Copyright 2007 John Sayles DNA Fingerprinting A Primer for Future Jurors (or Criminals)
Post on 16-Jan-2016
212 Views
Preview:
Transcript
Copyright 2007 John Sayles
DNA Fingerprinting
A Primer for Future Jurors
(or Criminals)
Copyright 2007 John Sayles
Genetic Background
Only about 10% of our DNA is found in genes
Other 90% is “junk” DNADNA that doesn’t code for protein
productionThis is the stuff that makes us unique
Copyright 2007 John Sayles
Uses of DNA Fingerprinting
Forensic cases -- matching suspect with evidence
Paternity testing -- identifying father Historical investigations Missing persons investigations Mass disasters – matching tissue to
known DNA to identify victims Military DNA “dog tag” Convicted felon DNA databases (CODIS)
Copyright 2007 John Sayles
Sources of DNA Evidence(anything containing cells)
Blood Semen Saliva Urine Hair Teeth Bone Tissue (skin, muscle)
Copyright 2007 John Sayles
RFLP Profiling
Restriction Fragment Length Polymorphisms
Older technology, but still used
Requires larger sample
Used in OJ, Clinton cases
Copyright 2007 John Sayles
RFLP (“rif-lip”)
Restriction Enzymes are used to cut DNA at specific places RE’s recognize certain base (ATGC)
sequences and snip at that location The fragments are then separated using
Electrophoresis Light chunks move faster
The fragments are exposed to radioactive probes that attach to repeating base sequences only a small % of RFLP’s are “lit up”
Copyright 2007 John Sayles
Example of a RFLP
A Restriction Enzyme:
RFLP, w/probe:
Copyright 2007 John Sayles
Tandem Repeats
The probed chunks of DNA contain tandem repeats … GACTGACTGACTGACTGACT… = [GACT]5
The commonness of these tandem repeats is known a TR might occur in 10% of the population
By looking for several known TR’s we can narrow likelihood of that combination Multiply % commonness of each TR
Copyright 2007 John Sayles
An Electrophoresis Gel
Each sample contains many DNA fragments, but only the RFLP’s exposed tothe radioactive probes of repeating TR’s will show up as stripes on the exposed electrophoresis gel.
Negatively charged DNA fragments are attracted to the positive charge onthe right side of the gel. Shorter, lighter DNA fragments travel faster.
Copyright 2007 John Sayles
Probability Analogy
Blood type O was found at a crime scene The suspect is type O, but so is 50% of the population Suspect is not excluded, but not proven guilty either
Bruno Magli shoe prints were found at the crime scene The suspect owns Bruno Magli’s, like 2% of the
population The Bruno Magli’s are size 12’s
The suspect is size 12, like 10% of the population The % of the population with all three is
50% x 2% x 10% = 0.1% of population = 1 of 1,000
Calculating TR possible matches in population
3 different TR identified in sampleX = 10% in populationY = 5% in populationZ = 25% in population
To determine the chance of someone else in population that has this combination of TR just change % into decimal then multiply all together
Calculating TR possible matches in population
X = 10% = .10 Y = 5% = .05 Z = 25% = .25
(.10)(.05)(.25) = .00125 = .125% chance
Or 1 person in 1000 would match TR
Copyright 2007 John Sayles
Gel Used in CourtIn a rape case, DNA was tested from: semen removed from the victim (EVIDENCE #2); semen left on the victim's clothing (EVIDENCE #1); the DNA of the victim herself (VICTIM) to be sure that
the DNA didn't come from her cells; DNA from two suspects (SUSPECT #1, SUSPECT
#2); a set of DNA fragments of known and decreasing
length (MARKER). They provide a built-in ruler for measuring the exact distance that each fragment travels.
the cells of a previously-tested person to be sure the probes are performing properly (CONTROL).
Who’s guilty? Who’s not guilty? (ie, who’s excluded?) Who’s not excluded? What more would you need to convict suspect 1?
Copyright 2007 John Sayles
RFLP Review
Restriction Enzymes are used to cut DNA at specific places RE’s recognize certain base (ATGC)
sequences and snip at that location The fragments are then raced using
Electrophoresis Light chunks move faster
The fragments are exposed to radioactive probes that attach to repeating base sequences
Copyright 2007 John Sayles
The Clinton Case
A sample from the “blue dress” was compared to a DNA sample collected from President Clinton
7 different RFLP’s were examinedno expense was spared
The odds of that combination of RFLP’s was 1 in 7.8 trillionie, 1 person on 1,000 Earths had that
combination. (see text, page 322)
Copyright 2007 John Sayles
7 RFLP “markers” examined
The Restriction Enzyme used
“K” = Known sample
“Q” = Questioned sample#3243 is the Blue Dress
1 in 7.87 trillion Caucasians has this combination of markers
Document from www.thesmokinggun.com
Copyright 2007 John Sayles
The Simpson Case
The Unlucky Sock Found in OJ’s house Who’s blood is it? Who’s blood isn’t it? Would you convict on
this alone? How much more
evidence would you need?
DNA Evidence in the O. J. Simpson Trial
Copyright 2007 John Sayles
PCR DNA Analysis
Polymerase Chain Reaction Uses DNA polymerase enzyme to
amplify DNA in small samplesCan start with a nanogram sample
Can double DNA every two minutesBillion-fold increase in 1 hourFully automated, inexpensive
Copyright 2007 John Sayles
STR DNA Analysis
Short Tandem Repeats Same idea as RFLP analysis, but with
shorter DNA segments Better than RFLP
works with much smaller sample less susceptible to damage or decomposition
effects FBI’s CODIS use 13 STR loci as basis for
its analysis technique
top related