2, B). Therefore, we conclude that the KDEL peptide is
probably not involved in the observed inhibition of plastid-targeted ASP1 import.
The second control vector had the complete ASP1 coding sequence replaced with
the sporamin coding sequence (RV8), another storage protein which exists in nature
(sweet potato). The plastid targeting signal and the KDEL tetrapeptide remained
69
unchanged. Following transient expression of this new construct, we observed a
homogenous spot-like fluorescence in spherical organelles, suggesting successful
import of modified sporamin in plastids (Figure 2, C).
To investigate whether the observed plastid import inhibition of ASP1 was dependent
on the tissue we were using, we transiently transformed A. thaliana protoplasts with a
modified RV9 construct, in which the p54 endogenous cassava promoter was
substituted with the constitutive CaMV35S promoter. In parallel, we also transformed
A. thaliana protoplasts with a vector encoding plastid-targeted psrbcS-eGFP under
the control of the same promoter (pCL60) (Figure 3). We observed that the control
vector expressed eGFP was clearly imported within chloroplasts. In contrast to this,
the plastid-targeted eGFP-ASP1 fusion did not accumulate and remained confined to
the cytosol.
Taken together, these results suggest that inhibition of complete plastid import for
psrbcS-ASP1 is neither dependent on plant species nor on plastid functionality.
Stable expression analysis To investigate the deposition pattern of plastid-targeted ASP1 in plants, the eGFP
coding sequence was excised from the RV9 vector. The resulting construct was used
for stable transformation and subsequent regeneration of transgenic cassava plants.
Five independent transgenic cassava lines carrying the psrbcS-ASP1-KDEL
expression cassette were regenerated. We could verify stable integration of the
cassette and constitutive gene transcription in both leaves and roots using standard
molecular tools (data not shown).
Protein levels of transgenic cassava roots were visualized and compared on a
Western blot (Figure 4). ASP1 bands were clearly detectable in all four transgenic
lines. Surprisingly, the migration profile of ASP1 protein bands correlated to a protein
size of 14kDa. This figure is 1-2 kDa higher than the weight of the fully processed
ASP1 molecule. The same result could be reproduced using leaf protein extracts
(data not shown).
These protein analysis results indicate that the plastid transit peptide has not been
cleaved off from the ASP1 protein. This, together with our transient expression
observations supports our hypothesis that ASP1 cannot be properly imported into
cassava plastids.
70
Discussion Improving protein content in cassava storage roots and the choice of the most
suitable storage protein to adopt remain major challenges in the cassava research
community. ASP1 has been considered a promising candidate in terms of nutritional
value and is compatible with subcellular targeted expression. Based on previous
observations in A. thaliana the psrbcS signal sequence was chosen in order to
achieve plastid targeting and to maintain an active cleavage site for the stromal
processing peptidase (Van den Broeck et al., 1985; Bedard and Jarvis, 2005). The
signal itself was functional when substituting ASP1 with sporamin and directs the
respective target proteins into the plastidal stroma. The C-terminal KDEL tetrapeptide
did not seem to interfere with that process either. Consequently, here we could show
for the first time that a protein coupled to psrbcS could not be imported into plastidal
stroma but rather accumulates at the outer envelope membrane or the inter-
membrane space in non-photosynthetic cells. It has been shown that the TP of RbcS
in actively photosynthetising cells specifically interacts with Toc34 or Toc159
depending on phosphorylation of the TP (Sveshnikova et al., 2000; Becker et al.,
2004) and that both interactions are involved in the import of both photosynthetic and
non-photosynthetic preproteins (reviewed in Bedard and Jarvis, 2005). Therefore,
one explanation for our observations in cassava callus tissue could be that plastid
import is inhibited in this specific tissue. Nevertheless, our in planta results obtained
from protein analysis in both leaves and roots which show the incorrect processing of
targeted ASP1 indicates that complete plastid import is also affected in green tissue.
It has been shown that nuclear-encoded plastidial precursor proteins compete for
the same import machinery (Row and Gray, 2001) but this fact alone cannot explain
the complete absence of imported ASP1 since we would expect at least partial
stromal import. Thus we speculate that inhibited plastid import could be correlated to
our protein’s structural properties. ASP1 was designed to form a very stable tertiary
structure in the absence of disulfide bridges comprised of four helical repeating units,
each 20 amino acids long (Bhatnagar, 1992). The stability of these interactions may
lead to a partial folding of the protein after cytosolic translation, negatively affecting
the required unfolding procedure which occurs prior to plastidial import. The size of
ASP1 does not allow for import of a partially folded protein (Clark and Theg, 1997).
71
Currently we cannot rule out completely that linker and/or transit peptide contribute to
this effect.
Further experiments such as the expression of truncated ASP1 versions or the
testing of other plastid targeting signals would be helpful to understand if indeed
import inhibition is due to ASP1’s peculiar structure or whether it is the signal we
have chosen to test that is not suitable for plastid targeting of ASP1. Nevertheless, it
currently seems that the ASP1 protein cannot be imported into plastids by using the
psrbcS signal peptide.
References Bauer J, Chen K, Hiltbunner A, Wehrli E, Eugster M, Schnell D, Kessler F (2000)
The major protein import receptor of plastids is essential for chloroplast biogenesis. Nature 403: 203-207
Becker T, Jelic M, Vojta A, Radunz A, Soll J, Schleiff E (2004) Preprotein recognition by the Toc complex. EMBO Journal 23: 520-530
Bedard J, Jarvis P (2005) Recognition and envelope translocation of chloroplast preproteins. Journal of Experimental Botany 56: 2287-2320
Bhatnagar D (1992) Molecular approaches to improving food quality and safety. Van Nostrand Reinhold, New York
Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry 72: 248-254
Clark SA, Theg SM (1997) A folded protein can be transported across the chloroplast envelope and thylakoid membranes. Molecular Biology of the Cell 8: 923-934
Cock JH (1982) Cassava - a Basic Energy-Source in the Tropics. Science 218: 755-762
Emanuelsson O, Nielsen H, Brunak S, von Heijne G (2000) Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. Journal of Molecular Biology 300: 1005-1016
FAO (2004) Agricultural biotechnology Meeting the needs of the poor? Food and Agriculture Organization of the United Nations FAO, Rome
FAO (2005) FAOSTAT data. In, Vol 2006 Hoglund A, Donnes P, Blum T, Adolph HW, Kohlbacher O (2006) MultiLoc:
prediction of protein subcellular localization using N-terminal targeting sequences, sequence motifs and amino acid composition. Bioinformatics 22: 1158-1165
Hyunjong B, Lee DS, Hwang I (2006) Dual targeting of xylanase to chloroplasts and peroxisomes as a means to increase protein accumulation in plant cells. Journal of Experimental Botany 57: 161-169
Nair R, Rost B (2005) Mimicking cellular sorting improves prediction of subcellular localization. Journal of Molecular Biology 348: 85-100
72
Nielsen H, Engelbrecht J, Brunak S, von Heijne G (1997) Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Engineering 10: 1-6
Pierleoni A, Martelli PL, Fariselli P, Casadio R (2006) BaCelLo: a balanced subcellular localization predictor. Bioinformatics 22: e408-416
Row PE, Gray JC (2001) Chloroplast precursor proteins compete to form early import intermediates in isolated pea chloroplasts. Journal of Experimental Botany 52: 47-56
Sambrook J, Fritsch E, Maniatis T (1989) Molecular Cloning: a laboratory manual. CSH Laboratory Press, Cold Spring Harbor, NY
Schagger H, von Jagow G (1987) Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Analytical Biochemistry 166: 368-379
Stupak M, Vanderschuren H, Gruissem W, Zhang P (2006) Biotechnological approaches to cassava protein improvement. Trends in Food Science & Technology 17: 634-641
Sveshnikova N, Grimm R, Soll J, Schleiff E (2000) Topology studies of the chloroplast protein import channel Toc75. Biological Chemistry 381: 687-693
Van den Broeck G, Timko MP, Kausch AP, Cashmore AR, Van Montagu M, Herrera-Estrella L (1985) Targeting of a foreign protein to chloroplasts by fusion to the transit peptide from the small subunit of ribulose 1,5-bisphosphate carboxylase. Nature 313: 358-363
Xie D, Li A, Wang M, Fan Z, Feng H (2005) LOCSVMPSI: a web server for subcellular localization of eukaryotic proteins using SVM and profile of PSI-BLAST. Nucleic Acids Research 33: W105-110
Zhang P, Bohl-Zenger S, Puonti-Kaerlas J, Potrykus I, Gruissem W (2003) Two cassava promoters related to vascular expression and storage root formation. Planta 218: 192-203
Zhang P, Gruissem W (2004) Production of transgenic cassava (Manihot esculenta Crantz). In Transgenic Crops of the World - Essential Protocols. Curtis, Ian S., pp 301-319
Zhang P, Jaynes JM, Potrykus I, Gruissem W, Puonti-Kaerlas J (2003) Transfer and expression of an artificial storage protein (ASP1) gene in cassava (Manihot esculenta Crantz). Transgenic Research 12: 243-250
73
Figures and tables Figure 1
Figu
re 1
: (A
) P
redi
cted
sub
cellu
lar
loca
lizat
ion
patte
rn o
f ps
Rbc
S:A
SP
1:K
DE
L us
ing
seve
ral
pred
ictio
n to
ols.
Pre
dict
ed p
eptid
ase
clea
vage
site
dow
nstre
am o
f tra
nsla
tion
initi
atio
n is
sho
wn.
Opt
ion
in s
ome
tool
s no
t ava
ilabl
e (N
.A.);
Tra
nsit
pept
ide
sequ
ence
and
pro
tein
lin
ker u
sed
for e
xper
imen
ts (B
).
74
Figure 2
Figu
re 2
: Tr
ansf
orm
ed c
allu
s pr
otop
last
s of
M. e
scul
enta
. (A
) Lo
caliz
atio
n pa
ttern
of p
sRbc
S:G
FP:A
SP
1:K
DE
L (R
V9)
sur
roun
ding
pla
stid
s in
cas
sava
pr
otop
last
s. F
luor
esce
nce
hots
pots
can
be
seen
with
in c
ircul
ar s
igna
ls (
red
arro
w).
(B)
Loca
lizat
ion
patte
rn o
f ps
Rbc
S:G
FP:A
SP
1:S
KL
(RV9
m)
as
circ
ular
sig
nals
(red
arr
ow) a
nd p
oint
s of
fluo
resc
ence
, bei
ng p
roba
bly
pero
xiso
mes
. (C
) Loc
alis
atio
n pa
ttern
of p
sRbc
S:G
FP:S
pora
min
:KD
EL
(RV
10) a
s ev
enly
dis
tribu
ted
sign
al w
ithin
sph
eric
al p
last
ids.
(D
) 3D
rec
onst
ruct
ion
of a
pro
topl
ast e
xpre
ssin
g ps
Rbc
S:G
FP:A
SP
1:K
DE
L (R
V9)
, as
seen
bef
ore
in
(A).
Fluo
resc
ence
hot
spot
s ca
n be
see
n w
ithin
nea
rly e
very
circ
ular
sig
nal (
red
arro
ws)
.
75
Figure 3
Figu
re 3
: Tr
ansf
orm
ed l
eaf
prot
opla
sts
of A
. th
alia
na.
(AS
P1)
Loca
lizat
ion
patte
rn o
f ps
Rbc
S:G
FP:A
SP
1:K
DE
L (R
V9)
with
in c
ytos
ol.
No
impo
rt or
ac
cum
ulat
ion
at t
he p
erip
hery
of
plas
tids
coul
d be
see
n. (
C1-
C6)
Loc
aliz
atio
n pa
ttern
of
cont
rol c
onst
ruct
psR
bcS
:GFP
(pC
L60)
with
in c
ytos
ol a
nd in
pl
astid
s. I
n pa
rticu
lar
som
e flu
ores
cenc
e sp
ots
wer
e m
ore
inte
nsiv
e an
d di
d no
t co
loca
lize
com
plet
ely
with
chl
orop
hyll
auto
fluor
esce
nce
indi
catin
g st
rom
al G
FP d
epos
ition
. (A)
Brig
htfie
ld, (
B) G
FP::p
rote
in s
igna
l, (C
) chl
orop
hyll
auto
fluor
esce
nce,
(D) o
verla
y of
(B) a
nd (C
).
76
Figure 4
Fi
gure
4: W
este
rn b
lot a
gain
st A
SP
1 pr
otei
n in
tota
l cas
sava
root
pro
tein
ext
ract
s. (9
-1, 9
-2, 9
-5,
9-7
) Fou
r tra
nsge
nic
lines
exp
ress
ing
Rbc
S:A
SP
1:K
DE
L.(C
) Con
trol l
ine
expr
essi
ng
AS
P1:
KD
EL
with
out t
rans
it pe
ptid
e. (W
T) w
ildty
pe c
ontro
l lin
e
77
IX. Evaluation of vacuoles as a suitable protein storage place in cassava
Target Journal: Journal of Plant Research (as short communication) Authors: Stupak M, Faso C, Gruissem W, Zhang P
Introduction Cassava plays an important role in global food supply especially in developing
countries (Cock, 1982). Besides its leaves consumers mainly appreciate the starchy
storage roots which are rich in carbohydrates but relatively low in protein
(Balagopalan et al., 1988). This leads to a serious concern for an adequate protein
supply for those communities of consumers who heavily rely on cassava for nutrition.
Consequently, those consumers are at risk of developing Protein-Energy-Malnutrition
(PEM). Recently, strategies on how to tackle this problem have been discussed and
reviewed (Stupak et al., 2006). In our laboratory, we focus on expression of
heterologous storage proteins in cassava storage roots for the prevention of PEM.
Several protein candidates have been tested for their potential to increase selective
content of essential amino acids, in addition to gaining an overall increase in protein
content, by specific subcellular targeting to the rough endoplasmic reticulum (Chapter
seven). In this report, ASP1 and sporamin have both been targeted to the vacuole in
cassava cells. To our knowledge, this is the first report concerning the exploitation of
the cassava vacuole as a site for recombinant protein accumulation. In fact there is
yet no data available on protein stability in this organelle in cassava storage roots.
In recent years at least two distinct types of vacuoles were found to exist (Paris et al.,
1996; Jauh et al., 1999) and their relative abundance seems to be dependent on
many different factors including species, type and age of the tissue (Park et al., 2004;
Martinoia et al., 2007). One type is more specialized in protein storage (PSVs) while
the other type is scarcely involved in protein accumulation and is defined as a lytic
vacuole. However, even combinations of both types of organelle have been reported
(Jiang et al., 2001) making functional predictions in non-model plants like cassava
problematic. Consequently, the rationale behind our vacuolar targeting strategy was
to imitate conditions in crops which are known to develop storage organs similar to
cassava storage roots. Sweet potato (Ipomoea batatus, Convolvulaceae) is one of
78
these crop candidates and naturally accumulates sporamin, a protein reported to
account for over 80 % of the total protein content in sweet potato (Maeshima et al.,
1985). Sporamin naturally accumulates in lytic vacuoles and its signal sequence can
be reliably used to target other heterologous proteins towards this organelle
(Matsuoka and Nakamura, 1991; Koide et al., 1997). In this paper we initiate a first
evaluation of vacuoles as suitable protein storage compartments in cassava using
the sporamin-derived targeting signal.
Material and Methods Vector construction Transformation vectors were designed using pCAMBIA1301 (Cambia, Australia) as a backbone (for vector maps see chapter XI). A synthetic oligo (“KDEL oligo”) containing a KDEL sequence followed by a Stop-codon, was digested with PstI and BstEII and cloned into our pCAMBIA backbone. ASP1 gene was amplified from pCASP1 (Zhang et al., 2003) using primers “ASP1 Fwd” and “ASP1 Rev” and cloned into our KDEL-backbone using SmaI/SalI. The 5’ signal sequence of the sporamin gene (Acc.Nr.: DQ195772) was amplified using PCR (primers “SporSS Fwd” and “SporSS Rev”) on the plasmid PspoAF-1 (Matsuoka and Nakamura, 1991). The PCR product was digested with BspHI/SmaI and cloned into the previous vector digested with NcoI/SmaI (RV4). The sporamin gene itself was amplified on the same donor plasmid (primers “Spor Fwd” and “Spor Rev”) and inserted into the vector backbone using SmaI/PstI thus replacing ASP1 (RV8). The endogenous cassava promoter p54 was amplified with PCR from pCP54GUS (Zhang et al., 2003) using primers “p54 Fwd” and “p54 Rev” and cloned into the cassette using EcoRI/NcoI of both RV4 and RV8. Primers Name sequence (5’-3’) KDEL oligo GCCTGCAGGAAGGACGAGCTCTAGAGGTCACCGCG ASP1 Fwd CAGCGCCTCTCCATGGCCCGGGATGCTTGAAG ASP1 Rev CTATGTCGACATTCCCGATCGTTCAAAC p54 Fwd TAGAATTCGGATCCACGGGTGTGGGCCAACTC p54 Rev CTATTTCATTTTCTCTTGCTTTCGCCACCATGGAG Spor Fwd AACCCGGGTCCTCTGAAACTCCAGTAC Spor Rev GTCATCAAACCTACCGATGTCTGCAGTG SporSS Fwd CATCATGAAAGCCCTCACACTGG SporSS Rev CCCCACCACACACGAACCCGGGTC PP2A-RT Fwd TGTGGAAATATGGCATCAATTTTGG PP2A-RT Rev GCAACAGAAAGCCGTGTCAC ASP1-RT Fwd CCCGGGATGCTTGAAGAGC ASP1-RT Rev CTAGAGCTCGTCCTTCCTGC Plant Material Transformation of cassava (cultivar TMS60444) was conducted using Agrobacterium-mediated gene transfer into friable embryogenic callus (FEC) tissue essentially as described by (Zhang and Gruissem, 2004). Hygromycin-resistant transformants were regenerated in vitro. Three-week old plantlets were transplanted to pots and transferred to the greenhouse. Storage roots of line RV4+/8 (n=2) and WT (n=4) were harvested after 5 months.
79
Transient protoplast assay Cell content of one jar cassava callus tissue (1-2g) was treated with 50ml of enzyme solution A under sterile conditions and incubated at 26°C in the dark for 16h (shaking at ~80rpm). Digested solution was filtered (50µm) and filter was washed with 10ml wash solution B. Protoplasts in flow-through were pelleted (15ml Falcon tubes, 70g, 10min) and washed twice with solution B. Protoplasts were counted (Jessen chamber) and resuspended in salt solution C depending on yield (1 to 3x106 protoplasts /ml). To 1ml of protoplast solution 20µg of plasmid DNA were added and gently mixed. Then 1ml of PEG solution D was added slowly and samples were incubated while gently shaking (RT, 5min).Then 6ml of nutrient solution E were added and samples were incubated for recovery (RT, dark, ~80rpm, 40-48h). Protoplasts were concentrated, warmed to 30°C and mixed with an equal part of low-melting-point agarose (2%, 45°C). Final solution was spread on microscopic slides (warmed to 33°C) and cooled to RT. Samples were observed using Confocal Laser Scanning Microscopy (Leica SP1-2) and images were processed using Imaris software (Bitplane AG, Zurich, Switzerland). Each vector was used in at least three independent tranformations and within each batch of transformation several protoplasts were checked for homogenicity and reproducibility of GFP pattern. Solution A (pH=5.7, filter-sterilized) Cellulase RS Onozuka (10g/l), Macerozyme (200mg/l), Pectolyase Y-23 (10mg/l), NAA (1mg/l), 2,4-D (1mg/l), Zeatin (1mg/l), D-Mannitol (91g/l), MES (0.5g/l), Na2 -EDTA (19.3mg/l), FeSO4x7H2O (14mg/l), MgSO4x7H2O (492mg/l), KNO3 (740mg/l), KH2PO4 (34mg/l), CaCl2x2H2O (487.4mg/l). Solution B (pH=5.6-5.8, autoclaved) CaCl2x2H2O (487.4mg/l), KH2PO4 (34mg/l), KNO3 (740mg/l), MgSO4x7H2O (492mg/l), Mannitol (45.5g/l), NaCl (7.3g/l). Solution C (pH=5.8, autoclaved) MgCl2x2H2O (3.05g/l), MES (1g/l), Mannitol (91.1g/l). Solution D (pH=8.0-9.0, autoclaved) PEG 4000 (400g/l), D-Mannitol (72.9g/l), Ca(NO3)2x4H2O (23.6g/l). Solution E (autoclaved) Picloram (10mg/l), MS salts +Vit. (4.4g/l), Glucose (102.6g/l), Mannitol (4.56g/l), Xylitol (30.8g/l), Sorbitol (4.56g/l), Myo-inositol (976mg/l). Molecular analysis Total cassava RNA and protein were extracted from leaves and roots of in vitro plantlets using the TRIZOL extraction protocol (Invitrogen). 2µg total RNA per sample was further treated with Super Script II Reverse Transcriptase (Invitrogen) according to manufacturer’s instructions. Real-time PCR on Cassava cDNA samples was carried out on a LightCycler 2.0 machine (F. Hoffmann-La Roche Ltd, Basel, Switzerland) using Serine/Threonine protein phosphatase PP2A catalytic subunit 2A (Acc.Nr. BM259718) as reference gene (primers “PP2A-RT Fwd” and “PP2A-RT Rev”) with ASP1 as gene of interest (primers “ASP1-RT Fwd” and “ASP1-RT Rev”). Results were processed for normalization using Microsoft Excel. Protein extracts were quantified according to (Bradford, 1976) and 10µg total protein were loaded per lane on a Tricine SDS gel (Schagger and von Jagow, 1987). Western blot was performed (Sambrook et al., 1989) and ASP1 bands were detected using a polyclonal antibody and ECL detection kits (Amersham Biosciences, Piscataway, USA). Amino-Acid Analysis Storage roots were peeled at the root cortex, sliced and freeze-dried for 24h while leaves were lyophilized directly. All plant material was ground afterwards to a homogenous powder and stored at -80◦C until use. Samples containing 1mg total protein were weighed and hydrolyzed with 2ml of 6M HCl for 24h at 110◦C in an oil bath using Argon as inert gas. After hydrolysis samples were evaporated (Rotavapor, BÜCHI Labortechnik AG, Switzerland) at ≤ 50°C, resuspended in 5ml sample buffer (0.16M Li-acetate-buffer, pH 2.20; No. 5.403.047, Laborservice Onken GmbH, Gründau-Breitenborn, Germany) and filtered through a 0.45-µm PVDF membrane
80
(Millipore AG, Switzerland). 50µl of the solution were injected into an automated Biochrom30 Analyser (Laborservice Onken) and separated afterwards by ion exchange chromatography (Lithium High Resolution Column, 4.0x125mm, No. 5.503.611, Laborservice Onken) based on a 5 buffer system. Following separation, amino acids were derivatized with ninhydrin and detected at 570nm and 440nm. Quantification was based on external standards (Cat-No. 20088ZZ, Pierce, Perbio Science Switzerland SA, Lausanne, Switzerland) consisting of a mixture of 5.0nmol of each amino acid in 50µl loading buffer. Each analysis was performed with two technical replicates and several biological replicates (as described in section “plant material“).
Results
Vacuoles can accumulate storage proteins In our experiments, ASP1 was coupled to two subcellular localization signals.
We added an N-terminal sporamin signal sequence and an RER retention signal was
engineered at the C-terminus of ASP1. We wanted to investigate if protein
accumulation in cassava cells could be distributed between two organelles of the
secretory pathway. Our results from transient expression assays in cassava
protoplasts clearly show that eGFP derived signals accumulate both in vacuoles and
in the RER simultaneously (Figure1, A). Organelle identification was achieved by co-
expression of an ER-resident chaperone (BIP) coupled to RFP (Figure1, column 3).
In order to elucidate whether an ER retention signal is mandatory for dual targeting
we cloned a TAG stop codon immediately upstream of the KDEL tetrapeptide. The
resulting vector (RV4-) triggered GFP protein accumulation in vacuoles only (Figure1,
B). Co-localisation with BIP resulted in no overlapping signals thus indicating a
complete endoplasmic flow-through of our protein.
In order to check whether dual targeting to vacuoles and ER was a protein-
dependent observation, we decided to test these conditions by using another storage
protein. Therefore ASP1 was exchanged in our transformation vector with the sweet-
potato derived storage protein sporamin. The resulting construct (RV8) successfully
triggered green fluorescence both in vacuoles and endoplasmic reticulum, in a
manner comparable to ASP1 (Figure1, C). Co-localisation with BIP identified the part
of the signal derived from the RER.
Our transient expression data suggest that dual targeting in cassava to vacuoles and
ER leads to successful protein accumulation in both organelles and is most likely not
protein-specific.
81
Stable transformation Mature vacuoles derived from a proliferated plant tissue can have altered physico-
chemical properties when comparing them to those derived from undifferentiated
callus cells. This required us to investigate whether expression in cassava storage
roots would not interfere with the accumulation of these proteins within cassava
vacuoles. We therefore used our constructs for stable cassava transformation and
regeneration. The construct carrying the ASP1-KDEL gene (RV4+) was successfully
transferred into cassava and three lines could be regenerated. Molecular
characterisation of these lines (Figure2) showed that one line (RV4+/8) had the ASP1
gene expressed constitutively both in leaves and roots, one line in leaves only
(RV4+/9) and one line neither in leaves nor in roots (RV4+/1). Protein accumulation in
roots of line RV4+/8 could be confirmed. The migration speed of the ASP1 protein
band (12-13kD) corresponds to the molecular weight of a processed ASP1-KDEL
protein without the N-terminal signal sequence, indicating the entrance of the protein
into the secretory pathway following the correct cleavage of the sporamin-derived
signal sequence.
Storage root analysis Although there was only one line (RV4+/8) available expressing the gene of interest
we decided to compare the protein production performance of its storage roots with
untransformed ones. Roots of line RV4+/8 appeared to have significantly higher total
protein levels than wildtype roots. We found 2.70(±0.44)g protein per 100g sample in
RV4+/8 and only 1.33(±0.16)g/100g in WT corresponding to a protein increase of
more than twofold.
Discussion Within this paper we could show that the sporamin signal sequence is functional in
cassava and triggers vacuolar protein deposition most likely in the central, lytic
vacuole. The combination of this signal sequence with an ER retention signal has
been already shown to lead to an increased protein accumulation in Arabidopsis
seeds (Yang et al., 2005) and tobacco leaves (Ramirez et al., 2003). Our results from
transient expression in protoplasts support the feasibility of this dual targeting
approach for both of our tested storage proteins. However, comparative conclusions
between ASP1 and sporamin are not feasible with this approach due to a high
variation in protoplast transformation efficiency and would require e.g. the integration
82
of an internal reference (fluorescence) marker like BiP:RFP in the same expression
cassette for expression levels to be compared effectively.
Furthermore, long-term protein stability and turn-over cannot be predicted based
exclusively on transient expression data and thus stable transformation was required
for reliable conclusions. Although routine transformation procedures have been
established (Raemakers et al., 1997; Zhang and Gruissem, 2004) cassava
transformation and regeneration remains a challenging task. Nevertheless, the data
currently available from line RV4+/8 supports our transient expression findings that
Spor:ASP1:KDEL is stably expressed and accumulates in cassava roots. The
migration speed of the expressed protein on a Western blot corresponds to the one
of a fully processed storage protein. Had cleavage not occurred, we would have
expected a band of 16.2kD whilst cleavage of the signal sequence would result in a
13.9kD band. Upon vacuolar protein import further pro-peptide cleavage would result
in a 12kD band which seems to correlate best with our band-size (Woolford et al.,
1986; Matsuoka and Nakamura, 1991). As a consequence the band corresponding to
RER-retained ASP1 could not be clearly identified using Western-blot analysis. In
order to clarify the subcellular storage place of ASP1 in transgenic cassava roots
stable integration of a reporter gene or the use of post-transformation visualization
techniques such as electron microscopy would be helpful. However, storage root
analysis of the transgenic line RV4+/8 confirms the potential of vacuolar targeting in
cassava to obtain a strong increase in total protein. The upcoming regeneration of
more lines expressing the ASP1 gene and the targeting of proteins to both the RER
and vacuoles will help us to understand whether the specific targeting strategy that
we have decided to implement is directly responsible for the sharp increase in protein
quantity that we have observed.
Acknowledgements We would like to thank Prof. Yeh for kindly providing us the plasmid PspoAF-1, Prof.
Brandizzi and Prof. Hwang for the BiP::RFP control vector. Furthermore we would
like to thank Hanna Schneider for technical assistance with Amino Acid Analysis.
83
References Balagopalan C, Padmaja G, Nanda S, Morthy S (1988) Cassava nutrition and
toxicity. In Cassava in Food, Feed and Industry. CRC Press, Boca Raton, Florida
Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry 72: 248-254
Cock JH (1982) Cassava - a Basic Energy-Source in the Tropics. Science 218: 755-762
Jauh GY, Phillips TE, Rogers JC (1999) Tonoplast intrinsic protein isoforms as markers for vacuolar functions. Plant Cell 11: 1867-1882
Jiang L, Phillips TE, Hamm CA, Drozdowicz YM, Rea PA, Maeshima M, Rogers SW, Rogers JC (2001) The protein storage vacuole: a unique compound organelle. Journal of Cell Biology 155: 991-1002
Koide Y, Hirano H, Matsuoka K, Nakamura K (1997) The N-terminal propeptide of the precursor to sporamin acts as a vacuole-targeting signal even at the C terminus of the mature part in tobacco cells. Plant Physiology 114: 863-870
Maeshima M, Sasaki T, Asahi T (1985) Characterization of Major Proteins in Sweet-Potato Tuberous Roots. Phytochemistry 24: 1899-1902
Martinoia E, Maeshima M, Neuhaus HE (2007) Vacuolar transporters and their essential role in plant metabolism. Journal of Experimental Botany 58: 83-102
Matsuoka K, Nakamura K (1991) Propeptide of a precursor to a plant vacuolar protein required for vacuolar targeting. Proceedings of the National Academy of Sciences of the United States of America 88: 834-838
Paris N, Stanley CM, Jones RL, Rogers JC (1996) Plant cells contain two functionally distinct vacuolar compartments. Cell 85: 563-572
Park M, Kim SJ, Vitale A, Hwang I (2004) Identification of the protein storage vacuole and protein targeting to the vacuole in leaf cells of three plant species. Plant Physiology 134: 625-639
Raemakers CJJM, Sofiari E, Jacobsen E, Visser RGF (1997) Regeneration and transformation of cassava. Euphytica 96: 153-161
Ramirez N, Rodriguez M, Ayala M, Cremata J, Perez M, Martinez A, Linares M, Hevia Y, Paez R, Valdes R, Gavilondo JV, Selman-Housein G (2003) Expression and characterization of an anti-(hepatitis B surface antigen) glycosylated mouse antibody in transgenic tobacco (Nicotiana tabacum) plants and its use in the immunopurification of its target antigen. Biotechnology and Applied Biochemistry 38: 223-230
Sambrook J, Fritsch E, Maniatis T (1989) Molecular Cloning: a laboratory manual. CSH Laboratory Press, Cold Spring Harbor, NY
Schagger H, von Jagow G (1987) Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Analytical Biochemistry 166: 368-379
Stupak M, Vanderschuren H, Gruissem W, Zhang P (2006) Biotechnological approaches to cassava protein improvement. Trends in Food Science & Technology 17: 634-641
Woolford CA, Daniels LB, Park FJ, Jones EW, Van Arsdell JN, Innis MA (1986) The PEP4 gene encodes an aspartyl protease implicated in the posttranslational regulation of Saccharomyces cerevisiae vacuolar hydrolases. Molecular and Cellular Biology 6: 2500-2510
84
Yang J, Barr LA, Fahnestock SR, Liu ZB (2005) High yield recombinant silk-like protein production in transgenic plants through protein targeting. Transgenic Research 14: 313-324
Zhang P, Bohl-Zenger S, Puonti-Kaerlas J, Potrykus I, Gruissem W (2003) Two cassava promoters related to vascular expression and storage root formation. Planta 218: 192-203
Zhang P, Gruissem W (2004) Production of transgenic cassava (Manihot esculenta Crantz). In Transgenic Crops of the World - Essential Protocols. Curtis, Ian S., pp 301-319
Zhang P, Jaynes JM, Potrykus I, Gruissem W, Puonti-Kaerlas J (2003) Transfer and expression of an artificial storage protein (ASP1) gene in cassava (Manihot esculenta Crantz). Transgenic Research 12: 243-250
85
Figures and tables Figure 1
Figu
re 1
: Vac
uola
r tar
getin
g of
sto
rage
pro
tein
s sp
oram
in a
nd A
SP1
coup
led
to e
GFP
in c
assa
va p
roto
plas
ts. I
n or
der t
o tri
gger
ta
rget
ing
the
spor
amin
sig
nal s
eque
nce
was
use
d. S
cale
bar
is 1
0µm
. (A
) Loc
aliz
atio
n pa
ttern
of S
S:G
FP:A
SP
1:K
DE
L (R
V4)
in
vacu
oles
and
ER
. (B
) Lo
caliz
atio
n pa
ttern
of S
S:G
FP:A
SP
1 (R
V4- ).
With
out E
R r
eten
tion
sign
al c
an b
e fo
und
in v
acuo
les
only
. (C
) Lo
caliz
atio
n pa
ttern
of
SS
:GFP
:spo
ram
in:K
DEL
(R
V8)
in
vacu
oles
and
ER
. (1
) B
right
field
, (2
) G
FP:p
rote
in s
igna
l, (3
) B
iP:R
FP s
igna
l for
ER
, (4)
ove
rlay
of (2
) + (3
).
86
Figure 2
Figu
re 2
: Mol
ecul
ar c
hara
cter
izat
ion
of c
assa
va li
nes
trans
form
ed w
ith S
pora
min
SS
-AS
P1-
KD
EL.
Top
par
t: re
lativ
e A
SP
1 tra
nscr
ipt a
bund
ance
of 3
di
ffere
nt li
nes
usin
g R
eal-t
ime
PC
R in
leav
es a
nd ro
ots.
Bot
tom
par
t: P
rote
in a
bund
ance
in y
oung
root
s.
87
X. Discussion and Perspectives Genetic engineering has been the method of choice to express foreign genes coding
for storage proteins in crop plants (reviewed in Beauregard and Hefford, 2006).
Unfortunately this has had only limited success; Chakraborty et al. (2000) report a
48% increase in total protein in transgenic potato tubers, whereas De Jaeger et al.
(2002) report increases of 36.5% in A. thaliana seeds and only a 4% increase was
achieved in canola seeds (Altenbach et al., 1992). The aim of this study was to
increase total protein content in cassava storage roots by up to four fold, as directed
by the BioCassavaPlus initiative. In order to achieve this goal, reliable measurements
of the protein status quo were needed. Here we present for the first time extensive
protein and amino acid data for cassava cultivar TMS60444. This complements
findings from studies that used other cultivars, mainly from South-America (Ceballos
et al., 2006).
Interestingly, we have shown that root protein levels can vary up to 23% between
biological replicates and depend on the time of harvest. This must be taken into
consideration in future experiments when analysing the protein content of cassava
storage roots. To date, studies have not applied uniformed standards for this issue,
often opting to determine crude protein content using the Kjeldahl Nitrogen method
(Yeoh and Chew, 1977; Gomez and Noma, 1986). This provides only an estimate
since nitrogen to protein conversion factors have been shown to vary significantly in
cassava (Yeoh and Truong, 1996). More recently, results have been obtained directly
from analysing anhydrous amino acids. Unfortunately, even these studies follow
different standards of sample preparation, leading most probably to incomparable
results. For example, Ngudi et al. (2002) and our own lab lyophilized cassava flour
that had been subjected to acid hydrolysis, whereas Nassar and Sousa (2007) first
extracted root proteins that were then hydrolyzed. It is apparent that a standardized
protocol describing protein analysis which is based on established protocols (AOAC,
1997) is critical to normalize results obtained from different laboratories.
Based on results obtained from amino acid analysis of spiked cassava samples, we
show that SAA from cassava storage roots cannot be reliably quantified using
88
standard amino acid analysis without performic acid pre-oxidation. The available
literature does not address this issue exhaustively, resulting usually in very low
values for SAA (Yeoh and Chew, 1977; Ngudi et al., 2002; Zhang et al., 2003;
Nassar and Sousa, 2007). Whether pre-oxidation with performic acid would have
resulted in a more reliable quantification has not been examined here but at least one
available reference value would suggest that for cassava. Consequently, we propose
that future experiments are conducted using methods reliable for SAA quantification,
such as XRFS or sample pre-oxidation with performic acid, as highlighted in this
study.
One aim of the project was to improve the protein content by expressing ASP1,
sporamin and zeolin targeted to vacuoles, ER and plastids. We show that all three
storage proteins can accumulate in the ER, while zeolin can also be found in lytic
vacuoles. This finding contradicts data from Mainieri et al. (2004), who reported that
zeolin accumulates within insoluble and stable ER-derived protein bodies. Currently it
is not clear whether root cells of cassava are able to form protein bodies at all and
requires further investigation. Notably, in transgenic plants the superiority of ER
retention in comparison to cytosolic deposition could be shown, at least for ASP1,
resulting in a much higher protein accumulation both in leaves and roots. However, a
phenotypic distortion was observed in all plants expressing ASP1 but this
phenomenon is currently not understood and could be linked to either tissue-culture
induced somaclonal variation and/or a side effect of the construct. Current thinking
suggests the latter explanation is more probable for this deleterious effect. Firstly, the
literature regarding somaclonal variation in cassava does not support the high
frequency of phenotypic disorder we observed in this cultivar (Raemakers et al.,
2001; Schreuder et al., 2001; Raemakers et al., 2007). Secondly, two lines that
contained the silenced transgene were comparable in appearance to untransformed
plants. Finally, propagation via stem-cuttings in the glasshouse did not induce a
partial recovery of affected plants, as would be expected if the phenotype was due to
somaclonal variation. It is clear that a detailed analysis of the affected plants is
required to determine the reason why the construct should have a negative effect.
This would also offer insights into the mechanism behind protein transport and
accumulation in cassava roots.
89
Notably, storage roots of several transgenic lines contained significantly elevated
levels of most amino acids. Line RV3-1B had on average a 15% increase and line
RV3-1A was greater still at approximately 27%. Total protein increased only
moderately by 7% and 14% due to a significant decrease in levels of
glutamate/glutamine. We could report here that arginine plays a crucial role as
component of the total protein fraction since high protein values were coupled to high
levels of arginine. We reported here up to 14-fold increased levels of Arg compared
to WT in high protein cassava flour and Nassar and Sousa (2007) measured a 6-8
fold increase in two of their high protein cassava hybrids supporting the idea that
higher arginine levels correlate with higher total protein content. The ongoing
generation of more transgenic lines will be helpful to understand the cause of this
increase and whether the effect can be uncoupled from any phenotypic abnormality.
Besides the ER, plastids were considered as a potential cellular storage place for
exogenous proteins and subsequently tested here for their accumulation potential.
Interestingly, our results strongly suggest that ASP1 cannot be properly imported into
plastidal stroma but rather accumulates at the plastid membrane or inter-membrane
space. This has never been reported so far for any storage protein. Instead it has
been shown that import efficiency can be reduced after partial elimination of C-
terminal sequences of the transit peptide (Lee et al., 2002). Consequently, a minimal
length of 73AA of the A. thaliana homologue is required for effective import, while the
transit peptide from P. sativum was reported to be effective with at least 57AA (Van
den Broeck et al., 1985). Independently of the genetic source proteins with a non-
functional transit peptide were always found in the cytosol but not in the inter-
membrane space of plastids. This suggests that fusion proteins studied within this
thesis are in fact coupled to a functional transit peptide successfully directing their
target towards plastids. But at the plastids further stromal import would be inhibited
due to other factors not related to the transit peptide such as the structure of the
ASP1 protein.
The third sub-cellular protein location in cassava we examined here were vacuoles.
Despite the ongoing discussion regarding development of different types of vacuoles
(Martinoia et al., 2007) we could show with our approach that storage proteins can be
targeted to and accumulated within them. Whether the addition of an ER retention
90
signal has an influence on final protein yield needs to be examined further but
currently our data suggests a complete vacuolar deposition in planta. Eventually,
increased abundance of the introduced storage protein might be achieved in the next
generation of transformants.
Further research is required to determine the most suitable cellular location for
storage protein accumulation in cassava cells and it is likely that this will be protein
dependent. However, research conducted during this thesis provided the answer to
many important questions on the way and contributed significantly towards
understanding of current limitations. The ongoing sequencing project of the cassava
genome will provide essential data to gain further insights into the molecular
mechanisms behind protein accumulation and thus lead to the establishment of long
term strategies to improve the nutritional value of cassava storage roots (Raven et
al., 2006).
Altenbach SB, Kuo CC, Staraci LC, Pearson KW, Wainwright C, Georgescu A, Townsend J (1992) Accumulation of a Brazil nut albumin in seeds of transgenic canola results in enhanced levels of seed protein methionine. Plant Molecular Biology 18: 235-245
AOAC (1997) Official methods of analysis of AOAC international, Ed 16 Vol 3. Elsevier, Amsterdam
Beauregard M, Hefford MA (2006) Enhancement of essential amino acid contents in crops by genetic engineering and protein design. Plant Biotechnology Journal 4: 561-574
Ceballos H, Sanchez T, Chavez AL, Iglesias C, Debouck D, Mafla G, Tohme J (2006) Variation in crude protein content in cassava (Manihot esculenta Crantz) roots. Journal of Food Composition and Analysis 19: 589-593
Chakraborty S, Chakraborty N, Datta A (2000) Increased nutritive value of transgenic potato by expressing a nonallergenic seed albumin gene from Amaranthus hypochondriacus. Proceedings of the National Academy of Sciences of the United States of America 97: 3724-3729
De Jaeger G, Scheffer S, Jacobs A, Zambre M, Zobell O, Goossens A, Depicker A, Angenon G (2002) Boosting heterologous protein production in transgenic dicotyledonous seeds using Phaseolus vulgaris regulatory sequences. Nature Biotechnology 20: 1265-1268
Gomez G, Noma AT (1986) The Amino-Acid-Composition of Cassava Leaves, Foliage, Root Tissues and Whole-Root Chips. Nutrition Reports International 33: 595-601
Lee KH, Kim DH, Lee SW, Kim ZH, Hwang I (2002) In vivo import experiments in protoplasts reveal the importance of the overall context but not specific amino
91
acid residues of the transit peptide during import into chloroplasts. Molecules and Cells 14: 388-397
Mainieri D, Rossi M, Archinti M, Bellucci M, De Marchis F, Vavassori S, Pompa A, Arcioni S, Vitale A (2004) Zeolin. A new recombinant storage protein constructed using maize gamma-zein and bean phaseolin. Plant Physiology 136: 3447-3456
Martinoia E, Maeshima M, Neuhaus HE (2007) Vacuolar transporters and their essential role in plant metabolism. Journal of Experimental Botany 58: 83-102
Nassar NM, Sousa MV (2007) Amino acid profile in cassava and its interspecific hybrid. Genetics and Molecular Research 6: 192-197
Ngudi DD, Kuo YH, Lambein F (2002) Food safety and amino acid balance in processed cassava "Cossettes". Journal of Agricultural and Food Chemistry 50: 3042-3049
Raemakers K, Schreuder M, Anggraini V, Putten H, Pereira I, Visser R (2007) Cassava. In Transgenic Crops IV, p 317
Raemakers K, Schreuder M, Pereira I, Munyikwa T, Jacobsen E, Visser R (2001) Progress made in FEC transformation of cassava. Euphytica 120: 15
Raven P, Fauquet C, Swaminathan MS, Borlaug N, Samper C (2006) Where next for genome sequencing? Science 311: 468
Schreuder MM, Pereira IJ, Raemakers CJJM, Jacobsen E, Visser RGF (2001) Effects of Somaclonal Variation in Cassava Plants Regenerated from Friable Embryogenic Callus of Increasing Age. In 5th International Scientific Meeting of the Cassava Biotechnology Network, Vol S7-26, Donald Danforth Plant Science Center, St. Louis, Missouri USA
Van den Broeck G, Timko MP, Kausch AP, Cashmore AR, Van Montagu M, Herrera-Estrella L (1985) Targeting of a foreign protein to chloroplasts by fusion to the transit peptide from the small subunit of ribulose 1,5-bisphosphate carboxylase. Nature 313: 358-363
Yeoh HH, Chew MY (1977) Protein content and acid composition of cassava seed and tuber. Malaysian Agricultural Journal 51: 1-6
Yeoh HH, Truong VD (1996) Protein contents, amino acid compositions and nitrogen-to-protein conversion factors for cassava roots. Journal of the Science of Food and Agriculture 70: 51-54
Zhang P, Jaynes JM, Potrykus I, Gruissem W, Puonti-Kaerlas J (2003) Transfer and expression of an artificial storage protein (ASP1) gene in cassava (Manihot esculenta Crantz). Transgenic Research 12: 243-250
92
XI. Vector overview
Figure 1: Vector overview. For CLSM green fluorescent protein (GFP) was cloned in vectors
at position indicated. KDEL= tetrapeptide triggering ER retention. (A) Four vectors used in chapter VII using three different storage proteins. ProlSS= rice prolamin signal sequence inducing entry into the secretory pathway. (B) Four vectors used in chapter VIII. SKL= tripeptide functional as peroxisomal targeting signal. psRbcS TP= transit peptide of P. sativum RuBisCo small subunit triggering protein deposition in plastidal stroma. (C) Three vectors used in chapter IX. SporSS= sporamin signal sequence containing a signal for entrance into the secretory pathway as well as a vacuolar sorting determinant (NPIRL).
93
XII. Acknowledgments I would like to thank all people who helped and supported me during the last years. In particular, acknowledgement should be given to all my colleagues and friends here who created a really stimulating environment both for work and leisure. Thanks to Alessandro, Daniel, Eveline, Gilles, Judith, Lorenzo, Ruben, Sonja, Sylvain, and Yec’han for enduring my persistent optimism, my singing, and my lunch calls. It was a pleasure for me to have such competent and creative cassava mates as colleagues like Adrian, Boris, Carmen, Dario, Hervé, Judith, Kim, and Simon. Out of these I would like to thank in particular Hervé for sailing by my side during deep and shallow waters. For useful comments and English proofreading I would like to thank in particular Simon and Carmen. Eveline, Hervé, and Johannes are acknowledged for further valuable comments. For scientific advice and supervision of my abandoned rice project I would like to thank Christoph Sautter. For cassava supervision Peng has to be acknowledged. And Wilhelm Gruissem is acknowledged for providing me the independence of pursuing my PhD in his lab. But all the brain is useless without a heart providing it with the essence of life. And indeed, Alexandra was, is and will be essential for me and my brain. This list could be much longer and I ask for apologies from all people who assisted me in any way not mentioned here. Thanks for contributing to such a great period in my life! May those who love us, love us. And those who don't love us - may God turn their hearts. And if He cannot turn their hearts, may He turn their ankles, so that we may know them by their limping. (taken from the movie “Keeping the Faith”)
94
XIII. Curriculum Vitae Personal Details Details of Birth: 02/01/1978 in Bad Friedrichshall (D) Postgraduate Experience 05/2004 – present: Ph.D. thesis at ETH Zurich, group of Prof. Gruissem in the field
of Cassava Plant Biotechnology University Education 09/1998 – 09/2003: Diplom-Lebensmittelchemiker (Food Chemistry) at the University
of Karlsruhe 03/2003 – 09/2003: Diplomarbeit (thesis) at The University of Western Australia in
the lab of Dr. Susan J. Barker School Education 06/1997: Abitur (School-leaving exam) 1988 – 1997: Secondary school; priorities were Chemistry and English 1985 – 1988: Primary school education Private Interests
Soccer, SCUBA- diving, rock-climbing, singing in a choir
95
top related