#1 Lecture 1(1)

7/27/2019 #1 Lecture 1(1)

1/26

BIOL4320: Molecular Biology

INSTRUCTORName: Sang-Hyuk Chung, Ph.D.E-mail: [email protected]: 832-842-8181Fax: 713-743-0634Office: SERC, Rm3008

7/27/2019 #1 Lecture 1(1)

2/26

Textbook

Authors:Jocelyn E. Krebs,

Elliott S. Goldstein,Stephen T. KilpatrickPublisher:Jones and Bartlett Learning

Burlington, MA

7/27/2019 #1 Lecture 1(1)

3/26

Class & Course Rules

1.

Turn off cell phones during class and exam.

2. Attend all class sessions & read covered chapters.3. There will be 4 exams and a final. The lowest of 4 exam scores

will be dropped and each exam will account for 20% of totalgrade. The final will be comprehensive and account for 40% ofgrade.

4. Academic honesty policy: Cheating could result in receiving azero for an examor a grade of F for the course.

5. Lecture slides will be uploaded in Blackboard.

7/27/2019 #1 Lecture 1(1)

4/26

Molecular Biology

Warren Weaver coined the term in 1938 to describe a researchapproach in which physics and chemistry are used to address

fundamental biological problems.

(DNA polymerase)

(RNA polymerase)

(RNA polymerase)

(Ribosome)(protein)

(Reverse transcriptase)

Double strand mustbe separated forreplication andtranscription.

7/27/2019 #1 Lecture 1(1)

5/26

Chapter 1

Genes Are DNA

7/27/2019 #1 Lecture 1(1)

6/26

Hereditary Information Is Carried by DNA or RNA

Genome: a sequence of DNA or RNA that provides thecomplete setof hereditary information

Chromosome: a physical unit of the DNA genome Gene: a functional unit of the genome, a sequence of DNA

that encodes an RNA that may encode a protein

Human genome: 23 chromosome pairs

7/27/2019 #1 Lecture 1(1)

7/26

1.2. DNA Is the Genetic Material of Bacteria, Viruses,and Eukaryotic Cells

Transformation

What is the transforming principle?

Protein is a sequence of20amino acids; higher complexity DNA is a sequence of4nucleotides; too simple

Frederick Griffith, 1928

Figure B1.1Read Historical Perspectives.

7/27/2019 #1 Lecture 1(1)

8/26

1.2. DNA Is the Genetic Material ofBacteria, Viruses, and Eukaryotic Cells

! AveryMacLeodMcCartys experimentsdetermined that DNAis the transformingprinciple but not protein (1944).

! DNA purified from S bacteria transformed Rbacteria into S form." Purified material retained transforming

ability after treatment with enzymes thatdegrade protein, RNA, or carbohydrate.

" DNA-degrading enzyme (DNase I)destroyed transforming potential of purifiedmaterial.

7/27/2019 #1 Lecture 1(1)

9/26


Hershey & Chase, 1952

! Phage is a virus that infects bacteria. DNA was labeled with radioactive

phosphorus (32P) and protein withradioactive sulfur (35S).

E. coliwas infected with radio-labeled phage T2. The progeny phage particles

contained ~30% of the original 32Plabel but less than 1% of 35S.

! Some viruses use RNAas the geneticmaterial.

Figure 1.3

7/27/2019 #1 Lecture 1(1)

10/26

Transfection


! When DNA is introduced to eukaryoticcells, they gain a new trait.

! Thimidine kinase (TK) is essential forthymidine biosynthesis#TK-deficientcells die in culture media withoutthymidine; TK-deficient cellstransfected with TK gene can grow inmedia lacking thymidine.

Figure 1.4

7/27/2019 #1 Lecture 1(1)

11/26

1.3. Polynucleotide Chains Have Nitrogenous BasesLinked to a SugarPhosphate Backbone

Base

BaseNucleoside = base + sugar*Nucleotide = base + sugar*+ phosphate*sugar: deoxyribose for DNA

ribose for RNA

Nucleotide

NucleosideChemical moieties for glycosidic bond with 1 carbon on sugar

Chemical moieties for sugar-phosphate backbone (phosphodiester bond)

7/27/2019 #1 Lecture 1(1)

12/26


A polynucleotide is a long chain of nucleotides linked by 5 to 3phosphodiester linkages.

The bases stick out from the backbone. One end of the chain has a

free 5!end and the other endhas a free 3!end.

DNA contains the four bases: Adenine (A) Guanine (G) Cytosine (C) Thymine (T)

RNA has uracil (U) instead ofthymine.

Figure 1.5

7/27/2019 #1 Lecture 1(1)

13/26


Nucleic acids are named for the type of sugar: DNA has 2-deoxyriboseand RNA has 2-ribose (see purple rings below).

RNA contains the four bases: adenine (A), guanine (G), cytosine (C),and uracil (U)

DNA has thymine (T) insteadof uracil.

The only difference betweenuracil and thymine is a methylgroup (CH3) at position C5(seered rings on left).

nucleoside

nucleotide

H3C

1

3

4

61

34

6

H

Glycosidic bond

7/27/2019 #1 Lecture 1(1)

14/26


DNA RNA

Base Nucleoside Nucleotide* Nucleoside Nucleotide#

Adenine Deoxyadenosine Deoxyadenosine-5-triphosphate (dATP)

Adenosine Adenosine-5-triphosphate (ATP)

Guanine Deoxyguanosine Deoxyguanosine-5-

triphosphate (dGTP)

Guanosine Guanosine-5-

triphosphate (GTP)Cytosine Deoxycytidine Deoxycytidine-5-triphosphate

(dCTP)Cytidine Cytidine-5-triphosphate

(CTP)

Thymine Deoxythymidine Deoxythymidine-5-triphosphate (dTTP)

Uracil Uridine Uridine-5-triphosphate

(UTP)*Deoxynucleoside-5-monophosphate (dNMP); deoxynucleoside-5-diphosphate (dNDP)#Nucleoside-5-monophosphate (NMP); nucleoside-5-diphosphate (NDP)

DNA and RNA sequences are shown as the name of the base (i.e, A, G, C, T, or A, G, C, U).

7/27/2019 #1 Lecture 1(1)

15/26

1.4. DNA Is a Double Helix

! James Watson & Francis Crick proposed the double-helix model in1953 based on three pieces of evidence.

X-ray diffraction data collected by Rosalind Franklin & Maurice Wilkinsshowed that the B-formof DNA is a regular helix, making a complete turnevery 34 , with a diameter of ~20 . Since the distance between adjacentnucleotides is 3.4, there must be 10 nucleotides per turn.

The density of DNA suggests that the helix must contain twopolynucleotide chains. The constant diameter of the helix can be explainedif the bases in each chain face inward and are restricted so that a purine isalways paired with a pyrimidine.

Chargaff rule: the proportion of G is always the same as the proportion ofC in DNA, and the proportion of A is always the same as that of T.

7/27/2019 #1 Lecture 1(1)

16/26

G pairs with C and A pairs with T; these are called base pairing. Base pairing is formed by hydrogen bondsbetween bases. G:C pair has three hydrogen bonds and A:T pair has two#G:C pair

is stronger.

Paired bases are said to be complementary. Two strands run in opposite direction: antiparallel.


The sugar-phosphate backbones are onthe outside and carry negative chargeson the phosphate groups.

Bases are positioned inward; they areflat and lie perpendicular to the axis of

the helix#bases are stacked aboveone another (called base-stacking),which forms strong hydrophobicinteractionsbetween bases.Figure 1.6

7/27/2019 #1 Lecture 1(1)

17/26

! The double helix exists in multipleconformations and has amajor(wide)grooveand a minor(narrow) groove.

! B formis the major conformation in cells:10 bp per turn.

! A formis found in some DNA-proteincomplexes: 11 bp per turn. narrower and deeper major groove broader and shallower minor groove similar to RNA double helix

! Z formis formed in solution with highconcentration of positively charged ions. left-handed; the others are right-

handed.


Figure 1.8

7/27/2019 #1 Lecture 1(1)

18/26


! B formis the majorconformation in a cell: 10.5

bp per turn.! A formis found in some

DNA-protein complexes: 11bp per turn.

narrower and deepermajor groove

broader and shallowerminor groove

similar to RNA doublehelix

! Z formis formed in solutionwith high concentration ofpositively charged ions.

left-handed; the othersare right-handed.

7/27/2019 #1 Lecture 1(1)

19/26

1.5. Supercoiling Affects the Structure of DNA

! Supercoiling occurs only in closedDNA with no free ends.! Closed DNA is either circular DNA (prokaryotes) or linear DNA(eukaryotes) in which the ends are anchored to a protein scaffold; they

are not free to rotate.

! DNA topology (overall conformation of DNA) is crucial for its function.! Two strands are interwound and can not be separated without breaking

covalent bonds." Type I topoisomerase: single strand break, do not require ATP" Type II topoisomerase: double strand break, require ATP" Topoisomearses usually remove supercoils.

Gyrase (prokaryote-specific type II topoisomerase) introducesnegative supercoiling.

! Same DNAs can be different topologically. They are calledtopoisomers.

7/27/2019 #1 Lecture 1(1)

20/26


! Linking number (Lk): number of times one strand has to passthrough the other strand for the two strands to be entirely separated;always integer; invariablein closed DNA if there is no break.

! Twist number (Tw): the number of helical turns of one strands! Writhing number (Wr): the number of crossovers of helical axis! Tw and Wr are topologically equivalent; interconvertible without the

breakage of any covalent bondsLk =Tw + Wr

! Negative supercoling isunderwound compared to BDNA and positivesupercoiling is overwound.

! Negative supercoiling istwisting in the oppositedirection to the two strandsand positive supercoiling isin the same direction.

7/27/2019 #1 Lecture 1(1)

21/26


! Linking difference

!Lk = Lk Lk

O

(LkO

(# bp/10) is linking number of relaxed closedDNA) !Lk < 0: negatively supercoiled !Lk > 0: positively supercoiled

! Biological significance of negative supercoiling Negative supercoiling can be converted into untwisting of the double

helix#strand separation is easier Thermophilic bacterial DNAs are positively supercoiled# helps keep the DNA from denaturing at high temperature.

Nucleosomes introduce negative supercoiling in eukaryotes.

7/27/2019 #1 Lecture 1(1)

22/26

Chapter 2

Genes Encode RNAs and Polypeptides

7/27/2019 #1 Lecture 1(1)

23/26

2.10. Several Processes Are Required to Express

the Product of a Gene

DNA consists of two strands; sequence of only one strand is oftenused to indicate DNAs genetic information.(coding/sense strand)

(template/antisense strand)

Common ways to show the sequence of the DNA above:5-ATGCCGTTAGACCGTTAGCGGACCTGAC-3 or

ATGCCGTTAGACCGTTAGCGGACCTGAC

Figure 2.12

7/27/2019 #1 Lecture 1(1)

24/26



Genetic information flow: DNA#RNA#protein There are multiple forms of RNA.

RNA that produces protein iscalled messenger RNA (mRNA).

Other types of RNA that do notproduce a protein includeribosomal RNA (rRNA), transferRNA (tRNA), and micro RNA(miRNA).

An mRNA consists of an 5 UTR (untranslated region), coding region,and 3 UTR#a gene is usually longer than the sequence encoding aprotein.

Figure 2.13

7/27/2019 #1 Lecture 1(1)

25/26



! Bacterial transcription andtranslation occur in the sameplace.

! Bacterial translation starts beforetranscription is complete.

RNA polymerase

Figure 2.14

7/27/2019 #1 Lecture 1(1)

26/26



! Eukaryotic transcription occurs in thenucleus and translation in thecytoplasm.

! Eukaryotic genes contain introns andexons; intron-containing RNA is pre-

mRNA and introns are removed bysplicing.

! Mature mRNA is transported to thecytoplasm and translated.

! Eukaryotic gene expression has moresteps for regulation.

Figure 2.15

#1 Lecture 1(1)

Documents

#1 Lecture 1(1)