Genetic Modification of Musa Acuminate Delays Ripening Stage
Post on 02-Feb-2016
11 Views
Preview:
DESCRIPTION
Transcript
Genetic modification of Musa acuminate delays ripening stage
BY: ABBY HALL, LINDSEY KEPLINGER, AND GARRETT RIGGLEMAN
Food waste is a serious issue. Over 1.4 million bananas are thrown away every day in the United Kingdom alone (Prince,
2014). This is approximately 140 million calories, enough to provide 70,000 people with 2,000
calories, the amount the average person needs in a day. Twenty-seven percent of fresh fruits
were wasted in 1995 (Cuéllar and Webber, 2010).
One fruit that ripens extremely fast in bananas.
Many times you buy a bunch and they’re brown before you know it and then thrown away. With
GMO technology, we can try to fix this. Genetic engineering is one of science’s most innovative
breakthroughs (Malyska et al., 2014). Some claim is it unnatural, but there really is no exact
definition of unnatural and no negative effects of consuming genetically engineered foods have
been found (Cooley, 2004).
One piece of produce that stays edible for a long time is apples.
Placed in a refrigerator, apples can stay fresh for 1-2 months compared to bananas placed in the
refrigerator which last 2-9 days depending on how ripe they are when purchased.
What factors influence banana ripening?
There have been multiple studies on what factors influence banana ripening, but a quick search
on the internet didn’t provide us with any attempts at genetically modifying the fruit to slow
down the process. There are many tricks to slowing down the process like keeping the stem
covered in tape, or keeping the bananas in the refrigerator, but by changing the DNA, it should
make a significant change.
Enzyme: Pectate lyase To low the ripening process through genetic engineering, our first step was to find an enzyme in
the bananas that plays a role in its ripening process. The enzyme called pectate lyase has been
found to be in highest concentrations when fruits are at peak ripeness. It is the most active cell
wall-degrading enzyme during fruit ripening (Payasi, 2013). So, in an attempt to slow the
ripening process of the banana down, we’re going to genetically modify a banana to produce
the pectate lyase enzyme of an apple rather than the pectate lyase enzyme of a banana.
No gene promotors needed If this works as expected, we shouldn’t need any gene promotors. Hopefully, this modified
pectate lyase enzyme will work in the ripening process just as the regular enzyme does in all
circumstances.
Pectate lyase sequence in bananas
CTCAGATAGTGCAAGGCATGGCTACTTCCACGTGGTAAACAATGACTACACGCACTGGGAGATGTACGCC
ATTGGCGGTAGCGCGAATCCAACGATCAACAGTCAAGGCAACCGATACCTTGCGCCGACCAATCCATTTG
CAAAGGAGGTAACAAAAAGGGTGGACACAGATCAAAGCACGTGGAAGAACTGGAATTGGAGGTCGGAGGG
TGACCTGCTTCTGAATGGTGCTTTTTTCACCCCTTCCGGTGCAGGGGCTTCAGCCAGCTACGCACGGGCC
TCCAGCTTTGGGGCCAAGCCCTCTTCCTTGGTTGACACACTGACTTCTGATGCTGGGGTCCTGTCTTGCC
AAGTCGGCACTCGATGTTAACGTAATGCCAAGTAGCAGAACGCCACAACCCGAAGGATGGGAAATCGTAC
TTGACGGTGTTACAAATTTCTTCTATGTTACACCGTCAGAAATGTCATTTCCTCCAATTGCCCAACCTCC
GCCTGGCTCCATATGTGGAGCGCATGCGGAAGCGTTGTCAGTTTCTTTTATTCTACTTTGCTGTTTTAGC
TCTGTTACACCGTCCATCTAGCAATAAGTGGGTTTATAGATAGACTTCAAAAAAAAAAAAAAAAAA
Pectate lyase in apples actcacaaac acacctcctc tctctctgcc ttctctctct ttgcttgcct cagtgccttg
61 cacattcaaa aaaatgccaa aaatgccaag gccctcctca ggcccctcac ttctctctcc
121 cctcctcctc ctccctctcc tctctctcct ctccccaacc ctcatttcct ccaggccact
181 tcatctccaa gaccctgaat tggtagtaca agaggtacaa aggaatatta gcgactcagt
241 atctaggagg aacttgggct acttgtcatg cgggaccggc aaccctatcg acgactgctg
301 gcggtgcgac ccgaactggg agaagaacag gcagagctta gctgattgtg cgatagggtt
361 cggaaagaac gccataggtg gaagagacgg gaagatttac gtggtcacag attccggcga
421 tgacgacccc gtgaacccca agccaggaac cctacgacac gccgtcatcc aagacgagcc
481 attatggatc attttccagc gtgacatgac catccagctg aaggaggagc tgatcatgaa
541 ctccttcaag acaatcgacg gccggggagc gtccgtacac attgccggcg ggccatgcat
601 caccatccag ttcgtgacca acattattat ccacggactg cacatacacg attgcaagca
661 gggtgggaac gctatggtga ggagctcccc caggcacttc gggtggagga ccgtatcgga
721 cggcgacggc gtgtcgatct tcggtgggag ccacgtgtgg gtggaccatt gctcgttgtc
Pectate lyase in apples (cont.) 781 caactgcaaa gatgggttgg ttgatgcaat ttatgggtcc actgcgataa cgatttcgaa
841 caattacatg acgcaccatg ataaggtgat gcttttgggg catagcgatt cgtataccaa
901 cgacaagaac atgcaaatca ccattgcgtt caatcacttt ggagaaggct tggtccaaag
961 aatgccaaga tgtaggcatg gatatttcca tgtggtgaac aatgactaca cccattggga
1021 gatgtatgcc attggtggga gtgcagaccc tacaatcaat agccaaggga acagatttgc
1081 tgcaccagat atcagatcca gcaaagaggt gaccaaacat gaggatgcac cagaaagtga
1141 atggaagaat tggaactgga ggtcggaagg cgacttgatg ctcaacggtg cgttttttac
1201 tgcatcaggt gccggagctt cctctagcta cgccagggct tcgagcttgg gtgcaaagcc
1261 atcttctcta gtgggtgcga ttaccacggc ttccggcgca cttagttgcc gaaagggctc
1321 tcgttgctga ttgcatatcg agcttgtggc ctattgaaaa cgacattcct aaagtgatta
1381 gctgaagaac tattcaagtt caattagaca tatttaggag ggaagtgaga ggaaaacgac
1441 atttcctcca aacaatattt tctactttgt ccctttgctt ttttactgtt tttaagtcaa
1501 ttttcatgat gattacaacc tcgctttgtt tctctgaggc tgcattaggg tttctgttca
1561 agaatcttga tgacctataa gagaagacaa gtgttgaagt gttgactata ctaaattatc
1621 aatctatttc ctgatatttg ataaaaaaaa aaaaaaaaaa
Restriction enzyme MluCI They both have 3 AATT sequences. To get them to combine, we use restriction enzymes. Restriction
enzymes are often called molecular scissors because they cut DNA into either sticky or blunt ends. We
will be using the restriction enzyme called MluCI, an isoschizomer of Tsp509I. They are isoschizomers
of each other because they both recognize the same genetic sequence (Vanamee et al., 2010). Tsp509I
has been used in various studies before. Use of this enzyme is quick and practical while also being low-
cost (Mahami-Oskouei et al., 2011). MluCI can be ordered online through New England Bio Labs which
is what we would do.
DNA transfer using plasmids To get the DNA from the apple to the banana, we would use agrobacterium tumefaciens
bacterium’s plasmid. After removing the plasmid, we would treat both it and the DNA of the
apple with the restriction enzyme to form sticky ends on both the plasmid and the DNA region
of interest. The two would then be allowed to connect. The recombinant DNA would then be
inserted back into the bacteria which would be allowed to colonize.
PyroMark Q96 ID Once we create the new DNA for the pectate lyase enzyme, we will use the PyroMark Q96 ID
from Qiagen to see the DNA sequence. The PyroMark Q96 ID is a very reliable, fast machine that
been used in many studies. It can and has been used for a wide range of study topics including a
study that aimed to detect bacterial etiology in urine to properly diagnose UTI’s (Lu et al., 2011)
and another that investigated parent-of-origin SNP’ (single nucleotide polymorphisms) in
imprinted genes (Zhang et al, 2013). We would use it to test the bacteria we created to make
sure the DNA from the apple was present.
Use the bacteria to insert the DNA
Once we knew it was present, we would use the bacteria to insert the apple’s DNA into the
chromosome of a banana cell. The plant cells would be allowed to grow in a culture and then
the modified banana would be generated from these clones. All of the cells in the banana will be
affected by this modification.
Grow modified banana trees After successfully growing several of the modified banana trees, we will take some of the
modified bananas and generic bananas and test their ripening times. We would, of course, have
to have constants including the soil they were grown in, and the environment in which they
were allowed to ripen, monitoring factors such as temperature and humidity. We would test the
time it takes for the bananas to reach a point in the ripening process such as no green remaining
on the bananas or when a few brown spots begin to appear.
Negative Outcomes Negative outcomes can be expected with all genetic modification experiments. No one can know
exactly how modifying the DNA will affect the organism, in this case the banana. The taste may
be askew, the bananas may fail to ripen at all, or the plants could fail to grow because we don’t
know exactly how pectate lyase plays a role in the entire growth process.
Negative Outcomes (cont.) There are also risks that the organism could become an invasive species or affect its local
ecology in some way (Wolfenbarger and Phifer, 2000). The most controversy over GMO’s comes
from those worried about long-term effects, but the doors that are opened through transgenic
plants create endless opportunities for new discoveries. (Andow and Zwahlen, 2006).
Literature Cited Andow, D. A., & Zwahlen, C. (2006). Assessing environmental risks of transgenic plants. Ecology Letters,9(2), 196-214. doi:10.1111/j.1461-0248.2005.00846.x
Cooley, D. R., & Goreham, G. A. (2004). ARE TRANSGENIC ORGANISMS UNNATURAL?. Ethics & The Environment, 9(1), 46.
Cuéllar, A., Webber, M. (2010) Wasted Food, Wasted Energy: The Embedded Energy in Food Waste in the United States. Environmental Science & Technology. 44 (16), 6464-6469 http://pubs.acs.org/doi/full/10.1021/es100310d
Mahami-Oskouei, M., Dalimi, A., Forouzandeh-Moghadam, M., & Rokni, M. B. (2011). Molecular Identification and Differentiation of Fasciola Isolates Using PCR- RFLP Method Based on Internal Transcribed Spacer (ITS1, 5.8S rDNA, ITS2). Iranian Journal Of Parasitology, 6(3), 35-42.
Malyska, A., Maciag, K., & Twardowski, T. (2014). Perception of GMOs by scientists and practitioners - the critical role of information flow about transgenic organisms. New Biotechnology, 31(2), 196-202. doi:10.1016/j.nbt.2013.11.004
Prince, R. Feeding Britain: from potatoes to bananas, the tonnes of produce thrown away every day. 2014 Dec 8. The Telegraph. Web. 2015 Oct 25.
Literature Cited (cont.) Payasi, A., Sanwal, G., (2013 June). Pectate lyase activity during ripening of banana fruit. Phytochemistry, 63(3), 243–248. Web. 2015 Oct 28.
Vanamee, E., Viadiu, H., Chan, S., Ummat, A., Hartline, A., Xu, S., Aggarwal, A. (2010 Sep). Asymmetric DNA recognition by the OkrAI endonuclease, an isoschizomer of BamHI Nucl. Acids Res. 39 (2): 712-719. doi:10.1093/nar/gkq779
Lu, J., Yu, R., Yan, Y., Zhang, J., Ren, X. (2011 July). Use of Pyromark Q96 ID pyrosequencing system in identifying bacterial pathogen directly with urine specimens for diagnosis of urinary tract infections. 86(1): 78-81. doi: 10.1016/j.mimet.2011.03.016
Wolfenbarger, L., & Phifer, P. (2000). Biotechnology and ecology - the ecological risks and benefits of genetically engineered plants. Science, 290(5499), 2088-2093.
Zhang, S., Zhao, S., Wang, Z., & Li, C. (2013). Investigation of parent-of-origin SNPs in 5 imprinted genes for forensic purpose. Forensic Science International: Genetics Supplement Series, 4(1), e304-e305. doi:10.1016/j.fsigss.2013.10.155
top related