Slayt 1 - International University of Sarajevo · All living things share a common ancestor. We can draw a Tree of Life to show how every species is related. Evolution is the process

HUM 101 Spring semester 2013-2014

Lecturer: Faruk Berat AKCESME (MSc)

Week III

Origin of species?

Origin of Human?

TIME LINE

for the last 3.6 billion years, simple cells (prokaryotes);for the last 3.4 billion years, cyanobacteria performing photosynthesis;for the last 2 billion years, complex cells (eukaryotes);for the last 1 billion years, multicellular life;for the last 600 million years, simple animals;for the last 550 million years, bilaterians, animals with a front and a back;for the last 500 million years, fish and proto-amphibians;for the last 475 million years, land plants;for the last 400 million years, insects and seeds;for the last 360 million years, amphibians;for the last 300 million years, reptiles;for the last 200 million years, mammals;for the last 150 million years, birds;for the last 130 million years, flowers;for the last 60 million years, the primates,for the last 20 million years, the family Hominidae (great apes);for the last 2.5 million years, the genus Homo (human predecessors);for the last 200,000 years, anatomically modern humans.

ASSUMPTIONS!

All living things share a common

ancestor.

We can draw a Tree of Life to

show how every species is

related.

Evolution is the process by which

one species gives rise to another

and the Tree of Life grows

• The theory of Evolution deals with how Evolution

happens. Our understanding of this process is always

changing.

Science?

Ideology?

Belief?

Source?

Fact?

Part 1: How was evolution discovered?

Discussion: Should Creationism and Evolution be given “equal time” in science lessons?

Part 2: How does evolution work?

Part 3: What is the evidence for evolution?

Fixed Species!

Evolving species!

Jean Baptiste de Lamarck

• Around 1800, scientists began to wonder whether species could change or transmute.

• Lamarck thought that if an animalacquired a characteristic during itslifetime, it could pass it onto its offspring.

• Hence giraffes got their long necks through generations of straining to reach high branches.

William Smith, his geology map & some of his fossil specimens

At about the same time, geologists like William Smith were mapping the rocks and fossils of Britain. He and others showed that different species existed in the past compared with today.

Voyage of the Beagle

• From 1831-1836, ayoung naturalist calledCharles Darwin touredthe world in HMSBeagle.

• He was dazzled by theamazing diversity of life and started to wonder how it mighthave originated

• In his Origin of Species, published in 1859, Darwinproposed how one speciesmight give rise to another.

• Where food was limited, competition meant that onlythe fittest would survive.

• This would lead to the natural selectionof the best adapted individuals and eventually the evolution of a new species.

Darwin in 1860

Natural Selectionexplains adaption

Mendel and his peas• From 1856-63, a monk called Gregor

Mendel cultivated 29,000 pea plants

to investigate how evolution worked

i.e., how characteristics were passed

down the generations.

• He figured out the basic principles of

genetics. He showed that offspring

received characteristics from both

parents, but only the dominant

characteristic trait was expressed.

Mendel’s work only came to light in

1900, long after his death

• The genetic make-up of

an organism is known as

its genotype.

• An organism’s genotype

and the environment in

which it lives determines

its total characteristic traits

i.e. its phenotype.

PhenotypeGenotype

Watson and Crick and their model of DNA

DNA replication

• The double-helix

structure of DNA

was discovered

in 1953.

• This showed how

genetic information

is transferred from

one cell to another

almost without error.

Types of mutation

Mutant fruitfly

• However, occasional mutations or copying errorscan and do occur when DNA is replicated.

• Mutations may be causedby radiation, viruses, orcarcinogens.

• Mutations are rare and often have damaging effects. Consequently organisms have special enzymes whose job it is to repair faulty DNA.

• Nevertheless, some

mutations will persist and

increase genetic variation

within a population.

• Variants of a particular

gene are known as alleles.

For example, the one of

the genes for hair colour

comprises brown/blonde

alleles.

?

• Mutant alleles spread through a population by sexual reproduction.

• If an allele exerts a harmful effect, it will reduce the ability of theindividual to reproduce and the allele will probably be removed from the population.

• In contrast, mutants with favorableeffects are preferentially passed on

Selection of dark gene

Any mutation with favorable effects ?

Discussion based on the current information of molecular biology

Lets look what evolutionist present as a evidance!

DNA for Information

TransferATP for Energy

Transfer

• Does basic similarity of all living things suggeststhat they evolved from a single common ancestor?

• As we have already seen, all living things passon information from generation to generationusing the DNA molecule.

• All living things also use a moleculecalled ATP to carryenergy around theorganism.

HUMAN CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGACHIMPANZEE CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGAGORILLA CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA

• If evolution is true then we might also expect that closely related organisms will be more similar to one another than moredistantly related organisms.

• Comparison of the human genetic code with that of other organisms show that chimpanzees are nearly genetically identical (differ by less than 1.2%) whereas the mouse differs by ≈15%.

Genetic code of chimps and gorillas is almost identical to humans

What about chickens ? Genetically identical according to what method? What about the method validity?

Human and Gorilla

• Similar comparisons can be madebased on anatomical evidence.

• The skeleton of humans andgorillas are very similar suggestingthey shared a recent common ancestor, but very different from themore distantly relatedwoodlouse…

yet all have a commonshared characteristic: bilateral symmetry

Woodlouse

The pentadactyl limb is ancestral to allvertebrates…

but modified for different uses(how does these limbs modified???)

dinosaurs humansbacteriaorigins

en.wikipedia.org/wiki/Image:Eopraptor_sketch5.png© World Health Org.

© NASA

complex cells

Some scientist thinks “The fossil record shows a sequence from simple bacteria to more complicated organisms through time “They consider them as provides the most compelling evidence for evolution.

Archaeopteryx

• Many fossils show a cleartransition from one species,or group, to another.

• Archaeopteryx was found in Germany in 1861. It share many characteristics with both dinosaurs andbirds.

• It provides good evidencethat birds arose fromdinosaur ancestors

Marsupials • Geographic spread of organisms also tells of their past evolution.

• Marsupials occur in two populations today in the Americas and Australia.

• This shows the groupevolved before thecontinents drifted apart

From geography to evolution??or From evolution to geography??

PRO-THEORY OF EVOLUTION / ANTI-CREATIONISM

> [2] Falk, Dean. Braindance, NY: Henry Holt and Co., 1992.

[5] Growlett, John. Ascent to Civilization, NY: Alfred A. Knopf, 1984.

[8] Howell, F. Clark. Early Man, NY: Time Life Books, 1973.

[9] Johanson, David, and Maitland, Edy. Lucy, NY: Simon and Schuster, 1981.

[10] Johanson, David, and Shreeve, James. Lucy's Child, NY: William Morrow and Co., 1989.

[12] Leakey, Richard, and Lewin, Roger. Origins, NY: E.P. Dutten, 1977.

> [13] Leakey, Richard, and Lewin, Roger. Origins Reconsidered, NY: Doubleday, 1992.

> [14] Lewin, Roger. Bones of Contention, NY: Simon and Schuster, 1987.

> [15] Lewin, Roger. In the Age of Mankind, Washington, D.C.: Smithsonian Books, 1988.

[20] Pfieffer, John. The Emergence of Man, NY: Harper and Row, 1969.

[23] Wendt, Herbert. From Ape to Man, NY: The Bubbs Merril Co., 1972.

ANTI-THEORY OF EVOLUTION / PRO-CREATIONISM

[1] Bliss, Richard. Origins: Creation or Evolution? El Cajon, CA: Master Books, 1988.

[3] Gish, Duane T. The Amazing Story of Creation from Science and the Bible El Cajon, CA: Institute for Creation Research, 1990.

[4] Graham, Keith, et al. Biology Pensacola, FL: A Beka Book Publications, 1986.

[7] Ham, ken, et. al. The Answers book, El Cajon, CA: Master Books, 1992.

> [11] Johnson, Phillip. Darwin on Trial, Washington, D.C.: Regnery Gateway, 1991.

> [16] McDowell, Josh and Stewart, Don. Reasons Skeptics Should Consider Christianity, San Bernardino, CA: Here's Life, 1981.

[17] Moreland, J.P. Scaling the Secular City, Grand Rapids: Baker Book House, 1987.

> [18] Morris, Henry M. Evolution and the Modern Christian, Phillipsburg, NJ: Presbyterian and Reformed Publishing Co., 1988.

[19] Morris, Henry M. The Twilight of Evolution, Grand Rapids: Baker Book House, 1967.

> [22] Ranganathan, B.G. Origins?, Carlisle, PA: The Banner of Truth Trust, 1988.

[24] Whitcomb, John. The Early Earth, Grand Rapids: Baker Book House, 1986.

NEUTRAL REFERENCE WORKS

[6] Grzimek, Bernhard, ed. Grzimek's Animal Life Encyclopedia, Vol. 10, NY: Van Nostrand Reinhold Co., 1984.

[21] Pinchot, Roy, ed. The Human Body, "The Skeleton", NY: Torster Books, 1985.

The number in the [ ]'s after each quote in the paper corresponds to the number in the [ ]'s above from which the quote was taken. Quotes with no [ ]'s are lost

references but should be considered reliable.

">" indicates most recommended for further study. Pro-evolution books are recommended for how well they reveal the actual state of their evidence.