Analysis of rare variants for population-level data is becoming a more common component of genomic research. Whether using exome chips, whole-exome sequencing, or even whole-genome…

1. Website: www.DRPUSoftware.com E-Mail: [email protected] Website: www.DRPUSoftware.com E-Mail: [email protected] The vCard or virtual business card is used…

1. Website: www.DRPUSoftware.com E-Mail: [email protected] Website: www.DRPUSoftware.com E-Mail: [email protected] If you want to add your excel file contacts…

Slide 1IHWG Workshop Data Tools for HLA Sequence Slide 2 http://www.ncbi.nlm.nih.gov/sra Slide 3 Growth Slide 4 Scope Repository of raw reads from next generation sequencing…

Slide 1 SMART/FHIR Genomic Resources An overview... For latest see http://smartgenomics.wikispaces.com/Clinical+Genomics+Presentation Slide 2 Change Log Made a few changes…

Slide 1 Vanderbilt Center for Quantitative Sciences Summer Institute Sequencing Analysis (DNA) Yan Guo Slide 2 Slide 3 Alignment ATCGGGAATGCCGTTAACGGTTGGCGT Reference genome…

SMART/FHIR Genomic Resources SMART/FHIR Genomic Resources An overview... For latest see http://smartgenomics.wikispaces.com/Clinical+Genomics+Presentation Possible names:…

SMART/FHIR Genomic Resources SMART/FHIR Genomic Resources An overview... Possible names: geneticSummaryAnalysis TODO: change PhenotypeAnalysis to something less confusing…