DNA and Protein Synthesis A Brief Tutorial. Background DNA is the genetic material. DNA is the genetic material. Sometimes called “the blueprint of.

DNA and Protein SynthesisDNA and Protein Synthesis

A Brief TutorialA Brief Tutorial

BackgroundBackground

DNA is the genetic material.DNA is the genetic material.

Sometimes called “the blueprint of life.”Sometimes called “the blueprint of life.”

Used to help build everything the organism Used to help build everything the organism needs to function.needs to function.

Must remain in the nucleus.Must remain in the nucleus.

Structure of DNA Structure of DNA

NucleotideNucleotide 5 carbon sugar + phosphate group + nitrogenous base5 carbon sugar + phosphate group + nitrogenous base

DNA sugar = deoxyriboseDNA sugar = deoxyribose

Nitrogenous Bases = adenine, thymine, cytosine, guanineNitrogenous Bases = adenine, thymine, cytosine, guanine

Nucleotides are linked together into shape of Nucleotides are linked together into shape of double-helix.double-helix.

Twisted Ladder AnalogyTwisted Ladder Analogy

Science Aid: DNA Structure and Replicationscienceaid.co.uk/biology/genetics2/dna.html

DNA is really a pattern of repeating nucleotides.

LADDER ANALOGY

A DNA Sequence

Latest from the Labs: Cells and DNA

info.cancerresearchuk.org/.../cellsanddna/

The DNA molecule needs to coil and fold-up so that it can fit into the small nucleus.

The Ladder The Double Helix

Complementary Base-PairingComplementary Base-Pairing

DNA molecule is double-stranded and DNA molecule is double-stranded and “complementary”“complementary”

Adenine always pairs with Thymine (A=T)Adenine always pairs with Thymine (A=T)

Cytosine always pairs with Guanine Cytosine always pairs with Guanine (G =C)(G =C)

Backbone/rails = alternating Backbone/rails = alternating sugar/phosphate moleculessugar/phosphate molecules

Practice DNA StrandsPractice DNA Strands

ATCCGTGCTATCCGTGCT

GCGTAGCTGACCGCGATGACAGCGTAGCTGACCGCGATGACA

DNA ReplicationDNA Replication

How DNA makes a copy of itselfHow DNA makes a copy of itself

Semi-conservative ReplicationSemi-conservative Replication

2 New DNA molecules each with 1 old strand and 2 New DNA molecules each with 1 old strand and 1 new strand1 new strand

DNA Ladder unzips, enzymes come in and add DNA Ladder unzips, enzymes come in and add new base pairs…. 2 new molecules!new base pairs…. 2 new molecules!

ANIMATION! ANIMATION!

DNA, RNA, and ProteinDNA, RNA, and Protein

Main IdeaMain Idea: DNA codes for RNA, : DNA codes for RNA, which helps build proteins.which helps build proteins.

Central DogmaCentral Dogma How does the information stored in DNA get How does the information stored in DNA get

expressed in genes?expressed in genes?

DNA DNA RNARNA ProteinProtein

RNA is able to take the information RNA is able to take the information stored in DNA out of the nucleus and stored in DNA out of the nucleus and go to the ribosome to help build go to the ribosome to help build proteins!proteins!

RNARNA

5 carbon sugar = 5 carbon sugar = riboseriboseNitrogenous bases = adenine, Nitrogenous bases = adenine, uracil,uracil,

cytosine, and guaninecytosine, and guanineSingle (not double) strandedSingle (not double) stranded

3 different forms3 different forms::mRNA – messenger RNAmRNA – messenger RNA tRNA- transfer RNAtRNA- transfer RNA rRNA- ribosomal RNArRNA- ribosomal RNA

TranscriptionTranscription

DNA DNA mRNA mRNA

Information in DNA gets transcribed (or Information in DNA gets transcribed (or rewritten) into RNA language.rewritten) into RNA language.

C pairs with GC pairs with GA pairs with UA pairs with U

Sample Transcription: AGCGTGAACGTSample Transcription: AGCGTGAACGT

Next, mRNA shuttles its message to the Next, mRNA shuttles its message to the ribosomeribosome

TranslationTranslation

mRNA mRNA Protein Protein

At the ribosome, information stored in At the ribosome, information stored in mRNA molecule gets translated into a mRNA molecule gets translated into a chain of amino acids (protein) with the chain of amino acids (protein) with the help of tRNA.help of tRNA.

StepsSteps

Break mRNA molecule into 3 bases = Break mRNA molecule into 3 bases = codoncodon

Use the codon chart to determine what Use the codon chart to determine what amino acid the tRNA molecule would bring amino acid the tRNA molecule would bring to the ribosome to help build the protein.to the ribosome to help build the protein.

Protein SynthesisProtein Synthesis

DNA Strand: AGTACCGCGTCATTDNA Strand: AGTACCGCGTCATT

Transcription Product:Transcription Product:

Translation Product:Translation Product:

ANIMATE!ANIMATE!

MutationsMutations

A permanent change in the DNA of a cellA permanent change in the DNA of a cell

Missense mutationMissense mutation:: change in DNA change in DNA results in wrong amino acid placed in results in wrong amino acid placed in protein. (Might still be ok….)protein. (Might still be ok….)

Nonsense mutationNonsense mutation: change in DNA : change in DNA causes translation to stop early. (VERY causes translation to stop early. (VERY BAD)BAD)

Point mutationPoint mutation base substitution (C base substitution (C instead of G)instead of G)

Addition/DeletionAddition/Deletion “Frame shifts”… “Frame shifts”… cause change the multiple of three codonscause change the multiple of three codons

Tandem RepeatsTandem Repeats excessive repeating excessive repeating of sequences.of sequences.

Multiple Choice (Scantron) AnalogyMultiple Choice (Scantron) Analogy