Farzin Farzaneh Department of Haematological Medicine King’s College London

Farzin FarzanehDepartment of Haematological MedicineKing’s College London

Gene Therapy – hype or hope ?

Gene Therapy – Inherited Monogenic disorders

• Successful gene therapy of common Chain cytokinereceptor defect (SCID)-X1 Disease:

9 children cured and off treatment! Alain Fischer – Institut Pasteur, Paris. Adrian Thrasher – Institute of Child Health, London.

Science 2000, Vol. 288: 669-672. Science 2003, Vol. 302: 415-419.

• Successful gene therapy of ADA deficiency (SCID)

2 children cured and off treatment! Caludio Bordignon – Hospital San Rafael, Milan Shimuon Slavin – Hadasa University Hospital, Jerusalem

Science 2002, Vol. 296: 2410-2413.

Cure for two fatal genetic disorders!

Clinical trial for X-SCID (Alain Fischer – Paris, Adrian Thrasher - London)

- SCID due to deficiency of common interleukin receptor c chain

- lethal at 4 months if untreated

- survival prognosis - 10 years under sterile conditions

Oct 2002: 1st report describing development of leukaemic syndrome

Jan 2003: 2nd report of identical adverse event

Jan 2005: 3rd report of leukaemia

Mar 2007: 4th report of leukaemia

1998-2000: Successful gene transfer in 10 out of 11 patients

Retroviral life cycle

Integrated provirus DNA

Nucleus

Viral DNA is integrated into the host cell genome

Unintegrated provirus DNA

Integrated viral genome is transcribed into genomic RNA and viral mRNA Virus

receptor

Viral RNA genome is transcribed into provirus DNA by reverse transcriptase

Budding

Shed virus

Assembly and release of viral particles

Infectious virions

Virus attachment to receptors on the host cell

Protein synthesis, processing and assembly

Replication defective (helper dependent) retro-viral vectors

Retroviral Packaging Cell

cDNA neo

Helper dependent retroviral vector

gag pol env

LTR LTR

The genome of a typical retrovirus

cDNA inserts

gag pol env

Retrovirus producer Cell

Helper dependent retrovirus

cDNA neo

gag pol env

cDNA neo

Viral RNA

Infected target cell – no virus production

Host cell DNA

Retroviral insertional mutagenesis

Provirus DNAGenomic DNA sequence

regulatory gene

LTR LTRpuro

Insertional inactivation

LTR LTRpuro

Insertional activationLTR LTRpuro

Pseudorandom provirus integration into the host cell

genome

LTR LTRpuro

truncated transdominant products

LMO2 -

Actin -

P4Integration

P5Integration

C antisense

C sense

LMO2 antisense

exon 1 exon 2 exon 5

LMO2 insertional mutagenesis:

3 of 15 SCID-X1 (C) children developed T-cell leukaemia after the retroviral transfer of C gene to the CD34+ haematopoietic stem cells

Hacein-Bey-Abina et al (2003). Science 302: 415-419.

• Use of retroviral vectors – hence inherent risk of insertional mutagenesis

• Selective growth advantage of T cells expressing C

• The inherent anti-apoptotic effect of C gene expression

• Genetic modification of haematopoietic stem cells

• Genetic modification of large numbers of cells – hence increased numbers of cells at risk of mutagenesis

• The immune suppressed status of the host

• Reduced endogenous numbers of competing T-cells

• Potential predisposing cytogenetic abnormalities

Possible factors contributing to development of T cell leukaemia in the C clinical trial

A problem turned on its head

- functional analysis of the genome

Objective:

• Identification of phenotypic / physiological function

• Determination of rate-limiting, regulatory steps

• Identification of causally associated rather than

consequential changes

Functional analysis of the genome

Strategy:- Retroviral cDNA library expression cloning

- RNA interference (siRNA) library based inhibition cloning

- Retroviral insertional mutagenesis

Retroviral cDNA library expression cloning

cDNA neo

gag pol env

cDNA neo

gag pol env

Infect cells with cDNA library

Select phenotypeand expand

cDNA neo

Introduce viral genesto rescue cDNA vector

gag pol env

Confirm cDNA encodes the selected function

cDNA neo

gag pol env

cDNA neo

Identify cDNA

cDNA neo

Williams & Farzaneh (2004). Cancer Immunol. Immunother. 53: 160-165.

Immobilized cells in semi-solidculture (e.g. pluripotent cells in soft agar)

Induction of differentiation, apoptosis, or other selectable functions

Isolation of clonal population of cellswith the selected phenotype

Phenotypic selection of cellular function (e.g. resistance to differentiation, apoptosis, etc.)

Alternative strategies:

- Ligand and antibody mediated selection of cells with specific surface markers

- Tissue/function specific promoters for drug mediated selection of cells with the appropriate phenotype

Protein Phosphatase 4: an inducer of apoptosis!

cDNA library transfer - selection of apoptosis resistant cells

W7.2 + Dex W7.2/4n10 + Dex

Insert identified: C-terminal catalytic subunit of PP4 – induces apoptosis resistance ( PP4 breakdown)

W7.2 + Dex W7.2/4n10 + Dex

PP4-Cat.

Vector100

Dex (60nM)

γ(1000cGy)

Dex (60nM)

γ(1000cGy)

UV(20J/m2)

W7.2 cells

PP4 – a new apoptosis regulator

(member of the superfamily of serine/threonine phosphatases)

• Expression of the catalytic subunit of PP4 (C-terminal fragment*):

- steady-state levels of PP4 RNA and protein

- blocks induction of apoptosis by UV, γ-irradiation or dexamethasone

- target site: TTCTAATAAAAGAAGAAAAAT - reduces

• Over-expression of full-length PP4 induces apoptosis in mouse and human cell lines

Mourtada-Maarabouni et al. (2003) Cell Death Differ. 10:1016-24.

• Growth Arrest Specific transcript 5 (GAS5):

A non-coding regulatory RNA

• rFAU:

A non-coding antisense transcript identified both by cDNA expression cloning and expressed by Finkel-Biskis-Reilly sarcoma virus (FBRSV)

Apoptosis control by naturally expressed regulatory RNA species

Induction of resistance to UV (254nm, 20J/m2), X-rays (1000cGy), steroids (60nM Dex) and etoposide (1nM)

PP4: Mourtada-Marabouni et al. (2003) Cell Death & Diff. 10: 1016-1024.rFau: Mourtada-Marabouni et al. (2004) Oncogene 23: 9419-9426.RACK1: Mourtada-Marabouni et al. (2005) J Leuk. Biol. 78: 503-514.

Functional studies of the genome(RIM, cDNA, RNAi libraries)

Direct identification of controlling genes

(i.e. causal rather than consequential changes)

Rate-limiting regulatory gene products:

Cancer Gene Therapy

- some of the main strategies

Expression of tumour-suppressor genes

• Expression of p53 induces growth arrest and increased apoptosis in response to chemo/radio-therapy.

• p53 expression also blocks angiogenesis by ↓ VEGF and by ↑ expression of thrombospondin and IGF-1 BP.

Anti-sense RNA, ribozyme and RNA interference mediated inhibition of oncogene expression

Oncogenes examined:

c-erbB2, c-erbB4, K-ras, H-ras, HPV E6/E7, bcl-2, Telomerase, c-met, c-myc.

Suicide gene therapy

Enzyme Prodrug Active product MechanismHSV-tk GCV/ACV GCV/ACV triphosphate Blocks DNA synthesis

Cytosine deaminase 5-Fluorocytosine 5-Fluorouracil (5-FU) Blocks DNA/RNA synth.

Nitroreductase Nitrobenzyloxcarbonyl Anthracyclines DNA crosslinking anthracyclines

Carboxylesterase CPT-11 SN38 Topoisomerase inhibitor

Cytochrome p450 Cyclophosphamide Phosphoramide mustard DNA alkylating agent

Purine nucleoside 6-mercaptopurine-DR 6-mercaptopurine Purine antagonistphosphorylase

Conditionally replicating / oncolytic viruses

Frank McCormick 2001, Nature Reviews 1: 130-141.

Replication of a conditionally replicating virus. ONYX-015, in a cancer cell from a patient with head and neck cancer during Phase-II clinical trial. 109 infectious E1B defective Adenovirus particles were injected over a 5 day period. After 8 days biopsy was performed and analysed by electron microscopy.

Productive replication, cell

Virus kills tumour cell, spreads to neighbours

Oncolytic virus

Normal cell: abortive replication

Tumour cell

ONYX-015 plus Cisplatin/5-FU

Cycle 1, Day 22 Cycle 3, Day 22Baseline

Yoon LTK, Laquerre S, Kasahara N (2001) Curr Cancer Drug Targets 1: 85-106.

Oncolytic virus therapy – problems:

– robust immune response (and other intratumoural barriers):

rapid clearance of virus

– basis for attenuation / tumor selectivity: not well understood

Retro- and lenti-virus vectors

High-titre vectors for -

• functional analysis of the genome

• immune gene therapy of poor prognosis acute myeloid leukaemia (AML)

Retro- and lenti-virus vectors

High-titre vectors for -

• functional analysis of the genome

• immune gene therapy of poor prognosis acute myeloid leukaemia (AML)

Generation of biotinylated retroviral vectors

Biotin succinimide ester

Hughes et al (2001) Molecular Therapy 3: 623-630.

Biotinylated retro- and lenti-virus vectors:

Vector concentration

Attachment of targeting ligands

Paramagnetic labelling and concentration of the vector/s

Biotin / avidin mediated attachment of targeting ligands

Casimir et al (2004). J. Gene Medicine 6: 1189-1196. Chan et al (2005) J. Virol. 79: 13190-13194.

1x1010

Control

Biotin

SE conc

DMSO c

Biotin

4200 X

125x concentration(i.e. reduction in volume)

Paramagnetic bead concentration of retroviral vectors

Efficient transduction of primary CD34+ blasts:

71 + 23 % of all cells express transgene after a single round of infection at an MOI of 3

Paramagnetically targeted retrovirus delivery

International Society for Cell & Gene Therapy of Cancer

…LGGA KEAC GGGLNDIFEAQKIbEWHE ACPTGL…

SPH-1SPH-1

Signal peptide

BAP LNGFRExtracellular domain

Transmembrane domain

Endogenously biotinylated LNGFR

Packaging cells producing endogenously biotinylated retrovirus vectors

BirALNGFRTransmembrane domain

LNGFRExternal domain

Biotin

Nesbeth et al. 2006, Mol. Ther. 13: 814-822

Envelope / receptor independent vector concentration & targeting

Amphotropic producer cell

Amphotropic vector

Vector concentration (K562 stable colonies)

1x 1010

1x 1011

1x 106

1x 107

1x 108

1x 109

Control

B7.1 cDNA transduced packaging cells

Amphotropic vector

Amphotropic vector (surface B7.1)

1x 1010

1x 1011

-B7.11x 106

1x 107

1x 108

1x 109

CTLA4Control

B7.1 or LNGFR cDNA transduced packaging cells

Amphotropic vector

Amphotropic vector (surface LNGFR)

1x 1010

1x 1011

-B7.11x 106

1x 107

1x 108

1x 109

CTLA4 -LNGFRControl

SCF cDNA transduced packaging cells

Casimir et al (2004). J. Gene Medicine 6: 1189-1196.

Producer cell with surface expressed SCF

Amphotropic vector (surface SCF)

B7.1 or LNGFR cDNA transduced packaging cells

Amphotropic vector

Amphotropic vector (surface LNGFR)

1x 1010

1x 1011

-B7.11x 106

1x 107

1x 108

1x 109

CTLA4 -LNGFRControl

ampho0

SCF-ampho

Targeting to c-kit+/CD34

Bone Marrow Cells

Paramagnetically labelled / concentrated lentivirus

1 m particles with attached vector

Nesbeth et al. 2006, Mol. Ther. 13: 814-822

A genetically modified autologous cell vaccine for

Acute Myeloid Leukaemia (AML)

Immune gene therapy of cancer

Human cancer antigens recognized by T lymphocytes

Cancer-testis antigens:MAGE-3, BAGE, GAGE, NY-ESO-1

Melanocyte differentiation antigens:Melan-A/MART-1, Tyrosinase, gp100

Point mutations:β-catenin, MUM-1, CDK-4, p53, ras

Overexpressed ‘self’ antigens:Her-2/neu. P53, MUC-1

Viral antigens:HPV, HBV, HCV, EBV

• Tumour cells can be immunogenic

• There are tumour associated and tumour specific antigens

• Cancer is not the product of immune incompetence

- ELISPOT and MHC/antigen tetramers show increased presence of tumour targeted T cells

• Tumour editing of the immune system AND immune editing of the tumour

- a clinical tumour has already escaped immune surveillance

Professional antigen presenting cells:

Schwartz 1992

Professional antigen presenting cells:

Schwartz 1992

Acute Myeloid Leukaemia (AML):

• AML blasts express both HLA class-I, and class-II

• Express AML associated antigens (WT1, PRAME, GP250, etc)

• Common lineage with APCs – efficient antigen presentation

• Express many surface markers present on DC – but not B7.1 (CD80) !

■■■ ■ ■ ■ ■ ■ ■●●●

● ● ●

● ●

■ ■

■■

0 20 40 60 80

Days post-challenge2x107 leukaemic cells iv

32D/M3P (vector)

32D/B7.1

32D/IL-2

32D/B7.1/IL-2

Leukaemogenecity of 32DP210bcr/abl cells modified to express B7.1, IL-2 or both

■●

Rejection of established myeloid leukemia (32Dp210) in mice, by genetically modified leukemia cells expressing B7.1 and IL-2

■ ■●●

● ●

■ ■

■■■

Time (days)Leukemia initiation

(105 32Dp210 cells iv)

100 20 40 60 80 0

Vaccination (106 irradiated cells)

32D/M3P (Vector)

32D/B7.1

32D/IL-2

32D/B7.1/IL-2

Cell vaccine

● ●●● ● ●■ ■■■ ■ ■ ■ ■ ■■

Can B7.1/IL-2 expressing AML cells induce T cell proliferation?

If so, are the stimulated T cells functionally competent (Cytokine release, cytolytic activity)?

Are AML cells susceptible to T cell mediated lysis?

Can post-chemotherapy ,“remission” T cells, stimulate cytolytic activity?

Is there any specificity in the cytolytic activity of the stimulated T cells against the leukaemic cells?

Important questions for the clinical application of immune gene therapy:

In vitro stimulation of T cells with autologous primary AML blasts (MLR)

MB – at presentation

0 50 100 150 200 250 300

uninfected

IL-2/B7

PW – at presentation

0 2 4 6 8 10 12 14

uninfected

IL-2/B7

Stimulation Index

MB – remission (no BMT)

CY – remission (no BMT)

0 10 20 30 40 50

Uninfected

B7/IL-2

Stimulation Index

0 5 10 15 20 25 30

uninfected

L-2/B7

Stimulation Index

AJ – remission, post BMT

uninfected

0 200 400 600 800 1000 1200

B7/IL-2

Stimulation Index

0 100 200 300 400 500

Uninfected

B7/IL-2

HM –remission, post BMT

Stimulation IndexStimulation Index

0 50 100 150 200 250 300

unstimulated

Unmodified AML

IL-2.B7 AML

number of IFN-gamma secreting cells per 2 x 10^5 cells

0 50 100 150 200 250 300

unstimulated

Unmodified AML

IL-2.B7 AML

number IFN-gamma secreting cells / 2 x 10^5 cells

IFN-gamma ELISPOT: 1 week stimulation with the indicated autologous AMLs, assayed on the same unmodified AMLs

Increased numbers of functionally competent T cells generated by the in vitro culture of T cells with B7.1/IL-2 expressing AML cells.

Stimulation of cytotoxic activity against unmodified AML blasts

010203040

0 210 12

010203040

Unstim

16 149

010203040

Unstim

Effectors: Donor T cells

Stimulators: The indicated AML cells

Target cells: The same, but unmodified, AML cells

• AML cells expressing B7.1 & IL-2 can stimulate in vitro CTL activity in donor T cells.

• AML cells are susceptible to CTL mediated lysis.

% Lysis

Unstim

Autologous CTL activity

Remission PBLs can be stimulated by B7.1/IL-2 expressing autologous AML cells to generate cytotoxic activity

- Remission T cells are not defective in cytolytic activity

- AML cells are not resistant to T cell mediated lysis

Unstimulated Unmodified AML

IL-2.B7 AML

E:T ratio = 50:1

IL-2.B7 AML

PREVIOUS STIMULATION

IL-2.B7 AML

1012141618

100:1 50:1 25:1 12:1 6:1

Effector to Target Ratio

Unstimulated

Unmodified AML

LV.B7.1 AML

LV.IL-2/B7.1 AML

LV.IL-2 AML

Specificity of the in vitro stimulated T cells

• Greater specificity of the B7.1/IL-2 stimulated T cells against AML blasts, than against remission bone marrow cells.

0 10 20 30 40

Unstimulated

Unmodified AML

B7.IL-2 AML

Stimulation Index (proliferation in a secondary assay)

Remission BoneMarrow

AML blasts

Autologous Stimulatorsunstimulated (media only)

unmodifiedAML cells

IL-2/B7.1 AML

No target CD14+ AML blasts

Secondary targets

- tumour editing of the immune system

- immune editing of the tumour

Two obstacles to cancer immune therapy:

Tumour editing of the immune system:

Chronic immune stimulation (cancer or infection) induces loss of functional competence, anergy, clonal exhaustion, depletion, and induction of Tregs.

Klenerman et al (2002) Nature Reviews: Immunology 2: 263-272.

Implications for therapeutic vaccination strategies- the most potent antigens may not provide the

best vaccination targets !

Immune editing of the tumour:

A clinical tumour has undergone selection for resistance to immune Surveillance -

hence the need for : - reduced tumour mass

- reconstituted immune system – if possible !

Chan et al (2006). Cancer Immunol. Immunother 55: 1017-1024.

Standard Treatment

5x105 106 5x106 107 5x107 108

Chemotherapy

CR or PR

Allo-HSCT RIC (Fludarabin, Busulphan, Campath 1H)

Day 28 Day 56 Day 100Day 0

DLI (cells/kg)

Day 100+

Donor Leuckocyte Infusion (DLI)

if no evidence of GvHD

Poor prognosis AML

Standard Treatment

5x105 106 5x106 107 5x107 108

Chemotherapy

CR or PR

DLI (cells/kg)

Day 100+

Minimal disease burden

Reconstituted immune system

(donor chimerism)

Poor prognosis AML

B7.1/IL-2 immune gene therapy

5x105 106 5x106 107 5x107 108

Chemotherapy

CR or PR

DLI (cells/kg)

Day 100+

Minimal disease burden

Reconstituted immune system

(donor chimerism)

105 106 107 108 108 108

VaccinationB7.1/IL-2 modified ‘autologous’ AML cells

Poor prognosis AML

Vaccination and DLI will stop if:

1. GVHD > grade 2

2. Progressive cytopenia

3. Grade-2 toxicity

4. Unexplained side effects

Gene Therapy – Hype or hope?

Monogenic inherited disorders:

Over 30 children with incurable SCID (common Chain and ADA) cured and currently off treatment

Malignant disease:

A lot of hype, a great deal of hope and still a long way to go

King’s College London:

HaematologyLucas Chan David Darling

Steve Devereux Andrea Buggins

Joop Gäken Joanna Galea-Lauri Barbara Guinn Nicola Hardwick

Joti Hannoe Al HoWendy Ingram Aytug Kizilors

Nicholas Lea Daren NesbethJames WellsGhulam Mufti

Head & Neck Oncology

Mahvash Tavassoli

Mayo Clinic: Stephen Russell

University College London:

Mary CollinsAdrian Thrasher

UCLANoriyuki Kasahara

Sharon WilliamsNigel Slater

University of Cambridge:

Imperial College London: Colin CasimirMyrtle GordonNagy Habib

• HSC transduction unlikely with intra-tumoural injection

• Inability to infect HSCs in vivo without growth factors

• No selective growth advantage for the infected cells

• Suicide gene-mediated elimination of infected cells

• Risk versus benefit ratio in poor prognosis malignancies

Mitigating factors in considering the use of replicating MLV vectors for suicide gene therapy of

cancer

PBMCs alonePBMCs with

Unmodified AMLPBMCs with B7.1/IL-2

expressing AML

• Ex-vivo modification of cells followed by lethal irradiation before re-administration (e.g. cancer vaccines).

• Use of non-integrating vectors (e.g. adenovirus).

Current strategies for dealing with the problem of insertional mutagenesis

• Use of vectors with preferred genomic sites of integration e.g. adeno-associated virus (AAV) – need to increase payload.

• Use of episomally maintained vectors based on EBV and EBNA/Ori containing plasmids (i.e. extra-chromosomal maintenance).

• Development of vectors with targeted chromosomal site/s of integration.

• Incorporation of single or multiple suicide genes into vectors.

Forego stable expression:

Develop better vectors:

siRNA or ncRNA library production and analysis

Retrovirus packaging cell ( no expression )

siRNA/ncRNA Library under the control of inducible promoter Transfection into retrovirus

packaging cell line Library of cells producing the siRNA/ncRNA retrivirus library

(no expression)

Retroviral siRNA/ncRNA library

Target cells

Target cells infected with the retroviral siRNA/ncRNA library

(no expression of siRNA/ncRNA)

Induced expression ofsiRNA/ncRNA

Phenotypic selection

Inducible expression of siRNA/ncRNA

Identification of siRNA or ncRNA and their targets

RCR vector mediates highly efficient gene transmission

(NIH3T3 cells, MOI=0.0005)

Day 2:

22.7 %

Day 4:

93.8 %

Day 7:

Logg CR et al. (2001) Hum Gene Ther, 12: 921-932.

RCR vectors for suicide gene therapy

• CD converts the non-toxic prodrug 5-FC to the toxic metabolite 5-FU• Better bystander effect than HSV-tk/GCV

Yeast cytosine deaminase (CD) as a suicide gene

gag pol envU5RCMV U5RU3

IRES CD

5-fluorocytosine (non-toxic)

5-fluorouracil (toxic)

The ACE-CD Vector:

Multiple cycles of 5-FC can further improve survival and suggests persistence of RCR-CD in metastatic intracranial glioma cells

median survival:>100 days

Current Standard Treatment:

Reduced Intensity Conditioning (RIC) combined with mini-HSCT

5x105 106 5x106 107 5x107 108

Chemotherapy

CR or PR

DLI (cells/kg)

Day 100+

Poor prognosis AML

Analysis of the transcriptome, proteome, etc.

• Comparison of transcripts or proteins expressed in cell or tissue A with B

• Advantage: - Rapid screening of large number of changes

• Disadvantage: - No discrimination between cause and consequence

What function ? ~ 30,000 genes(~ 100,000 protein coding RNA)

What function ?

• At the molecular/biochemical level– e.g. kinases, proteases, etc.

~ 30,000 genes(~ 100,000 protein coding RNA)

~ 1/3 known biochemical role

What function ?

• At the cellular level– Specific (e.g. phosphorylation of cell cycle

proteins, response to growth hormones)– General (e.g. involvement or regulation of

DNA repair, protein synthesis, etc.)

~ 1/2 identified physiological role

What function ?

• At the cellular level– Specific (e.g. phosphorylation of cell cycle

proteins, response to growth hormones)– General (e.g. involvement or regulation of

DNA repair, protein synthesis, etc.)

• At the phenotypic/physiological level– e.g. rate limiting regulatory factors

controlling cell survival, apoptosis, differentiation, trans-differentiation, etc.

~ 1/2 identified physiological role

Few have rate-limiting regulatory functions ?

• Objective: • Identification of phenotypic / physiological function

• Determination of rate-limiting, regulatory steps

• Identification of causally associated rather than consequential changes

Functional analysis of the genome

- Retroviral insertional mutagenesis disruption cloning

- Retroviral cDNA library expression cloning

- RNA interference (siRNA) library based repression cloning

- Non-coding RNA (ncRNA) library based regulation cloning

• the availability of genomic sequences

• increased retroviral titres

Substantially enhanced by:

Functional analysis of the genome(RIM, cDNA, siRNA and ncRNA libraries)

Advantage: - Direct identification of controlling genes (i.e. identification of causal rather than consequential changes)

Disadvantage: - Requires selectable phenotype (e.g. resistance to apoptosis, differentiation, etc.)

- limited by inefficient library transfers (…..no longer!)

- Requires adequate knowledge of the genome (now available!)

- Requires robust validation!

Determination of physiological role & identification of rate-limiting regulatory gene products:

U937 K564

NB4 MAR(Primary AML)

Lentiviral (VSV-G) infection of established and primary myeloid leukaemia cells

MOI3.0

Efficient transduction of primary AML blasts

Efficiency of primary AML transduction:

MOI ~ 1 (43 ng p24) > 40%

MOI ~ 5 (200ng p24) > 95 %

Chan et al (2005) J. Virol. 79 (20): 13190-13194.

Human myeloid leukaemia cells infected with SIN lentiviral vectors encoding B7.1, IL-2 or both

Chan et al (2005) Mol. Therapy 11: 120-131.

PBMCs + unmodified AML

PBMCs + IL2 expressing AML

PBMCs + B7.1/IL2 expressing AML

FACS analysis of NK cells

CD56dim: Account for >90% of NK cells in peripheral blood.

Express perforin and KIRs.

Subpopulation express CD16 and responsible for ADCC.

Publications suggesting CD16neg population responsible for cytotoxicity against tumour cells.

CD56bright: Produce cytokines e.g. IFN-, TNF-, IL-10.

W7.2 + Dex W7.2/4n10 + Dex

PP4-Cat.

Vector100

Dex (60nM)

γ(1000cGy)

Dex (60nM)

γ(1000cGy)

UV(20J/m2)

W7.2 cells

0 100 200

No. of coloniesafter Dex treatment

W7.2 + Dex W7.2/4n10 + Dex

PP4-Cat.

Vector100

Dex (60nM)

γ(1000cGy)

Dex (60nM)

γ(1000cGy)

UV(20J/m2)

W7.2 cells

0 100 200

No. of coloniesafter Dex treatment

Vector0

PP4-Cat.

CEM-C7 cells

Insertional mutagenesis in myeloid cells (HL-60 differentiation)

HL-60 cells HL-60 cells + Retinoic acid PAGER D cells + Retinoic acid

1A II III IV V VI VII VIII

Provirus

RARα:Mutants resistant to RA only.

1A II III IV V VI VII VIII

Provirus

RARα:Mutants resistant to RA only.

MPSV retroviral insertional mutagenesis of HL-60 cells: mutants resistant to RA, DMSO and Vit. D3

11 4111

c-myb:Mutants resistant to RA, DMSO, Vit. D3

IFN-γ TNF-α IL-2 IL-10 1L-6 IL-4

Unstimulated

Unmodified AML

Lv.IL-2.B7 AML

The profile of cytokine secretion by the in vitro stimulated T cells

(Cytokine Bead Array – CBA)

• The in vitro stimulated T cells have a predominantly Th1 phenotype

IL-6IL-10

VUD and sibling RIC transplants

VUD n = 56Sibling n = 31

0 500 1000 1500 20000

days from transplant

0 500 1000 1500 2000

days from transplant

%Overall Survival

Relapse

Ho et al (2004) Blood 104: 1616-1623.

Endogenously biotinylated retro- and lenti-virus vectors:

Vector concentration

Attachment of targeting ligands

Paramagnetic labelling and concentration of the vector/s

Biotin / avidin mediated attachment of targeting ligands

Casimir et al (2004). J. Gene Medicine 6: 1189-1196. Chan et al (2005) J. Virol. 79: 13190-13194.

– simple virus, well understood

– poor immunogenicity

– infects proliferating cells only

– transcriptional control of replication – use of tissue/ tumour specific promoters

– stable integration, not directly cytolytic – therefore possibility of sustained presence

– can provide prodrug-activated cell death by suicide genes

(e.g. GCV GCV-P; 5-fluorocytosine 5-flurouracil)

– availability of anti-retroviral drugs

No viraemia and clearance of the infected cells in mice and monkeys

Replicating MLV retrovirus as a cancer therapeutic

HSV-tk CD

(non-toxic) (non-toxic) (toxic) (toxic)

Microarray & Proteomics

• Comparison of transcripts or proteins expressed in cell A with cell B

• Comparison of the same cell under different biological conditions

• Advantage: - Rapid screening of large numbers of

transcripts/proteins

• Disadvantage: - No discrimination between cause and consequence

Descriptive analysis of genome

Subtractive cloning strategies (PCR Select):

Identification of regulatory iron binding proteins:

IREG1 (iron transporter) McKie et al (2000). Molecular Cell 5: 299-309.

Dcyt.B (Ferric reductase)McKie et al (2001). Science 291: 1755-1759.

Microarray analysis:

Identification of host factors responsible for resistance to HIV infection

A number of candidates identified!

Provirus DNAGenomic DNA sequence

regulatory gene

LTR LTRSelectable marker

Insertional inactivation / activation(gain or loss of function)

LTR LTR

cDNA expression cloning (gain or loss of function)

LTR LTR

cDNA library

Pseudorandom provirus integration into the host cell

genome

Oncolytic virus therapy – problems:

– robust immune response:rapid clearance of virus

– Inadequate targeting/specificity: “even a brick can kill tumour cells”

Farzin Farzaneh Department of Haematological Medicine King’s College London

tcell leukaemia

retroviral transfer

t cell p4n

t cell p5lmo2 actin

scidx1 c children

successful gene transfer

adrian thrasher london

use of retroviral vectors

Documents

CURRICULUM VITAE FARZANEH BANKI M.D.

Hierarchical Optimal Transport for Document...

Gilmore - Haematological Malignancies

Presented by: Farzin R. Karma Farohar Enterprizes Ph: +65.....

By Farzin Sadeq 6D The Legendary Football Player, Pele.

By Farzin Sadeq 7C

Farzaneh Module 2 Biology HSC Notes

haematological case study

Haematological cancers: improving outcomes (update)

Farzaneh Module 1 Biology HSC Notes

MJ Farzaneh Construction Director/Co-Owner Home...

Crosslinguistic transfer in the FARZANEH FOROODI-NEJAD...

Sustainability, Optimality, and Development Policy Y ... ·...

Growth Rate, Physiological Parameters, Haematological ...

ARMSTRONG FINAL PRESENTATION (farzaneh ghiassi)

Drugs in Haematological Disorders