Top Banner
Tumor Biology and Immunology Inhibition of EphB4Ephrin-B2 Signaling Reprograms the Tumor Immune Microenvironment in Head and Neck Cancers Shilpa Bhatia 1 , Ayman Oweida 1 , Shelby Lennon 1 , Laurel B. Darragh 1 , Dallin Milner 1 , Andy V. Phan 1 , Adam C. Mueller 1 , Benjamin Van Court 1 , David Raben 1 , Natalie J. Serkova 2 , Xiao-Jing Wang 3,4 , Antonio Jimeno 5 , Eric T. Clambey 2 , Elena B. Pasquale 6 , and Sana D. Karam 1 Abstract Identifying targets present in the tumor microenvironment that contribute to immune evasion has become an important area of research. In this study, we identied EphB4ephrin-B2 signaling as a regulator of both innate and adaptive compo- nents of the immune system. EphB4 belongs to receptor tyrosine kinase family that interacts with ephrin-B2 ligand at sites of cellcell contact, resulting in bidirectional signaling. We found that EphB4ephrin-B2 inhibition alone or in com- bination with radiation (RT) reduced intratumoral regulatory T cells (Tregs) and increased activation of both CD8 þ and CD4 þ Foxp3 T cells compared with the control group in an orthotopic head and neck squamous cell carcinoma (HNSCC) model. We also compared the effect of EphB4ephrin-B2 inhibition combined with RT with combined anti-PDL1 and RT and observed similar tumor growth suppression, particu- larly at early time-points. A patient-derived xenograft model showed reduction of tumor-associated M2 macrophages and favored polarization towards an antitumoral M1 phenotype following EphB4ephrin-B2 inhibition with RT. In vitro, EphB4 signaling inhibition decreased Ki67-expressing Tregs and Treg activation compared with the control group. Overall, our study is the rst to implicate the role of EphB4ephrin-B2 in tumor immune response. Moreover, our ndings suggest that EphB4ephrin-B2 inhibition combined with RT repre- sents a potential alternative for patients with HNSCC and could be particularly benecial for patients who are ineligible to receive or cannot tolerate anti-PDL1 therapy. Signicance: These ndings present EphB4ephrin-B2 inhibition as an alternative to anti-PDL1 therapeutics that can be used in combination with radiation to induce an effective antitumor immune response in patients with HNSCC. Introduction Numerous clinical trials are testing the benets of immuno- therapy in human cancer, including head and neck squamous cell carcinoma (HNSCC). The objective response rate is 6% to 20% (14) and the vast majority of patients demonstrate either innate or adaptive resistance to immunotherapy. Clinical trial study attempts at simply combining more immune checkpoint inhibitors have also proven disappointing due to increased tox- icity to patients and lack of additional benet (NCT02205333). In orthotopic mouse models of HNSCC, we have recently demon- strated that tumor regrowth occurs even after combination treat- ment with anti-PDL1 antibody and radiation therapy (RT; ref. 5). Concerted efforts to understand the factors involved in resis- tance to immunotherapy within the tumor microenvironment (TME) have led to the identication of T regulatory cells (Tregs) and tumor-associated macrophages (TAM) as key regulators of tumor growth and therapeutic response. Our laboratory recently showed an increase in the Treg population during tumor regrowth phase of anti-PDL1 antibody treatment combined with RT in preclinical HNSCC mouse models (5). Studies have shown a correlation between high Treg/TAM inltrates and poor survival outcomes (6, 7). Targeted depletion of Tregs or TAMs has been reported to improve the response to chemotherapy and check- point inhibitors in different tumor models (8, 9). However, data from clinical trials suggest lack of efcacy following treatment with Treg-targeted immunotherapies such as anti-CTLA-4 (10). Therefore, there is an unmet need for alternate approaches that can both target immunosuppressive cell populations within the TME and enhance therapeutic benet. EphB4 belongs to the largest family of receptor tyrosine kinases and upon interaction with the ephrin-B2 ligand has been reported to regulate neuronal migration, bone remodeling, angiogenesis, cancer progression, and metastasis (11). EphB4 and ephrin-B2 expression is downregulated in vast majority of adult normal 1 Department of Radiation Oncology, University of Colorado Denver, Anschutz Medical Campus, Aurora, Colorado. 2 Department of Anesthesiology, University of Colorado Denver, Anschutz Medical Campus, Aurora, Colorado. 3 Department of Pathology, University of Colorado Denver, Anschutz Medical Campus, Aurora, Colorado. 4 Veterans Affairs Medical Center, VA Eastern Colorado Health Care System, Aurora, Colorado. 5 Division of Medical Oncology, Department of Medicine, University of Colorado Denver, Anschutz Medical Campus, Aurora, Colorado. 6 Cancer Center, Sanford Burnham Prebys Medical Discovery Institute, La Jolla, California. Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/). Corresponding Author: Sana D. Karam, University of Colorado Denver, 1665 Aurora Court, Suite 1032, Aurora, CO 80045. Phone: 720-848-0100; Fax: 720- 848-0238; E-mail: [email protected] doi: 10.1158/0008-5472.CAN-18-3257 Ó2019 American Association for Cancer Research. Cancer Research Cancer Res; 79(10) May 15, 2019 2722 on December 5, 2020. © 2019 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from Published OnlineFirst March 20, 2019; DOI: 10.1158/0008-5472.CAN-18-3257
15

Inhibition of EphB4 Ephrin-B2 Signaling Reprograms the Tumor … · Tumor Biology and Immunology Inhibition of EphB4–Ephrin-B2 Signaling Reprograms the Tumor Immune Microenvironment

Aug 21, 2020

Download

Documents

dariahiddleston
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: Inhibition of EphB4 Ephrin-B2 Signaling Reprograms the Tumor … · Tumor Biology and Immunology Inhibition of EphB4–Ephrin-B2 Signaling Reprograms the Tumor Immune Microenvironment

Tumor Biology and Immunology

Inhibition of EphB4–Ephrin-B2 SignalingReprograms the Tumor ImmuneMicroenvironment in Head and Neck CancersShilpa Bhatia1, Ayman Oweida1, Shelby Lennon1, Laurel B. Darragh1, Dallin Milner1,Andy V. Phan1, Adam C. Mueller1, Benjamin Van Court1, David Raben1, Natalie J. Serkova2,Xiao-Jing Wang3,4, Antonio Jimeno5, Eric T. Clambey2, Elena B. Pasquale6, andSana D. Karam1

Abstract

Identifying targets present in the tumor microenvironmentthat contribute to immune evasion has become an importantarea of research. In this study, we identified EphB4–ephrin-B2signaling as a regulator of both innate and adaptive compo-nents of the immune system. EphB4 belongs to receptortyrosine kinase family that interacts with ephrin-B2 ligand atsites of cell–cell contact, resulting in bidirectional signaling.We found that EphB4–ephrin-B2 inhibition alone or in com-bination with radiation (RT) reduced intratumoral regulatoryT cells (Tregs) and increased activation of both CD8þ andCD4þFoxp3� T cells compared with the control group in anorthotopic head and neck squamous cell carcinoma (HNSCC)model. We also compared the effect of EphB4–ephrin-B2inhibition combined with RT with combined anti-PDL1 andRT and observed similar tumor growth suppression, particu-larly at early time-points. A patient-derived xenograft model

showed reduction of tumor-associated M2 macrophages andfavored polarization towards an antitumoral M1 phenotypefollowing EphB4–ephrin-B2 inhibition with RT. In vitro,EphB4 signaling inhibition decreased Ki67-expressing Tregsand Treg activation compared with the control group. Overall,our study is the first to implicate the role of EphB4–ephrin-B2in tumor immune response. Moreover, our findings suggestthat EphB4–ephrin-B2 inhibition combined with RT repre-sents a potential alternative for patients with HNSCC andcould be particularly beneficial for patients who are ineligibleto receive or cannot tolerate anti-PDL1 therapy.

Significance: These findings present EphB4–ephrin-B2inhibition as an alternative to anti-PDL1 therapeutics that canbe used in combination with radiation to induce an effectiveantitumor immune response in patients with HNSCC.

IntroductionNumerous clinical trials are testing the benefits of immuno-

therapy in human cancer, including head and neck squamous cellcarcinoma (HNSCC). The objective response rate is 6% to20% (1–4) and the vast majority of patients demonstrate eitherinnate or adaptive resistance to immunotherapy. Clinical trialstudy attempts at simply combining more immune checkpointinhibitors have also proven disappointing due to increased tox-

icity to patients and lack of additional benefit (NCT02205333). Inorthotopic mouse models of HNSCC, we have recently demon-strated that tumor regrowth occurs even after combination treat-ment with anti-PDL1 antibody and radiation therapy (RT; ref. 5).

Concerted efforts to understand the factors involved in resis-tance to immunotherapy within the tumor microenvironment(TME) have led to the identification of T regulatory cells (Tregs)and tumor-associated macrophages (TAM) as key regulators oftumor growth and therapeutic response. Our laboratory recentlyshowed an increase in the Treg population during tumor regrowthphase of anti-PDL1 antibody treatment combined with RT inpreclinical HNSCC mouse models (5). Studies have shown acorrelation between high Treg/TAM infiltrates and poor survivaloutcomes (6, 7). Targeted depletion of Tregs or TAMs has beenreported to improve the response to chemotherapy and check-point inhibitors in different tumor models (8, 9). However, datafrom clinical trials suggest lack of efficacy following treatmentwith Treg-targeted immunotherapies such as anti-CTLA-4 (10).Therefore, there is an unmet need for alternate approaches thatcan both target immunosuppressive cell populations within theTME and enhance therapeutic benefit.

EphB4 belongs to the largest family of receptor tyrosine kinasesand upon interactionwith the ephrin-B2 ligand has been reportedto regulate neuronal migration, bone remodeling, angiogenesis,cancer progression, and metastasis (11). EphB4 and ephrin-B2expression is downregulated in vast majority of adult normal

1Department of Radiation Oncology, University of Colorado Denver, AnschutzMedical Campus, Aurora, Colorado. 2Department of Anesthesiology, Universityof Colorado Denver, Anschutz Medical Campus, Aurora, Colorado. 3Departmentof Pathology, University of Colorado Denver, AnschutzMedical Campus, Aurora,Colorado. 4Veterans Affairs Medical Center, VA Eastern Colorado Health CareSystem, Aurora, Colorado. 5Division of Medical Oncology, Department ofMedicine, University of Colorado Denver, Anschutz Medical Campus, Aurora,Colorado. 6Cancer Center, Sanford BurnhamPrebys Medical Discovery Institute,La Jolla, California.

Note: Supplementary data for this article are available at Cancer ResearchOnline (http://cancerres.aacrjournals.org/).

Corresponding Author: Sana D. Karam, University of Colorado Denver, 1665Aurora Court, Suite 1032, Aurora, CO 80045. Phone: 720-848-0100; Fax: 720-848-0238; E-mail: [email protected]

doi: 10.1158/0008-5472.CAN-18-3257

�2019 American Association for Cancer Research.

CancerResearch

Cancer Res; 79(10) May 15, 20192722

on December 5, 2020. © 2019 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst March 20, 2019; DOI: 10.1158/0008-5472.CAN-18-3257

Page 2: Inhibition of EphB4 Ephrin-B2 Signaling Reprograms the Tumor … · Tumor Biology and Immunology Inhibition of EphB4–Ephrin-B2 Signaling Reprograms the Tumor Immune Microenvironment

tissues, even as early as postnatal development but its overexpres-sion has been implicated during malignant transformation(12–14). Thus, targeting of EphB4–ephrin-B2 represent a thera-peutic strategy that has survived the test of clinical trials. It has beenshown to be safe in multiple clinical trials (NCT01642342,NCT02717156, NCT02767921) with minimal to no toxicity (15),likely due to low levels of expression in normal tissue. In ourlaboratory, we have previously shown that EphB4–ephrin-B2 inhi-bition indifferent patient-derived xenograft (PDX)HNSCCmodelsenhances tumor response to RT (16) as well as to combined EGFRinhibition and RT (17). Although direct evidence that implicatesEphB4–ephrin-B2 interaction in the cancer-related immuneresponse is lacking, multiple reports have documented that Eph/ephrin gene family members modulate immune cell processes ininflammatory models, such as arteriosclerosis and wound heal-ing (18–20). Eph-ephrin interactions have also been reported toregulate monocyte adhesion to the blood vessel wall (18), trans-endothelial migration (20, 21), T-cell activation, proliferation andapoptosis (22, 23), and mobilization of hematopoietic cells frombone marrow sinusoids (24).

In this study, we sought to determine whether inhibition ofEphB4–ephrin-B2 interaction can induce an antitumor immuneresponse in HNSCC. Our data show that EphB4 is expressed inHNSCC tumor and stromal cells. Based on these findings, and therole of Eph/ephrins in immune processes in inflammatory mod-els, we hypothesized that EphB4–ephrin-B2 interaction regulatesthe tumor immune microenvironment by sustaining Tregs andTAMs, thus negatively impacting the ability of CD8þ T cells toinduce an antitumor response. We demonstrate that targetedblockade of EphB4–ephrin-B2 signaling results in a significanttumor growth retardation and remodeling of the immune land-scape in a HNSCC orthotopic immunocompetent model and in aPDX model. We also compared the relative efficacy of EphB4–ephrin-B2 inhibition combined with RT (which is a mainstay forthe treatment of HNSCC) to the anti-PDL1 therapy and RTcombination. We observed a similar tumor growth inhibitionresponse with both treatments at early time-point. In conclusion,our study is the first report providing insight into a novel role ofEphB4–ephrin-B2 interaction in modulating the tumor immunemicroenvironment in HNSCC.

Materials and MethodsCell culture and reagents

The murine Moc2 cell line was obtained from Dr. RavindraUppaluri (Dana-Farber Cancer Institute, MA) and the Ly2 cell linewas obtained from Dr. Nadarajah Vigneswaran (University ofTexas Health Science Center, TX). Ly2 cells were cultured inDMEM-F12 and Moc2 cells in IMDMmedium. The medium wassupplemented with 10% FBS and 1% primocin and cells werecultured at 37�C in a 5% CO2 incubator. All the cell lines used inthis study were within 12 passages and were tested for mycoplas-ma contamination. The short tandem repeat (STR) analysis wasperformed as a method of authentication wherever applicable.The soluble EphB4 extracellular domain fused to human serumalbumin (sEphB4–HSA; ref. 16) was used to inhibit EphB4–ephrin-B2 interaction in a PDX immunocompromised mousemodel. The sEphB4–HSA protein was provided by Vasgene Ther-apeutics, Inc. For immunocompetent mouse models, a plasmidencoding the 15 amino acids long TNYL-RAW peptide fused withthe Fc portion of human IgG1 (TNYL-RAW-Fc, an EphB4 antag-

onist) was used to block EphB4–ephrin-B2 signaling (25).pcDNA3 plasmid was used as a control. The plasmids wereobtained from Dr. Elena Pasquale's lab (Sanford BurnhamPrebys Medical Discovery Institute, CA). The PEGylated formof TNYL-RAW peptide was obtained from Anaspec for in vitrostudies involving T cells (26).

HNSCC patient samplesExcess, nondiagnostic fresh tumor tissue was collected from

patients with HNSCC with informed consent at the University ofColorado Hospital in accordance with the protocol approved bythe ColoradoMultiple Institutional Review Board (COMIRB #08-0552). Following tumor resection, tumor tissueswere analyzedbya clinical pathologist and non-necrotic sections were used forresearch purposes including establishment of PDX model.

In vivo modelsAll mice were handled and euthanized in accordance with the

ethics guidelines and conditions set and overseen by the Univer-sity of Colorado, AnschutzMedical Campus Animal Care andUseCommittee. The study has been approved by the InstitutionalAnimal Care and Use Committee. For immunocompromisedmouse model studies, female athymic nude mice (5–6 weeksold, n ¼ 5–7 per group) were used. The HNSCC PDX tumorsCUHN013 and CUHN004 (F8-F16 generation) were obtainedfromDr. Antonio Jimeno's lab (University of Colorado, AnschutzMedical Campus, Aurora, CO). Tumor implantations were per-formed as described earlier (16). When tumor volumes reachedapproximately 50 to 150 mm3, mice were randomized into fourgroups (i) PBS, (ii) sEphB4-HSA, (iii) PBSþRT, and (iv) sEphB4-HSAþRT. Mice were either injected with PBS or with a 20 mg/kgdose of sEphB4-HSA (three times/week) and/or subjected to RT(5 Gy/fraction � 4 fractions) as described earlier (16).

For iron oxide imaging studies, superparamagnetic iron oxide(SPIO) nanoparticles were generated (27). The detailed protocolfor MRI as reported by Serkova and colleagues (27) was followed.MR imaging was performed before treatment and 96 hours afterthe last dose of RT. Final images were processed with ParaVi-sionsoftware (Bruker Biospin).

For immunocompetent mouse model studies, 5- to 6-week-old female BALB/c mice (n ¼ 7–8; Charles River Laboratories)or C57BL/6 mice (n ¼ 7–8; Jackson Laboratories) were used.Tumor cell inoculation was performed as described earlier (28).Mice were randomized at day 4 to 5 posttumor inoculation(tumor volume � 50 mm3) to receive either pcDNA3 controlplasmid or TNYL-RAW-Fc plasmid (20 mg in �2 mL of PBS) viahydrodynamic injection (24) and tumor size was measuredbiweekly as described earlier (28). For combination therapystudies, mice were randomized into IgGþpcDNA3 control,IgGþTNYL-RAW-Fc, anti-PDL1þTNYL-RAW-Fc, RTþIgGþpcDNA3,RTþIgGþTNYL-RAW-Fc, RTþanti-PDL1þpcDNA3, and RTþanti-PDL1þTNYL-RAW-Fc. IgG2b control (referred as IgG; BioXcell)and anti-PDL1 (BioXcell) were administered on day 7 to 9 aftertumor inoculation by intraperitoneal method at a dose of 10mg/kg twice a week throughout the course of experiment. RTwas administered at a single dose of 10 Gy as describedearlier (28). Plasmid DNA treatment was initiated on day 5after tumor inoculation and administered as a single dose.Tumor tissue was harvested at the time of sacrifice and eitherfixed in 10% neutral buffered formalin or flash-frozen forfurther analysis.

EphB4–Ephrin-B2 Blockade Remodels Immune TME

www.aacrjournals.org Cancer Res; 79(10) May 15, 2019 2723

on December 5, 2020. © 2019 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst March 20, 2019; DOI: 10.1158/0008-5472.CAN-18-3257

Page 3: Inhibition of EphB4 Ephrin-B2 Signaling Reprograms the Tumor … · Tumor Biology and Immunology Inhibition of EphB4–Ephrin-B2 Signaling Reprograms the Tumor Immune Microenvironment

Immune cell depletion studiesCD8 T-cell depletion was performed using an anti-CD8 anti-

body (Clone 53-6.7, 10mg/kg, i.p.; BioXcell) and the correspond-ing rat IgG1 isotype was used as a control. The antibodies wereadministered 1 week prior to tumor implantation and werecontinued once a week for 3 weeks after tumor implantation.TNYL-RAW-Fc or pcDNA3 treatmentwas performedonday4 aftertumor implantation because of the aggressive nature of tumormodels used in this study. Flow cytometry was performed toconfirm systemic depletion of CD8þ T cells by using an anti-CD8antibody clone that do not compete with clone 53-6.7 used fordepletion experiment.

Flow cytometryTumors and spleens were processed into single-cell suspen-

sions forflowcytometric analysis as described earlier (28) and1 to2 � 106 live cells were plated in a 96-well plate followed byblocking with anti-CD16/32 antibody. For analysis of immunecells, cytokines, and phospho-STAT3 marker, the following con-jugated antibodies were used: Alexa Fluor 700-CD45 (1:50, Clone30-F11; catalog no. 56-0451-82; eBioscience), BUV737-CD11b(1:100, CloneM1/70; catalog no. 564443; BDBiosciences), FITC-F4/80 (1:100, Clone BM8; catalog no. 123108; Biolegend),DyLight350-CD3 (1:100, Clone 145-2C11; Novus Biologicals),eFluor450-CD4 (1:100, Clone RM4-5; catalog no. 48-0042-82;eBioscience), APC-eFluor780-CD8 (1:100, Clone 53-6.7; catalogno. 47-0081-82; eBioscience), PECyanine7-IFNg (1:20, CloneXMG1.2; catalog no. 25-7311-82; eBioscience), Ki67-BV605(1:50, Clone 16A8; catalog no. 652413; eBioscience), p-STAT3-PE (1:5, clone 49; p727; catalog no. 558557; eBioscience).

For cytokine release experiments, single cell suspensions wereplated in six-well plates in the presence of monensin (to blockcytokine release) and a cell activation cocktail with Brefeldin tostimulate cytokine production at 37�C for 3.5 to 4 hours. Afterwashes, the cells were stained with surface marker antibodies(1:100 dilution) at room temperature for 30 minutes. Cells werethen resuspended in 100 mL of Cytofix/Cytoperm solution (BDBiosciences) for 20 minutes at 4�C. Following incubation, cellswere washed with 1� Perm/Wash solution (BD Biosciences), andstained with anti-cytokine antibodies at 4�C for 30 minutes. Cellpellets were resuspended in FA3 buffer and samples were runon the YETI cell analyzer. To detect STAT3 phosphorylation(p-STAT3) and Ki67 expression in cultured T cells by flow cyto-metry, single cell suspensions treatedwith preclustered control Fc,20 mg/mL ephrin-B2-Fc, or PEGylated TNYL-RAW (4.5 mg/mL)following treatment with stimulating dose of ephrin-B2-Fc(2.5 mg/mL) for 24 to 48 hours were stained with immune cellsurface markers. This was followed by incubation in 1� lyse/fixbuffer (BD Biosciences) at 37�C for 30minutes. Preclustering wasperformed by incubating Fc proteins with hIgG in the ratio of1:3 at 4�C for 30 minutes in an orbital shaker. Followingwashing with PBS, samples were resuspended in cold perm IIIbuffer (BD Biosciences), incubated on ice for 15 minutes, andstained with p-STAT3 or Ki67 antibodies for 30 minutes atroom temperature. Various controls such as beads only, sam-ples stained with a single antibody, isotype controls, andfluorescence minus-one (FMO) controls were also included.Live cells were gated using Aqua/vi live/dead stain. Stainedcells were run on the YETI Cell Analyzer at the University ofColorado Denver Cancer Flow Cytometry Core. Data wereanalyzed using Kaluza analysis software.

RNA extraction and qPCR analysisTregs and monocytes were harvested from Ly2 tumors using

isolation kits (Stemcell Technologies). Monocytes were treatedwith IL4 (25 ng/mL) to allow differentiation into M2 macro-phages (29, 30). Total RNA was collected from Tregs and macro-phages using RNeasymini prep kits (Qiagen). cDNAwaspreparedas described earlier (28). Aliquots (2 mL) of a 1:2 dilution of thereverse transcription reactions were subjected to quantitative real-time PCR with the following primers using a iQ real time PCRdetection system (BioRad). GAPDH mRNA levels were analyzedas a housekeeping gene for normalization purposes. Similar RNAextraction and qPCR protocol was used to detect mRNA levels ofEPHB4 and EFNB2 in Ly2 tumors in the absence and presence of10 Gy dose of RT.

GAPDH: Forward primer: 50CGTGGAGTCTACTGGCGTCTT30

Reverse primer: 50CGGAGATGATGACCCTTTTGG30

EPHB4: Forward primers: 50GGATCGCATTCAGCCAAAGT30

50GGCACCTGGTTCCACTATCT30

Reverse primers: 50ACTGTCTAAGGCTGTGGCAT30

50CCATTTCAGATCCGCCGTTT30

EFNB2: Forward primer: 50TAAAGACCAAGCAGACAGATGCAC30

Reverse primer: 50GTGATGATGATGACGATGAAGATG30

Mass cytometry (CyTOF)For mass cytometry experiments, tumors were harvested and

digested as described above in the flow cytometry section. Singlecell suspensions were washed with PBS and stained with heavy-metal tagged antibodies according to manufacturer instruc-tions (Fluidigm). The following antibodies were used: CD45-Y89(catalog no. 3089005B), CD3e-Sm152 (catalog no. 3152004B),FoxP3-Gd158 (catalog no. 3158003A), CD4-Nd145 (catalog no.3145002B), CD8a-Er168 (catalog no. 3168003B), CD11b-Nd148(catalog no. 3148003B), F4/80-Nd146 (catalog No. 3146008B),CD11c-Nd142 (catalog no. 3142003B), Ly6G-Pr141, Ly6C-Nd150, ICOS-Yb176 (catalog no. 3176014B), and live-dead-Pt-195. Stained cells were run on the Helios Mass Cytometerat the University of Colorado Denver Cancer Center FlowCytometry Core. Data were analyzed using Kaluza or FlowJoAnalysis software.

ImmunoblottingFor immunoblotting, protein cell lysateswere prepared and ran

onto 10% SDS-PAGE gels followed by transfer to PVDF mem-branes and Western blotting. Blots were probed overnight at 4�Cwith primary antibodies. Anti-p-AKT (1:1,000; catalog no. 4058),anti-AKT (1:1,000; catalog no. 9272), anti-Bcl-XL (1:1,000;catalog no. 2764), anti-cleaved caspase-3 (1:1,000; catalog no.9579) and anti-b-actin antibodies (1:5,000; catalog no. 12262)were purchased from Cell Signaling Technology. Anti-EphB4(clone m265) was provided by Vasgene Therapeutics Inc., orpurchased from R&D Systems (catalog no. AF446). Horseradishperoxidase-conjugated secondary antibodies were obtainedfrom Sigma. For p-EphB4 analysis, CD4þ T cells were isolatedfrom mouse splenocytes using EasySep CD4þ T-cell Isolation Kit(Stemcell Technologies) and seeded in a six-well plate followedbytreatment with preclustered control Fc, ephrin-B2-Fc (20 mg/mL),or PEG-TNYL-RAW-Fc (4.5 mg/mL) with ephrin-B2-Fc (2.5mg/mL) at 37�C for 72 hours. Preclustering was performedas described above. Lysates were collected and run on a 10%

Bhatia et al.

Cancer Res; 79(10) May 15, 2019 Cancer Research2724

on December 5, 2020. © 2019 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst March 20, 2019; DOI: 10.1158/0008-5472.CAN-18-3257

Page 4: Inhibition of EphB4 Ephrin-B2 Signaling Reprograms the Tumor … · Tumor Biology and Immunology Inhibition of EphB4–Ephrin-B2 Signaling Reprograms the Tumor Immune Microenvironment

SDS-PAGE as described above. Membranes were probed withp-EphB4 (1:1,000, Catalog No. PA5-64792; ThermoFisher Scien-tific) and anti-b-actin antibodies.

Immunofluorescence stainingImmunofluorescence (IF) staining was performed on paraffin-

embedded sections fixed in 4% buffered formalin. Tumor tissuewas deparaffinized, hydrated, and antigen epitope retrieval wasperformed. Sections were incubated with primary antibodiesovernight at 4�C. The following antibodies were used: CD107b(1:100; catalog no. 550292; BD Pharmingen), CD163 (1:100;catalog no. orb13303; Biorbyt), Gpr18 (1:100; catalog no.NBP2-24918SS; Novus Biologicals), F4/80 (1:50; catalog no.NB600-404SS; Novus Biologicals), Foxp3 (1:1,000; catalog no.ab20034; Abcam), F4/80 (1:100; catalog no. 70076; Cell Signal-ing Technology), and Pan-Keratin (1:100; catalog no. 4545;Cell Signaling Technology). Primary antibody incubation wasfollowed by treatment with Alexa Flour-tagged IgG secondaryantibody (1:400 dilution; Life Technologies). Nuclei were coun-terstained with 6-diamidino-2-phenylindole dihydrochloridehydrate (DAPI). Images were captured with a 20� objective usinga Nikon fluorescence or Olympus confocal microscope. Analysiswas performed on six to eight random fields for each of theexperimental and control groups.

ELISAPlasma samples collected from TNYL-RAW-Fc and pcDNA3

control mice were isolated and subjected to ELISA to measure thelevels of TNYL-RAW-Fc as described earlier (24). To detect TGF-b1levels, plasma samples or cell culture supernatants/conditionedmedia were analyzed using a TGFb ELISA Kit (R&D systems)according to the manufacturer's instructions.

U-plex cytokine arrayRetro-orbital blood collection was performed onmice 11 to 18

days after hydrodynamic injection of TNYL-RAW-Fc plasmid(immunocompetent mouse model) or 96 hours after RT (nudemousemodel). Plasmawas isolated and subjected to U-plex array(Meso Scale Diagnostics) according to the manufacturer'sinstructions.

CIBERSORT, The Cancer Genome Atlas, and mRNA expressionanalysis

Gene expression data were obtained from the HNSCC cohort inthe The Cancer Genome Atlas (TCGA) database (n ¼ 530). TheTCGAprovides level 3 RNA-seq data, which has been aligned to thereference genome and quantified at the gene transcripts level usingRNA-seq by expectationmaximization (RSEM; ref. 31). TheCIBER-SORTanalysiswasperformedasdescribedearlier (32).Macrophagepopulations were categorized into M1 or M2 subtypes based onmarkers analyzed in the article published by Newman and collea-gues (32). M1-related markers include: ACHE, ADAMDEC1,APOL3,APOL6,APOBEC3A,AQP9,ARRB1,CASP5,CCL19,CCL5,CCL8, CCR7, CD40, CXCL10, CXCL11, CXCL9, TNFAIP6, TNIP3,TRPM4, CD80, IL1B, IL12B, IL2RA and M2 markers include AIF1,ALOX15, ASGR2, CCL13, CCL14, CCL18, CCL23, CD68, CD180,CD209, CD163, CLEC4A, CLEC7A, CLEC10A, MS4A6A, TLR8,IL21R, EGR2, GSTT1, HRH1, FRMD4A (32). Only cases with aP-value< 0.05,which indicates a reliable estimationof immune cellinfiltration,wereused for further survival analysis. A cutoff value forM1:M2 of 0.5 was assigned for survival analysis. The correlation

analysis between EphB4 or ephrin-B2 and TGFb, HRH1 was per-formed on the TCGA HNSCC dataset using R2 analysis platform(https://hgserver1.amc.nl/cgi-bin/r2/main.cgi).

IrradiationIrradiation was performed either using the RS-2000 irradiator

(Rad Source Technologies) at 160 kVp, 10 mA, or the PXi-225Cximage-guided irradiator (PXi Inc.) at 225 kVp, 13mAwith 0.3mmCu filter. Mice were positioned in the prone orientation and a CTscan was acquired. Treatment planning and radiation dose deliv-ery were performed as described (5). Radiation was delivered at adose rate of 5.6 Gy/min.

Statistical analysisStatistical analysiswasperformedusingGraphPadPrismsoftware.

All the experiments were performed in duplicate or triplicate andrepeated two to three times. Statistical analyses of differencesbetween two groups were performed using Student t test or one-wayANOVA.TheDunnettpost hoc testwasused for further validationafter ANOVA where multiple experimental groups were comparedwith thecontrol group.AP-valueof<0.05was considered significant.

ResultsIn HNSCC tumors, EphB4 is present in cancer cells and highlyexpressed in both Tregs and macrophages compared withephrin-B2

To analyze the expression of EphB4 and ephrin-B2, we per-formed IHC staining using sections of tumors derived from themurine Ly2 HNSCC cell line and of CUHN013 PDX tumors. Ourdata show that EphB4 is expressed in both cancer cells and stroma(Fig. 1A). Further confirmation showing EphB4 expression ontumor epithelial cells was done by performing IF staining withanti-EphB4 and pan-keratin antibodies (Supplementary Fig. S1).Ourdata also showephrin-B2 expressionon some cancer cells andstroma (Fig. 1A) including a-smooth muscle actin–expressingfibroblasts (Supplementary Fig. S2). We also interrogated the R2database to analyze the mRNA expression of EphB4 and ephrin-B2 using two different datasets that included different immunecell populations (Fig. 1B). The Wicker dataset (GSE28491) andthe Salazer dataset (GSE2125) indicated higher expression ofEphB4 than ephrin-B2 in both Tregs and macrophages isolatedfrom human samples (Fig. 1B). These findings were furtherconfirmed by analysis of the ImmGen database (https://www.immgen.org; Fig. 1C). Our IF data also confirmed expressionof EphB4 on both F4/80-expressing macrophages and Foxp3-expressing Tregs, whereas ephrin-B2 expression was negligiblecompared with EphB4 on macrophages in Ly2 tumors (Fig. 1D).In addition, we performed qPCR analysis on intratumoral Tregsandmacrophages anddata show slightly higher levels of EphB4 inintratumoral Tregs compared with ephrin-B2. The EphB4 mRNAlevels were comparatively higher than ephrin-B2 in intratumoralmacrophages (Supplementary Fig. S3).

Inhibition of EphB4–ephrin-B2 signaling retards tumor growthin mouse orthotopic syngeneic HNSCC models

We previously reported that blockade of EphB4–ephrin-B2signaling delays tumor growth and enhances radiosensitizationin HNSCC PDX models (16). To determine the role of EphB4–ephrin-B2 interaction in supporting tumor growth in immuno-competent models, we used two different orthotopic models of

EphB4–Ephrin-B2 Blockade Remodels Immune TME

www.aacrjournals.org Cancer Res; 79(10) May 15, 2019 2725

on December 5, 2020. © 2019 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst March 20, 2019; DOI: 10.1158/0008-5472.CAN-18-3257

Page 5: Inhibition of EphB4 Ephrin-B2 Signaling Reprograms the Tumor … · Tumor Biology and Immunology Inhibition of EphB4–Ephrin-B2 Signaling Reprograms the Tumor Immune Microenvironment

HNSCC: Ly2 (BALB/c) and Moc2 (C57BL/6). The experimentaldesign is presented in Fig. 2A.Micewere injectedwith TNYL-RAW-Fc plasmid, a derivative of the short peptide TNYL-RAW, whichvery selectively binds to the ephrin-binding pocket of EphB4 andblocks the interaction of the receptor with the ephrin-B2ligand (26). Although dimerized through the Fc portion,TNYL-RAW-Fc remains an EphB4 antagonist similar to themono-meric peptide. TNYL-RAW-Fc treatment significantly inhibited thegrowth of both Ly2 (Fig. 2B and C) and Moc2 (Fig. 2D and E)tumors by 1.53-fold (P ¼ 0.03) and 1.61-fold (P ¼ 0.02) respec-tively compared with the pcDNA3 control group. We also deter-mined the circulating levels of TNYL-RAW-Fc by using an Fc-basedELISA assay as described in the section Materials and Methods.

Consistent with the published literature (24), our data show thepresence of TNYL-RAW-Fc in the mouse blood 7 days afterhydrodynamic injection (P ¼ 0.02; Supplementary Fig. S4A).

Inhibition of EphB4–ephrin-B2 interaction significantlydecreases Tregs and TAMs and enhances activation of bothconventional CD4þFoxp3� and CD8þ T cells inHNSCC tumors

To investigate the contribution of the tumor immune micro-environment to tumor growth retardation due to EphB4–ephrin-B2 inhibition, CyTOF analysis was conducted on Ly2 tumors ondays 14 to18 after administrationof the TNYL-RAW-Fc plasmidorpcDNA3 control plasmid. Our data show significant changes intumor-infiltrating immune cells following TNYL-RAW-Fc

Figure 1.

EphB4 is expressed in HNSCC tumor cells and is present at elevated levels in both Tregs andmacrophages compared with ephrin-B2. A, IHC analysis wasperformed on Ly2 tumor sections and CUHN013 human tumors and data show the presence of EphB4 on cancer cells and stroma, whereas ephrin-B2 waspresent on some cancer cells and on stroma. Scale bar, 100 mm. B, Analysis of Wicker dataset and Salazer dataset show high levels of EphB4 vs. ephrin-B2 onTregs andmacrophages, respectively. C,Analysis of the ImmGen database also shows high expression of EphB4 in Tregs andmacrophages compared withephrin-B2. D, IF staining showing colocalization of Foxp3 (Treg marker) and F4/80 (macrophage marker) with EphB4 or ephrin-B2 in Ly2 tumors.Total magnification,�200.

Bhatia et al.

Cancer Res; 79(10) May 15, 2019 Cancer Research2726

on December 5, 2020. © 2019 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst March 20, 2019; DOI: 10.1158/0008-5472.CAN-18-3257

Page 6: Inhibition of EphB4 Ephrin-B2 Signaling Reprograms the Tumor … · Tumor Biology and Immunology Inhibition of EphB4–Ephrin-B2 Signaling Reprograms the Tumor Immune Microenvironment

treatment (Fig. 2F). In particular, CD8þ T cells in the tumorsshowed a 1.2-fold increase (P ¼ 0.03) following TNYL-RAW-Fctreatment compared with pcDNA3 control (Fig. 2F). The percent-age of CD4þ T cells, however, remained unchanged (Fig. 2F). TheTreg cells (CD4þ T cells that are also positive for the Foxp3marker) constitute an important immunosuppressive populationin the TME and were dramatically reduced by nearly three-fold(P ¼ 0.009) in the EphB4–ephrin-B2 inhibited group (Fig. 2F).Importantly, theCD8þTeffector cell/Treg ratio that is an indicatorof enhanced therapeutic response, also significantly increased(P¼ 0.02) following EphB4–ephrin-B2 inhibition (Fig. 2F). Addi-tionally, the activation status of both conventional CD4þFoxp3�T cells and CD8þ T cells, assessed based on ICOS (Inducible T-cellCOStimulator) expression (33), showed a nearly 2.8-fold increase(P ¼ 0.0002; P ¼ 0.009) following EphB4–ephrin-B2 inhibition(Fig. 2F). These activated T-cell populations are both known toplay a key role in inducing an antitumor immune response. TheCyTOF data was replicated by flow analysis as shown in Fig. 5.

In addition to the changes observed in T cells, we also observedchanges in the macrophage population (F4/80þ cells, gated onCD11bþ cells; Fig. 2F). There was a 1.9-fold decline (P¼ 0.04) inthe F4/80þ macrophages in the TNYL-RAW-Fc treated group(Fig. 2F). Specifically, we noted a 1.4-fold decline (P ¼ 0.01)in the protumorigenic M2 macrophages (Arg1þF4/80þ cells)and a 16-fold increase (P < 0.0001) in M1 macrophages(F4/80þiNOSþ) following TNYL-RAW-Fc treatment (Fig. 2F).No significant differences were detected in intratumoral

CD11bþLy6Cþ monocytes (Fig. 2F) or CD11bþLy6Gþ neutro-phils (Fig. 2F). We also observed a 1.7-fold upregulation(P ¼ 0.01) in the CD11Cþ dendritic cell population followingEphB4–ephrin-B2 blockade (Fig. 2F).

To distinguish whether the observed decrease in Tregs and M2TAMs in the tumors is a direct effect of intratumoral EphB4–ephrin-B2 inhibition or is due to systemic inhibition (whichcould decrease exit of these immune cells from the bone marrow,as has been previously reported for hematopoietic stem andprogenitor cells; ref. 24), we analyzed blood samples collectedfrom TNYL-RAW-Fc treated and control mice by flow cytometry.Our data demonstrate that in the Ly2 tumor model, TNYL-RAW-Fc treatment does not significantly affect circulating immune cells,including CD45þ cells, CD4þ and CD8þ T cells, Foxp3þ Tregs,CD45þCD11bþ myeloid cells, and F4/80þ macrophages (Sup-plementary Fig. S4B). To confirm the involvement of adaptiveimmune components, we performed systemic depletion of CD8þ

T cells in the BALB/c mouse model, which reversed the effects ofTNYL-RAW-Fc enhancing tumor growth (P ¼ 0.01; Supplemen-tary Fig. S5A). Depletion of CD8þ T cells was confirmed by flowanalysis (P ¼ 0.03; Supplementary Fig. S5B).

In vitro inhibition of EphB4 in T cells decreases STAT3phosphorylation andKi67 expressing Tregs and alters the levelsof key growth-promoting molecules

To understand the mechanisms by which EphB4–ephrin-B2interaction affects T-cell numbers and function inHNSCC tumors,

Figure 2.

Inhibition of EphB4–ephrin-B2 by TNYL-RAW-Fc results in a significant tumor growth reduction, decreased intratumoral Tregs and TAMs, and increased T-cellactivation in orthotopic HNSCCmodels.A, The experimental design. Blockade of EphB4–ephrin-B2 in mice hydrodynamically injected with the TNYL-RAW-Fcplasmid (20 mg/mouse) results in a significant decrease in tumor growth in Ly2 (B and C) and Moc2 (D and E) tumor-bearing mice. Ly2 tumors frommice treatedwith either pcDNA3 or TNYL-RAW-Fc plasmids were harvested 11 to 18 days after plasmid administration. Tumors were processed and subjected to masscytometry analysis. F, Bar diagrams show quantitative differences in tumor-infiltrating population of immune cells labeled with the indicated markers followingTNYL-RAW-Fc or control treatment. All the immune cells were gated on parent immune cell CD45þ population. Data represent mean� SEM. Student t testwas used to calculate the significance of the difference between the groups. � , P < 0.05; �� , P¼ 0.001–0.01; ��� , P¼ 0.0001–0.001.

EphB4–Ephrin-B2 Blockade Remodels Immune TME

www.aacrjournals.org Cancer Res; 79(10) May 15, 2019 2727

on December 5, 2020. © 2019 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst March 20, 2019; DOI: 10.1158/0008-5472.CAN-18-3257

Page 7: Inhibition of EphB4 Ephrin-B2 Signaling Reprograms the Tumor … · Tumor Biology and Immunology Inhibition of EphB4–Ephrin-B2 Signaling Reprograms the Tumor Immune Microenvironment

we conducted in vitro analyses of CD4þT cells isolated from thespleens of tumor-bearing mice and treated for 72 hours withrecombinant ephrin-B2-Fc. We selected recombinant ephrin-B2-Fc protein for in vitro studies because at high concentrations(20 mg/mL) it has been reported to inhibit certain EphB4 down-stream signals (34). We observed lower levels of tyrosinephosphorylated EphB4 in CD4þ T cells treated with 20 mg/mLephrin-B2-Fc than in CD4þ T cells treated with Fc control(Fig. 3A). To confirm these results, we also treated the CD4þ

T cells with PEGylated form of TNYL-RAW peptide EphB4 antag-onist (26), also known to block EphB4–ephrin-B2 interactionand observed similar effect.

We examined the effect of ephrin-B2-Fc treatment on Ki67 (asurrogate marker of proliferation) expressing Tregs using flowcytometry and observed that ephrin-B2-Fc at 20 mg/mL concen-tration decreased Ki67 expressing Tregs by 1.7-fold (P ¼ 0.02)compared with the Fc control treatment (Fig. 3B). The percentageof total CD4þ T cells remained unchanged between control andephrin-B2-Fc treated groups (Supplementary Fig. S6A). To exam-ine molecular mediators that might be affecting T-cell functiondownstream of EphB4–ephrin-B2, we focused on signalingmole-cules known to be involved in both T-cell signaling and EphB4–ephrin-B2 signaling. Substantial evidence from studies on normalphysiology and inflammation suggests that these involve a com-plex array of signaling pathways, including PI3-Kinase, MEK,STAT3, Src family kinases, and p38 MAPK pathways (35–37),which have previously been implicated in T-cell activation andproliferation (35, 36, 38). In addition, reports have suggestedJAK/STAT as an Eph receptor downstream pathway and we havepreviously demonstrated that blockade of EphB4–ephrin-B2signaling combined with RT decreases p-STAT3 in HNSCCtumors (16). Therefore, we examined changes in p-STAT3 in

Tregs after ephrin-B2-Fc treatment by flow cytometry. Our datashow that 20 mg/mL ephrin-B2-Fc and the PEGylated form ofTNYL-RAW similarly decreased STAT3 phosphorylation inTregs (Fig. 3C).

Tregs also constitutively express high levels of IL-2Ra anddepend on IL2 for proliferation, survival, and proper functioning.Because we observed decreased Ki67-expressing Tregs following ahighdoseof ephrin-B2-Fc, we investigated if thismaybemediatedby reduced secretion of cytokines such as IL2. Our data indeedshow a decrease in the secreted levels of IL2 (P¼ 0.07; Fig. 3D) aswell as of TGFb (P ¼ 0.009; Fig. 3E), a key regulator of Tregfunction (39), in the conditioned media of Treg cells treated with20 mg/mL ephrin-B2-Fc. We also performed CIBERSORT analysison TCGA HNSCC dataset and failed to find any correlationbetween Foxp3 and EphB4 or ephrin-B2. However, TGFb, aregulator and mediator of Treg functionality (39) showed somecorrelation with ephrin-B2/EphB4 in humanHNSCC TCGA data-base on R2 analysis platform (Supplementary Fig. S6B and S6C).In addition, decreased levels of prosurvival markers such asp-AKT, and Bcl-XL were observed in T-cell lysates by Westernblotting after 24 hours treatment with the high concentration ofephrin-B2-Fc compared with the control-Fc (Supplementary Fig.S6D). The levels of cleaved caspase-3, however, increased follow-ing treatment with 20 mg/mL ephrin-B2-Fc compared with thecontrol-Fc (Supplementary Fig. S6D).

Disruption of EphB4–ephrin-B2 signaling combined withradiation generates a potent antitumor response inimmunocompetent orthotopic HNSCC models

RT remains the mainstay of cancer treatment and is used incombination with chemotherapeutic or targeted agents for thedefinitive management of patients with HNSCC. However, in

Figure 3.

Treatment with a high (inhibitory) concentration of ephrin-B2-Fc reduces Ki67-expressing Tregs, STAT3 phosphorylation, and TGFb1 and IL2 levels in Tregsin vitro.A,Western blot analysis of isolated CD4þ T cells treated with 20 mg/mL ephrin-B2-Fc for 72 hours shows a decrease in EphB4 tyrosine phosphorylationas compared to the control treatment group (2.5 mg/mL). PEGylated TNYL-RAW (EphB4 antagonist) show similar effect. B, Flow cytometry analysis of T cellsdemonstrates decreased Ki67-expressing Tregs (CD4þFoxp3þKi67þ) following a 48 hour treatment with a high dose (20 mg/mL) of ephrin-B2-Fc or PEG-TNYL-RAW (4.5 mg/mL). C, The concentration of 20 mg/mL ephrin-B2-Fc has an inhibitory effect on p-STAT3 at the 24 hours time-point, similar to 4.5 mg/mL PEG-TNYL-RAW. Conditioned media collected at 24 hours from Tregs treated with control-Fc, and 20 mg/mL ephrin-B2-Fc were subjected to TGFb1 ELISA assay or toa U-plex mesoscale cytokine array to determine change in secreted IL2 levels (D) and TGFb1 levels (E). Data represent mean� SEM. The Student t test or one-way ANOVAwas used to calculate the significance of differences between the groups. � , P < 0.05; ��, P¼ 0.001–0.01.

Bhatia et al.

Cancer Res; 79(10) May 15, 2019 Cancer Research2728

on December 5, 2020. © 2019 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst March 20, 2019; DOI: 10.1158/0008-5472.CAN-18-3257

Page 8: Inhibition of EphB4 Ephrin-B2 Signaling Reprograms the Tumor … · Tumor Biology and Immunology Inhibition of EphB4–Ephrin-B2 Signaling Reprograms the Tumor Immune Microenvironment

addition to acting as an adjuvant to immunotherapy, RT alsoenhances the levels of both EphB4 and ephrin-B2 in Ly2 tumors asshown in Supplementary Fig. S7A and S7B. Therefore, we eval-uated the efficacy of combining EphB4–ephrin-B2 inhibitor,TNYL-RAW-Fc, with RT to suppress tumor growth by modulatingthe tumor immune microenvironment and mitigating the pro-tumorigenic effects of EphB4–ephrin-B2 signaling in the Ly2orthotopic model. We also compared the in vivo efficacy ofcombined EphB4–ephrin-B2 inhibition and RT with that ofcombined immune checkpoint inhibitor anti-PDL1 and RT. Theexperimental design is shown in Fig. 4A.

Our data show that radiation alone (RTþIgGþpcDNA3)reduced tumor growth by 2.2-fold (P ¼ 0.0003) compared withthe IgGþpcDNA3 control group (Fig. 4B–D). However, whenTNYL-RAW-Fc was used in combination with RT, the combina-tion group resulted in a 4.4-fold reduction compared withTNYL-RAW-Fc alone (P¼ 0.0003; Fig. 4B–D). Importantly, whenEphB4–ephrin-B2 inhibition was combined with RT, a similarantitumor response was generated as anti-PDL1 combined withRT (Fig. 4B–D) at day 20 posttumor implantation. Triple com-bination with anti-PDL1þRT and TNYL-RAW-Fc did not addadditional synergy (Supplementary Fig. S7C–S7E). Monitoringtumor growth over extended period of time showed enhancedtumor growth suppression in the RTþIgGþTNYL combinationgroup compared with RTþIgGþpcDNA3 in Ly2 tumors (Supple-

mentary Fig. S7C–S7E). We also evaluated the efficacy of com-bining TNYL-RAW-Fc inhibitor with RT in another aggressiveHNSCC tumormodel, Moc2 and it showed similar tumor growthsuppression in the combination groups compared with single-agent RT alone (Supplementary Fig. S7F–S7I). Treating Moc2tumors with RT resulted in a significant 1.59-fold reduction(P<0.0001) in tumor growth comparedwith the control pcDNA3group. When TNYL-RAW-Fc inhibitor was combined with RT, itdecreased tumor growth by 1.36-fold (P < 0.005). The irradiatedgroups when combined with either TNYL-RAW-Fc or anti-PDL1resulted in similar level of tumor growth suppression comparedwith RT alone at day 17 and day 21 posttumor implantation(Supplementary Fig. S7G and S7H). Similar to the Ly2 model,combining TNYL-RAW-Fc inhibitor with anti-PDL1þRT failed toshow any additional benefit (Supplementary Fig. S7F–S7I).

To understand the contribution of EphB4–ephrin-B2 inhibi-tion to immune modulation in the presence of RT, we analyzedLy2 tumors harvested from the control and TNYL-RAW-Fc groupswith and without RT by flow cytometry. Our data demonstratedthat in the absence of RT, EphB4–ephrin-B2 inhibition increasedCD8þ T-cell population (Fig. 5A) without affecting the CD4þ

T-cell subset (Fig. 5B). Exposing Ly2 tumors to 10 Gy dose of RTresulted in a significant enhancement of both CD8þ T cells andCD4þ T cells at day 3 post-RT (Fig. 5A and B). EphB4–ephrin-B2inhibition with RT did not affect these T-cell populations

Figure 4.

Inhibition of EphB4–ephrin-B2 interaction combined with RT induces significant tumor growth suppression in orthotopic model of HNSCC. A, The experimentaldesign. B, Inhibition of EphB4–ephrin-B2 interaction through hydrodynamic injection of the TNYL-RAW-Fc plasmid (20 mg/2 mL PBS/mouse) enhances thesensitivity of Ly2 tumors to RT (10 Gy). C, The dot plot shows tumor volumes on day 20 posttumor implantation and shows significant differences betweencontrol and experimental groups.D, Tumor volumes of individual mice within a group are represented by spaghetti plots. One-way ANOVAwas used tocalculate the significance of the differences between groups in C. Data represent mean� SEM. � , P < 0.05; ��, P¼ 0.001–0.01; ��� , P¼ 0.0001–0.001.

EphB4–Ephrin-B2 Blockade Remodels Immune TME

www.aacrjournals.org Cancer Res; 79(10) May 15, 2019 2729

on December 5, 2020. © 2019 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst March 20, 2019; DOI: 10.1158/0008-5472.CAN-18-3257

Page 9: Inhibition of EphB4 Ephrin-B2 Signaling Reprograms the Tumor … · Tumor Biology and Immunology Inhibition of EphB4–Ephrin-B2 Signaling Reprograms the Tumor Immune Microenvironment

compared to RT alone (Fig. 5A and B). We observed a 1.6-folddecline in the Treg population with RT treatment compared withthe control group at day 3 post-RT (P¼ 0.009; Fig. 5C). Additionof TNYL-RAW-Fc to RT resulted in a further decline (�2.7-foldtotal) in the tumor-infiltrating Tregs compared with both of thesingle agents (Fig. 5C). The CD8þ T cell-to-Treg ratio was alsosignificantly increased in the combination treatment comparedwith control or TNYL-RAW-Fc treatment (Fig. 5D). To examine theeffect of EphB4–ephrin-B2 inhibition with RT on T-cell function,we evaluated the percentage of activated CD8 T cells(CD8þIFNgþ; Fig. 5E) and activated conventional CD4 T cells(CD4þFoxp3�IFNgþ; Fig. 5F). We observed an increase in thepercentage of both in the combination group (2.2–2.4 fold)compared with TNYL-RAW-Fc alone. In addition, inhibitingEphB4–ephrin-B2 interactionwith RT also resulted in a significantincrease in CD4þFoxp3�IFNgþ cells (2.2-fold; P ¼ 0.04) com-pared with RT alone (Fig. 5F). Increased levels of secreted IP-10/CXCL10, a potent chemokine that attracts functional cytotoxic Tcells, was induced by TNYL-RAW-Fc or RT treatment, and furtherincreased by the combination of both treatments compared withRT (Fig. 5G). Finally, a 1.4- and 1.8-fold decrease in circulatingTGFb, an output of Tregs' immunosuppressive action, wasobserved with the TNYL-RAW-Fc and RT treatment, respectively,compared with the control group (Fig. 5H). Combining TNYL-RAW-Fc with RT further potentiated the decrease in TGF-b levels(P ¼ 0.02 compared with RT; Fig. 5H).

Combined EphB4–ephrin-B2 inhibition and radiationdecreases the infiltration of TAMs independently of the effecton T cells

To determine whether the decrease in TAMs is a direct conse-quence of the changes in Tregs, which are known to promotemonocyte differentiation to macrophages, we tested the effect of

EphB4–ephrin-B2 inhibition in nude mice, a T-cell independentmodel. We used HNSCC PDX tumor models known to preservethe tumor environment and mimic human cancers. We havepreviously shown a significant decrease in tumor growth follow-ing EphB4–ephrin-B2 inhibition using sEphB4–HSA in combi-nation with radiation only or radiation and the EGFR inhibitorcetuximab (16, 17). sEphB4–HSA is a soluble protein that inhibitsthe interaction between EphB4 and ephrin-B2 by binding toephrin-B2 (although TNYL-RAW inhibits the interaction by bind-ing to EphB4; ref. 26). We measured TAM infiltration by using T2weighted-MRI with iron oxide (SPIO) accumulation in a HNSCCPDX tumor model. We observed that although RT by itselfconsiderably increases SPIO uptake as represented by decreasedsignal intensity, inhibiting EphB4–ephrin-B2 interaction withsEphB4-HSA reversed this effect of RT (P < 0.05; SupplementaryFig. S8A and S8B).

These imaging data were further corroborated by IF stainingusing CUHN013 tumors harvested from control and experimen-tal groups. This demonstrated that inhibition of EphB4–ephrinB2with sEphB4–HSA in combination with RT significantly decreasesthe percentage of TAMs, as determined by the reduction in thestaining for the pan-macrophage markers CD107bþ and F4/80þ

compared with either treatment alone (Fig. 6A–C). We alsoobserved a decrease in the staining for CD163þ M2macrophages(Fig. 6A and D), and an increase in the staining for Gpr18þ M1macrophages (Fig. 6A and E) in CUHN013 tumors, suggestingthat EphB4–ephrin-B2 inhibition and RT shift the polarization ofmacrophages from the protumor M2 phenotype to the antitumorM1 phenotype. This is also evident in the increased ratio of M1 toM2 markers (Gpr18:CD163), which is potentiated in the com-bination group (Fig. 6F). Finally, analysis of circulating cytokine/chemokine profiles demonstrates that combining sEphB4-HSAwith RT significantly decreases the levels of macrophage colony-

Figure 5.

Inhibition of EphB4–ephrin-B2 signaling combined with RT inhibits HNSCC tumor growth by reducing Treg infiltrates and by enhancing activation of bothCD4þFoxp3� conventional CD4þFoxp3� T cells and CD8þ T cells. Tumors from control and experimental groups were harvested at 3 days after RT (10 Gy),processed, and subjected to flow cytometry analysis. Data represent changes in immune infiltrates including CD8þ (A), CD4þ (B), Foxp3þ (C) cells and the CD8þT cell/Treg ratio (D). Flow cytometry analysis also shows an increase in the percentage of activated CD8þIFNgþ (E) and CD4þFoxp3�IFNgþ conventionalCD4þFoxp3� (F) T cells in the combination group compared with the control and TNYL-RAW-Fc groups. Plasma samples were collected 3 days after RT andsubjected to a U-plex mesoscale cytokine array or ELISA assay. An increase in the circulating IP-10/CXCL10 levels (G) along with a reduction in TGFb1 (H) isevident in the combination treatment group compared with the control and single-agent cohorts. One-way ANOVAwas used to calculate the significance of thedifferences between the groups. Data represent mean� SEM. � , P < 0.05; �� , P¼ 0.001–0.01; ��� , P¼ 0.0001–0.001; ���� , P < 0.0001.

Bhatia et al.

Cancer Res; 79(10) May 15, 2019 Cancer Research2730

on December 5, 2020. © 2019 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst March 20, 2019; DOI: 10.1158/0008-5472.CAN-18-3257

Page 10: Inhibition of EphB4 Ephrin-B2 Signaling Reprograms the Tumor … · Tumor Biology and Immunology Inhibition of EphB4–Ephrin-B2 Signaling Reprograms the Tumor Immune Microenvironment

stimulating factor (M-CSF), a key differentiation factor that med-iates M2 polarization, compared with the single-agent treatments(Fig. 6G; ref. 40). This is accompanied by amarked increase in thelevels of both GM-CSF (Fig. 6H) and IFNg (Fig. 6I), particularly inthe combination treatment group as compared to either sEphB4–HSAaloneorRTalone. BothGM-CSF and IFNg are known to favorM1 polarization (40). Thus, taken together, our data indicate thatcombined EphB4–ephrin-B2 inhibition and RT induce an anti-tumor immune response by affecting macrophage polarization.

A low M1/M2 ratio correlates with poor survival and disease-free survival in HNSCC

In light of our data showing that EphB4–ephrin-B2 inhibitionfavors a polarization towards an M1 phenotype, we performedTCGA and CIBERSORT analysis to examine the significance ofsuch polarization on the survival of patients with HNSCC. Ouranalysis revealed for the first time that a significant correlationexists between lower M1/M2 ratio and poor overall survival aswell as disease-free survival (Supplementary Fig. S8C and S8D).The analysis was based on a cut-off M1/M2 ratio of 0.5. When theM1/M2 ratio is < 0.5, patients have poor overall survival ratescompared with patients with M1/M2 ratio >0.5. The mediansurvival for patients with M1/M2 ratio >0.5 was 65.8 monthscompared with 32.8 months (P ¼ 0.0170) for patients withM1/M2 ratio <0.5 (Supplementary Fig. S8C). Furthermore, the

median time to disease progression in patient cohort withM1/M2ratio >0.5 was 76.2 months compared with 53.1 months(P¼ 0.0111) for patients with <0.5M1/M2 ratio (SupplementaryFig. S8D). When we interrogated the HNSCC datasets, weobserved no correlation between EphB4 or ephrin-B2 expressionand composite M2-related macrophages. Some positive correla-tion was however evident between ephrin-B2 and M2 marker-HRH1 (Supplementary Fig. S8E and S8F).

DiscussionThe advent of immunotherapy has shownpromising outcomes

in several disease models, albeit the response rates have beensuboptimal (41). In addition, immune-related adverse toxicityand development of resistance poses a major hurdle that com-promises the efficacy of immunotherapeutic agents (5, 42). Thus,it is important to search for alternate therapeutic strategies that canremodel the tumor immune microenvironment to generate apotent antitumor immune response.

Multiple pieces of evidence show that EphB4–ephrin-B2 inter-action regulates different immune cell processes, including pro-liferation, survival, apoptosis, activation, and migration (22, 23,34, 38). The reported effects vary in different studies, possibly dueto different levels of blockade of Eph receptor–ligand interac-tion (23, 34, 38). A report by Kawano and colleagues, examined

Figure 6.

Targeting of EphB4–ephrin-B2 interaction combined with radiation decreases tumor-associated M2macrophages in PDXmodels of HNSCC. A, IF analysis showsdecreased CD107b, F4/80, CD163, and increased Gpr18 staining in CUHN013 tumors treated with sEphB4-HSA and RT compared with single agents or the PBScontrol group. CD107b and F4/80 represent pan-macrophage markers, CD163 is a specific marker for M2macrophages, and Gpr18 is a marker for M1macrophages. Quantitative analysis for different macrophagemarkers is shown in B–F. Significant changes in the levels of inflammatory cytokines andchemokines are evident in plasma samples in vivowhen EphB4–ephrin-B2 inhibition is combined with RT. Plasma samples were collected 96 hours after RT fromthe mice implanted with CUHN013 tumors and treated with PBS, sEphB4-HSA, PBS and RT, or sEphB4-HSA and RT and analyzed using a mouse cytokine array(G–I). One-way ANOVAwas used to calculate the significance of the differences between the groups. Data represent mean� SEM. � , P < 0.05; �� , P¼ 0.001–0.01;��� , P¼ 0.0001–0.001; ���� , P < 0.0001. Scale bar, 100 mm.

EphB4–Ephrin-B2 Blockade Remodels Immune TME

www.aacrjournals.org Cancer Res; 79(10) May 15, 2019 2731

on December 5, 2020. © 2019 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst March 20, 2019; DOI: 10.1158/0008-5472.CAN-18-3257

Page 11: Inhibition of EphB4 Ephrin-B2 Signaling Reprograms the Tumor … · Tumor Biology and Immunology Inhibition of EphB4–Ephrin-B2 Signaling Reprograms the Tumor Immune Microenvironment

the total CD3 T-cell population without distinguishing betweendifferent subset of T cells, making it challenging to appreciate thefull spectrum of the biological impact of EphB4–ephrin-B2 sig-naling (34). Our data are the first to show a differential effect ofEphB4–ephrin-B2 blockade on different T-cell populations in aHNSCC model, with selective targeting of Tregs.

Tregs present in the TME act as one of the major immunosup-pressors, dampening the activity of T-effector cells and immuno-therapy-induced antitumor responses (5). The outcome of anantitumor immune response depends on the balance between theactivities of intratumoral Teffector cells and immune suppressivecell populations, including Tregs. Our data show that the decreasein Tregs observedwith inhibition of EphB4–ephrin-B2 interactionin orthotopic HNSCC models is associated with increased acti-vation of the CD8þ and CD4þFoxp3� conventional CD4 T cellsknown to be involved in antitumor immune response. In addi-tion, increased T-cell activation is also inferred with EphB4–ephrin-B2 inhibition combined with RT, based on the increasedcirculating plasma levels of IP-10/CXCL10, which is a member ofthe CXC chemokine family that binds to the CXCR3 receptor onTeffector cells to enhance chemotaxis, activation, growth, andangiostatic effects (43). In contrast, the levels of circulatingTGFb1, amaster regulator of Treg function (39), were significantlyreduced by the combination of EphB4–ephrin-B2 inhibition andRT. In addition to its effects on T-cell subsets, EphB4–ephrin-B2inhibition also increased the dendritic cell population, which isknown to be involved in antigen presentation. These data are inagreement with a report demonstrating that Tregs cross-talk withintratumoral dendritic cells to suppress an activated T-cellresponse and that Treg ablation in turn results in an effectiveantitumor response by restoring immunogenicCD11Cþdendriticcells and activating the CD8þ T-cell population (44). Our resultsare also concordant with what is known for functional roles ofreceptor tyrosine kinases. Several studies have reported that AXL,another tyrosine receptor kinase similar in structure and functionto EphB4, has effects on both cancer cell and immune cells(45, 46). AXL inhibition has been shown to induce an antitumorimmune response in syngeneic ovarian cancer and lung cancermodels (45).

The impact of Tregs in HNSCCs has been a controversialtopic (47–50). Although a positive correlation between Tregs andprognosis has been reported in ameta-analysis inHNSCCs (47), itis important to note that the data presented are highly heterog-enous and the study only focused on univariate analysis of theresults. In a study byMandal and colleagues (48), such prognosticsignificance of Tregs was lost onmultivariate analysis after adjust-ment for other immune cells. These results indicate that Treg levelsin HNSCC covary with broader trends among T-cell populations,and that Treg levels in isolation may not represent the overall netlevel of immune activation or suppression in the TME. Supportiveof a role of Tregs in driving resistance to treatment are also resultsfrom a cross-sectional study showing that in the setting of post-operative chemoradiation, Tregs were increased in frequency andpersisted afterwards especially in those with active disease andcould be responsible for suppression of antitumor immuneresponses and recurrence in HNSCC (50). Consistent with thesefindings, Hanna and colleagues (49), demonstrated a correlationbetween an inflamed tumor subtype in the recurrent, metastaticsquamous cell carcinoma with improved survival compared witha non-inflamed subtype characterized by low CD8þ T cells, lowPD-1/TIM3 coexpression, and higher Tregs.

The mechanisms of how Tregs suppress Teffector functionand how EphB4–ephrin-B2 interaction contributes to this effectremain a subject of investigation. Our in vitro data show thatinhibition of EphB4–ephrin-B2 function decreases Ki67þTregsand decreases circulating IL2. The contribution of baselineperipheral Ki67þ Tregs in response to immunotherapy hasbeen recently shown to be directly, and unexpectedly, a positivecorrelation. In an analysis of CheckMate141 trial, baselineKi67þ Treg levels were found to be lower in nonresponderswhereas PD-1þTreg population was significantly reduced fol-lowing nivolumab (anti-PD1 antibody) treatment in bothresponders and nonresponders (51). Although these datamight seem counterintuitive, and they only apply to baselinecirculatory levels that may or may not reflect the dynamics ofthe TME, they nevertheless highlight an important unmet needin terms of understanding of Treg biology. An elegant study byMaj and colleagues (52) has shown that all Tregs within theovarian cancer TME express high Ki67. But it is the apoptoticTregs, induced by a highly acidic and hypoxic TME, thatmediate that mediate immunosuppression via the adenosinepathway (52). Others have argued that Tregs suppress Teffectorsby consumption of IL2 thus forcing Teffectors to undergolymphokine withdrawal apoptosis (53). Our data supporta decrease in Ki67þ Tregs and total numbers of Tregs uponTNYL-RAW mediated EphB4–ephrinB2 inhibition along with adecrease in circulating IL2 levels. We observe an increase inCD8 T-cell activation status, which we believe is due to directremoval of Treg immunosuppression. However, the exactmechanisms of how EphB4–ephrinEphB4–ephrin-B2 inhibi-tion might be influencing Tregs immunosuppressive activity onTeffectors remain unclear. We are using conditional knockoutsof EphB4 and ephrin-B2 for a more in-depth understanding ofthe mechanisms by which the interaction of the EphB4 receptorwith its cognate ligand affects the immune microenvironmentin the TME. This along with human samples from clinical trialsusing EphB4–ephrin-B2 inhibitors in HNSCCs should improvesuch understanding.

Using the R2 analysis on HNSCC datasets, we found EphB4and ephrin-B2 levels to correlate with TGFb, a regulator andmediator of Treg function (39), as well as HRH1-a mediator ofM2 function (54). No specific correlation was found betweeneither EphB4 or ephrin-B2 and Foxp3 or composite M2 markersin our CIBERSORT TCGA analyses. These data, however, haveto be interpreted with caution. First, CD25 is not included inthe CIBERSORT analysis so the validity of defining a "Treg"population remains to be established using this approach.Second, correlating gene expressions with immune signaturesin the TCGA analysis remains a challenge, particularly for genesrichly expressed on the stroma. This has been attributed totumor purity (55), where the presence of nontumor cell popu-lations such as immune cells, endothelial, and stromal cells inthe surgical specimens can skew the analyses of cancer geneexpression profiles. It should be further noted that such tumorpurity can act as a key confounding factor when deducingcorrelation between gene expression, mutational burden, geneclustering, and molecular taxonomy and should be taken intoconsideration (55). We know based on our data that ephrin-B2is present on some cancer cells and stroma whereas EphB4 ispresent both on cancer cells and stroma including Tregs. Thiscalls into question the validity of such data and awaits confir-mation by flow cytometry in future clinical trials.

Bhatia et al.

Cancer Res; 79(10) May 15, 2019 Cancer Research2732

on December 5, 2020. © 2019 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst March 20, 2019; DOI: 10.1158/0008-5472.CAN-18-3257

Page 12: Inhibition of EphB4 Ephrin-B2 Signaling Reprograms the Tumor … · Tumor Biology and Immunology Inhibition of EphB4–Ephrin-B2 Signaling Reprograms the Tumor Immune Microenvironment

Whether the increase in the CD8 T-cell/Treg ratio induced byTNYL-RAW-Fc is intratumoral or systemic is an importantdistinction in light of the published literature showing the roleof EphB4–ephrin-B2 in regulating mobilization of hematopoi-etic stem and progenitor cells from the bone marrow (24).Using genetically engineered mouse models and subcutaneousovarian and breast cancer mouse xenograft models, Kwak andcolleagues showed that EphB4 regulates transendothelialmigration of hematopoietic stem/progenitor cells from bonemarrow sinusoids, and that EphB4–ephrin-B2 inhibitiondecreases both blood and tumor-infiltrating hematopoieticstem/progenitor cells and thus tumor growth (24). In contrast,we did not observe changes in circulating lymphocytes, sug-gesting that the effect is likely exerted intratumorally. Duringdevelopment, ephrin-B ligands were also recently demonstrat-ed to act on T-cell homing by blocking their recruitment andretention via chemorepulsive interactions with EphB-receptor-expressing Teffector cells in germinal centers (56). This is notsurprising in view of the previous report by Korff and collea-gues (57), suggesting that ephrin-B2 is expressed on the lumi-nal surface of resting endothelial cells and EphB receptors arepresent on circulating leukocytes.

The mechanisms by which EphB4–ephrin-B2 interactionalters T-cell numbers and function remain poorly understood.Suppression of T-cell function has been demonstrated forEph/ephrin family members (22, 23, 35). Inhibition of CD4þ

T-cell proliferation has been previously demonstrated inresponse to ephrin-A1 signaling (22), a process that is likelymediated by activation of Src-family kinases, AKT phosphory-lation, and T-cell apoptosis blockade (35). Other signalingpathways such as MEK, STAT3, and p38 MAPK have also beenimplicated in T-cell activation and proliferation (35, 36, 38).EphB4–ephrin-B2 interaction between mesenchymal stem cellsand T cells can also suppress T-cell proliferation (23). Con-flicting data, however, also suggest that the Eph/ephrin systemcan stimulate T-cell function (58, 59). These functional contra-dictions could be explained by the concentration of availableligand that might result in different responses on T cells. Arecent study showed that the involvement of ephrin-B1 andephrin-B2 in T-cell proliferation is dose dependent (34), where-by low doses enhanced CD3-mediated murine T-cell prolifer-ation and an opposite effect was observed at higher doses (34).Our data show that at high concentration, ephrin-B2-Fcdecreases Ki67-expressing Treg population. In addition, we alsoobserved a decrease in the levels of p-AKT and BCL-XL in T cellsat high ephrin-B2-Fc concentration similar to what has beenpreviously reported (34–38).

Another immune cell population that has emerged as a maintarget of EphB4–ephrin-B2 inhibition are the TAMs. Overexpres-sion of EphB4 on monocytes has also been shown to augmentmonocyte adhesion (21). In atherosclerosis, it was shown thatendothelial ephrin-B2 activates the EphB2 receptor onmonocytesand induces cytokine expression inmonocytes (18). In this study,we show that inhibition of the interaction between EphB4 andephrin-B2 causes a significant reduction in TAMs. Although adecrease in intratumoral myeloid cells has been shown beforewith EphB4–ephrin-B2 inhibition and attributed to decreased exitof hematopoietic stem and progenitor cells from the bone mar-row (24), in our HNSCC tumor models we show a specificdecrease of protumoral M2 macrophages compared with theantitumoral M1 macrophages. Our TCGA analysis further shows

that theM1/M2 ratio is a prognostic predictor of both disease-freesurvival and overall survival in the HNSCC patient population.Ourdata are in concordancewith thepublished reports suggestingthat polarization of TAMs toward aM2 phenotype, indicated by alower M1/M2 ratio predicts for poor response to chemoradiationand shorter survival in locally advanced cervical cancer (60). Thepolarization of TAMs toward M1 phenotype upon inhibition ofEphB4–ephrin-B2 is most evident when combined with RT. Inoral cavity cancers, the recolonization of tumors by M2-likemacrophages post-RT has also been shown to elicit the secretionof pro-angiogenic factors that contribute to neo-angiogenesis,favoring tumor regrowth (61). In our HNSCC model, we showthat the combined treatment with an EphB4–ephrin-B2 inhibitorand RT decreases macrophages with the M2 phenotype.

Radiotherapy (R) remains the standard of care treatment in thedefinitive management of patients with locally advancedHNSCCs and can act as an adjuvant for immunotherapy butthere are some undesirable effectsmounted in response to RT thatin turn compromises the efficacy of immunotherapeutic agents.RT is unable to overcome the accumulation of immunosuppres-sive populations such as Tregs in the later (repair) phase (5).Therefore, finding other treatments that synergize with RT andcounteract its negative effects is critical to overcome adverse side-effects, treatment resistance, and tumor regrowth. In addition, weobserved that RT upregulates EphB4 and EFNB2 mRNA levels inmurine Ly2 tumors particularly in the late phase of tumorregrowth. Therefore, combining RT with EphB4-EFNB2 inhibitor(TNYL-RAW-Fc) provides rationale in mitigating the undesirableprotumor effects triggered as a result of EphB4-EFNB2 signaling.Our data demonstrate that inhibiting EphB4–ephrin-B2 signalingusing TNYL-RAW-Fc significantly enhances the radiosensitivityof Ly2 tumors and suppresses tumor growth. CombiningTNYL-RAW with RT counteracts the negative influence of RT byfurther inhibiting Tregs and M2 macrophages and resulting in aneffective antitumor immune response, enhanced cytotoxic T-cellfunction, and tumor growth suppression. It is also interestingto note that the magnitude of tumor reduction followingTNYL-RAW-Fc administration with RT is similar to immunecheckpoint inhibitor (anti-PDL1 antibody) combined with RTparticularly at early time-points. We further investigated whethercombining EphB4–ephrin-B2 inhibitor with anti-PDL1þRT cangenerate synergistic response, but we failed to observe anyenhanced benefit in the triple combination group in terms oftumor growth reduction in both Ly2 and Moc2 tumor models,suggesting that alternate tumor growth promoting pathwayssuch as EGFR that might be involved in cross-talk with EphB4–ephrin-B2. These further suggests that combined blockade ofthese two pathways might elicit a more effective antitumorresponse. This is not surprising in view of the fact that EGFR-targeted agents have been shown to induce tumor regression bystimulating tumor-specific immune responses (62) and warrantsfurther scrutiny in our tumor models. Nonetheless, our studyprovides supportive evidence suggesting that EphB4–ephrin-B2blockade with RT alters both innate and adaptive arms of theimmune system as demonstrated in both immunocompetentand PDX HNSCCmodels using two different inhibitors targetingthe EphB4–ephrin-B2 axis.

Overall, our study is the first report demonstrating the novelrole of EphB4–ephrin-B2 interaction in remodeling the tumorimmune microenvironment in HNSCC. Our findings offer apotential alternative in the form of EphB4–ephrin-B2 targeted

EphB4–Ephrin-B2 Blockade Remodels Immune TME

www.aacrjournals.org Cancer Res; 79(10) May 15, 2019 2733

on December 5, 2020. © 2019 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst March 20, 2019; DOI: 10.1158/0008-5472.CAN-18-3257

Page 13: Inhibition of EphB4 Ephrin-B2 Signaling Reprograms the Tumor … · Tumor Biology and Immunology Inhibition of EphB4–Ephrin-B2 Signaling Reprograms the Tumor Immune Microenvironment

therapeutics that can be tested in clinical trials in combinationwith RT for the treatment of patients with HNSCC.

Disclosure of Potential Conflicts of InterestD. Raben is a consultant/advisory board member of Astra Zeneca, Merck,

EMD Serono, Nanobiotix, and Genentech. X.-J. Wang is SBIR PI at AllanderBiotechnologies. No potential conflicts of interest were disclosed by the otherauthors.

Authors' ContributionsConception and design: S. Bhatia, A. Oweida, A.C. Mueller, A. Jimeno,E.B. Pasquale, S.D. KaramDevelopment of methodology: S. Bhatia, A. Oweida, D. Milner, B. Van Court,N.J. Serkova, S.D. KaramAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): S. Bhatia, A. Oweida, L.B. Darragh, D. Milner,A.V. Phan, N.J. Serkova, S.D. KaramAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): S. Bhatia, A. Oweida, S. Lennon, D. Milner,N.J. Serkova, E.T. Clambey, E.B. Pasquale, S.D. KaramWriting, review, and/or revision of the manuscript: S. Bhatia, A. Oweida,S. Lennon, L.B. Darragh, A.C. Mueller, D. Raben, N.J. Serkova, X.-J. Wang,E.T. Clambey, E.B. Pasquale, S.D. KaramAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): S.D. KaramStudy supervision: S.D. Karam

AcknowledgmentsThis work was supported by the National Institute of Dental and

Craniofacial Research (to S.D. Karam, 1R01DE028282-01A1), RSNA grant(to S.D. Karam, #RSD1713), Golfer's against Cancer (to S.D. Karam and AJ),Cancer League of Colorado Grant (to S.D. Karam), and P30-CA046934(University of Colorado Cancer Center Support Grant), Paul SandovalGrant, Wings of Hope grant (to S.D. Karam), and Marsico family endowmentfunds. Flow cytometry and CyTOF experiments were performed at theUniversity of Colorado Cancer Center Flow Cytometry Shared Resource(FCSR). Irradiation experiments were performed at the Image-guided mon-itoring and precision radiotherapy Shared Resource. Iron-oxide imagingstudies were performed at the Animal Imaging Shared Resource. We wouldlike to acknowledge the Biostatistics and Bioinformatics shared resource atthe Anschutz Medical Campus for their assistance with RNA-seq/CIBERSORTdata analysis. We would also like to thank Nomin Uyanga and SanjanaBukkapatnam for their technical assistance and Vasgene Therapeutics Inc.,for providing sEphB4-HSA.

The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

Received October 17, 2018; revised January 15, 2019; accepted March 14,2019; published first March 20, 2019.

References1. Szturz P, Vermorken JB. Immunotherapy in head and neck cancer:

aiming at EXTREME precision. BMC Med 2017;15:110. doi: 10.1186/s12916-017-0879-4.

2. Ferris RL, Blumenschein G Jr, Fayette J, Guigay J, Colevas AD, Licitra L, et al.Nivolumab vs. investigator's choice in recurrent or metastatic squamouscell carcinoma of the head and neck: 2-year long-term survival update ofCheckMate 141 with analyses by tumor PD-L1 expression. Oral Oncol2018;81:45–51.

3. Chow LQM, Haddad R, Gupta S, Mahipal A, Mehra R, Tahara M, et al.Antitumor activity of pembrolizumab in biomarker-unselected patientswith recurrent and/or metastatic head and neck squamous cell carcinoma:results from the phase Ib KEYNOTE-012 expansion cohort. J Clin Oncol2016;34:3838–45.

4. Siu LL, Even C, Mesia R, Remenar E, Daste A, Delord JP, et al. Safetyand efficacy of durvalumab with or without tremelimumab inpatients with PD-L1-low/negative recurrent or metastatic HNSCC:the phase II CONDOR Randomized Clinical Trial. JAMA Oncol 2019;5:195–203.

5. Oweida A, Hararah MK, Phan A, Binder D, Bhatia S, Lennon S, et al.Resistance to radiotherapy and PD-L1 blockade is mediated by TIM-3 upregulation and regulatory T-cell infiltration. Clin Cancer Res2018;24:5368–80.

6. Mei J, Xiao Z, Guo C, Pu Q, Ma L, Liu C, et al. Prognostic impact of tumor-associatedmacrophage infiltration innon-small cell lung cancer: a systemicreview and meta-analysis. Oncotarget 2016;7:34217–28.

7. Jie HB, Gildener-Leapman N, Li J, Srivastava RM, Gibson SP, WhitesideTL, et al. Intratumoral regulatory T cells upregulate immunosuppressivemolecules in head and neck cancer patients. Br J Cancer 2013;109:2629–35.

8. Olson OC, Kim H, Quail DF, Foley EA, Joyce JA. Tumor-associatedmacrophages suppress the cytotoxic activity of antimitotic agents.Cell Rep 2017;19:101–13.

9. Arce Vargas F, Furness AJS, Solomon I, Joshi K,Mekkaoui L, LeskoMH, et al.Fc-optimized anti-CD25 depletes tumor-infiltrating regulatory T cells andsynergizes with PD-1 blockade to eradicate established tumors. Immunity2017;46:577–86.

10. Robert C, Schachter J, Long GV, Arance A, Grob JJ, Mortier L, et al.Pembrolizumab versus ipilimumab in advanced melanoma. N Engl J Med2015;372:2521–32.

11. Pasquale EB. Eph-ephrin bidirectional signaling in physiology and disease.Cell 2008;133:38–52.

12. Ferguson BD, Tretiakova MS, Lingen MW, Gill PS, Salgia R. Expression ofthe EPHB4 receptor tyrosine kinase in head and neck and renal malignan-cies–implications for solid tumors andpotential for therapeutic inhibition.Growth Factors 2014;32:202–6.

13. MasoodR, Kumar SR, SinhaUK,CroweDL, KrasnoperovV, Reddy RK, et al.EphB4provides survival advantage to squamous cell carcinomaof the headand neck. Int J Cancer 2006;119:1236–48.

14. OweidaA, Bhatia S,HirschK,CalameD,GriegoA,Keysar S, et al. Ephrin-B2overexpression predicts for poor prognosis and response to therapy in solidtumors. Mol Carcinog 2017;56:1189–96.

15. El-Khoueiry A, Gitlitz B, Cole S, Tsao-Wei D, Goldkorn A, Quinn D, et al. Afirst-in-human phase I study of sEphB4-HSA in patients with advancedsolid tumors with expansion at the maximum tolerated dose (MTD) orrecommended phase II dose (RP2D). Eur J Cancer 2016;69.

16. Bhatia S, Hirsch K, Sharma J,Oweida A, Griego A, Keysar S, et al. Enhancingradiosensitization in EphB4 receptor-expressing head and neck squamouscell carcinomas. Sci Rep 2016;6:38792. doi: 10.1038/srep38792.

17. Bhatia S, Sharma J, Bukkapatnam S, Oweida A, Lennon S, Phan A, et al.Inhibition of EphB4-ephrin-B2 signaling enhances response to cetuximab-radiation therapy in head and neck cancers. Clin Cancer Res 2018;24:4539–50.

18. Braun J, Hoffmann SC, Feldner A, Ludwig T, Henning R, Hecker M, et al.Endothelial cell ephrinB2-dependent activation of monocytes in arterio-sclerosis. Arterioscler Thromb Vasc Biol 2011;31:297–305.

19. Poitz DM, Ende G, Stutz B, Augstein A, Friedrichs J, Brunssen C, et al.EphrinB2/EphA4-mediated activation of endothelial cells increasesmono-cyte adhesion. Mol Immunol 2015;68:648–56.

20. Funk SD, Yurdagul A Jr, Albert P, Traylor JG Jr, Jin L, Chen J, et al. EphA2activation promotes the endothelial cell inflammatory response: apotential role in atherosclerosis. Arterioscler Thromb Vasc Biol 2012;32:686–95.

21. Pfaff D, Heroult M, Riedel M, Reiss Y, Kirmse R, Ludwig T, et al. Involve-ment of endothelial ephrin-B2 in adhesion and transmigration of EphB-receptor-expressing monocytes. J Cell Sci 2008;121:3842–50.

22. Wohlfahrt JG, KaragiannidisC, KunzmannS, EpsteinMM,KempfW, BlaserK, et al. Ephrin-A1 suppresses Th2 cell activation and provides a regulatorylink to lung epithelial cells. J Immunol 2004;172:843–50.

Bhatia et al.

Cancer Res; 79(10) May 15, 2019 Cancer Research2734

on December 5, 2020. © 2019 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst March 20, 2019; DOI: 10.1158/0008-5472.CAN-18-3257

Page 14: Inhibition of EphB4 Ephrin-B2 Signaling Reprograms the Tumor … · Tumor Biology and Immunology Inhibition of EphB4–Ephrin-B2 Signaling Reprograms the Tumor Immune Microenvironment

23. Nguyen TM, Arthur A, Hayball JD, Gronthos S. EphB and Ephrin-Binteractions mediate human mesenchymal stem cell suppression of acti-vated T-cells. Stem Cells Dev 2013;22:2751–64.

24. Kwak H, Salvucci O, Weigert R, Martinez-Torrecuadrada JL, HenkemeyerM, Poulos MG, et al. Sinusoidal ephrin receptor EPHB4 controls hemato-poietic progenitor cellmobilization frombonemarrow. J Clin Invest 2016;126:4554–68.

25. Noberini R, Mitra S, Salvucci O, Valencia F, Duggineni S, Prigozhina N,et al. PEGylation potentiates the effectiveness of an antagonistic peptidethat targets the EphB4 receptor with nanomolar affinity. PLoSOne 2011;6:e28611.

26. KoolpeM, Burgess R,DailM, Pasquale EB. EphB receptor-binding peptidesidentified by phage display enable design of an antagonist with ephrin-likeaffinity. J Biol Chem 2005;280:17301–11.

27. Serkova NJ, Renner B, Larsen BA, Stoldt CR, Hasebroock KM, Bradshaw-Pierce EL, et al. Renal inflammation: targeted iron oxide nanoparticles formolecular MR imaging in mice. Radiology 2010;255:517–26.

28. Oweida A, Lennon S, Calame D, Korpela S, Bhatia S, Sharma J, et al.Ionizing radiation sensitizes tumors to PD-L1 immune checkpoint block-ade in orthotopic murine head and neck squamous cell carcinoma.Oncoimmunology 2017;6:e1356153.

29. Casella G, Garzetti L, Gatta AT, Finardi A, Maiorino C, Ruffini F, et al.IL4 induces IL6-producing M2 macrophages associated to inhibition ofneuroinflammation in vitro and in vivo. J Neuroinflammation 2016;13:139. doi: 10.1186/s12974-016-0596-5.

30. Ying W, Cheruku PS, Bazer FW, Safe SH, Zhou B. Investigation of macro-phage polarization using bone marrow derived macrophages. J Vis Exp2013. doi: 10.3791/50323.

31. Cancer Genome Atlas Research N, Weinstein JN, Collisson EA, Mills GB,Shaw KR, Ozenberger BA, et al. The Cancer Genome Atlas Pan-Canceranalysis project. Nat Genet 2013;45:1113–20.

32. Newman AM, Liu CL, Green MR, Gentles AJ, Feng W, Xu Y, et al. Robustenumeration of cell subsets from tissue expression profiles. Nat Methods2015;12:453–7.

33. Wikenheiser DJ, Stumhofer JS. ICOS Co-Stimulation: Friend or Foe?Front Immunol 2016;7:304. doi: 10.3389/fimmu.2016.00304.

34. Kawano H, Katayama Y, Minagawa K, Shimoyama M, Henkemeyer M,Matsui T.Anovel feedbackmechanismbyEphrin-B1/B2 inT-cell activationinvolves a concentration-dependent switch from costimulation to inhibi-tion. Eur J Immunol 2012;42:1562–72.

35. Holen HL, Shadidi M, Narvhus K, Kjosnes O, Tierens A, Aasheim HC.Signaling through ephrin-A ligand leads to activation of Src-family kinases,Akt phosphorylation, and inhibition of antigen receptor-induced apopto-sis. J Leukoc Biol 2008;84:1183–91.

36. Sharfe N, Freywald A, Toro A, Roifman CM. Ephrin-A1 induces c-Cblphosphorylation and EphA receptor down-regulation in T cells. J Immunol2003;170:6024–32.

37. Gu C, Park S. The EphA8 receptor regulates integrin activity throughp110gamma phosphatidylinositol-3 kinase in a tyrosine kinase activity-independent manner. Mol Cell Biol 2001;21:4579–97.

38. Kim I, RyuYS,KwakHJ, AhnSY,Oh JL, YancopoulosGD, et al. EphB ligand,ephrinB2, suppresses the VEGF- and angiopoietin 1-induced Ras/mitogen-activatedprotein kinasepathway in venous endothelial cells. FASEB J 2002;16:1126–8.

39. Chen W, Jin W, Hardegen N, Lei KJ, Li L, Marinos N, et al. Conversion ofperipheral CD4þCD25- naive T cells to CD4þCD25þ regulatory T cells byTGF-beta induction of transcription factor Foxp3. J Exp Med 2003;198:1875–86.

40. Samaniego R, Palacios BS, Domiguez-Soto A, Vidal C, Salas A, MatsuyamaT, et al. Macrophage uptake and accumulation of folates are polarization-dependent in vitro and in vivo and are regulated by activin A. J Leukoc Biol2014;95:797–808.

41. PostowMA.Managing immune checkpoint-blocking antibody side effects.Am Soc Clin Oncol Educ Book 2015:76–83.

42. Maughan BL, Bailey E, Gill DM, Agarwal N. Incidence of immune-relatedadverse events with program death receptor-1- and program death recep-tor-1 ligand-directed therapies in genitourinary cancers. Front Oncol 2017;7:56. doi: 10.3389/fonc.2017.00056.

43. Mukaida N, Sasaki S, Baba T. Chemokines in cancer development andprogression and their potential as targetingmolecules for cancer treatment.Mediators Inflamm 2014;2014:170381.

44. Jang JE, Hajdu CH, Liot C, Miller G, Dustin ML, Bar-Sagi D. Crosstalkbetween regulatory T cells and tumor-associated dendritic cellsnegates anti-tumor immunity in pancreatic cancer. Cell Rep 2017;20:558–71.

45. Guo Z, Li Y, Zhang D, Ma J. Axl inhibition induces the antitumor immuneresponse which can be further potentiated by PD-1 blockade in the mousecancer models. Oncotarget 2017;8:89761–74.

46. Brand TM, Iida M, Stein AP, Corrigan KL, Braverman CM, Coan JP, et al.AXL is a logical molecular target in head and neck squamous cell carci-noma. Clin Cancer Res 2015;21:2601–12.

47. de Ruiter EJ, Ooft ML, Devriese LA, Willems SM. The prognostic role oftumor infiltrating T-lymphocytes in squamous cell carcinoma of the headand neck: a systematic review andmeta-analysis. Oncoimmunology 2017;6:e1356148.

48. Mandal R, Senbabaoglu Y, Desrichard A, Havel JJ, Dalin MG, Riaz N, et al.The head and neck cancer immune landscape and its immunotherapeuticimplications. JCI Insight 2016;1:e89829.

49. Hanna GJ, Liu H, Jones RE, Bacay AF, Lizotte PH, Ivanova EV, et al.Defining an inflamed tumor immunophenotype in recurrent, meta-static squamous cell carcinoma of the head and neck. Oral Oncol 2017;67:61–9.

50. Schuler PJ, Harasymczuk M, Schilling B, Saze Z, Strauss L, Lang S, et al.Effects of adjuvant chemoradiotherapy on the frequency and function ofregulatory T cells in patients with head and neck cancer. Clin Cancer Res2013;19:6585–96.

51. Concha-Benavente F, Gillison ML, Blumenschein GR, Harrington K,Fayette J, Colevas AD, et al. Characterization of potential predictivebiomarkers of response to nivolumab in CheckMate 141 in patients withsquamous cell carcinoma of the head and neck (SCCHN). J Clin Oncol2017;35:15_suppl:6050.

52. Maj T, Wang W, Crespo J, Zhang H, Wang W, Wei S, et al. Oxidative stresscontrols regulatory T cell apoptosis and suppressor activity and PD-L1-blockade resistance in tumor. Nat Immunol 2017;18:1332–41.

53. Pandiyan P, Zheng L, LenardoMJ. Themolecularmechanismsof regulatoryT cell immunosuppression. Front Immunol 2011;2:60. doi: 10.3389/fimmu.2011.00060.

54. Wang HW, Joyce JA. Alternative activation of tumor-associated macro-phages by IL-4: priming for protumoral functions. Cell Cycle 2010;9:4824–35.

55. Rhee JK, Jung YC, KimKR, Yoo J, Kim J, Lee YJ, et al. Impact of tumor purityon immune gene expression and clustering analyses acrossmultiple cancertypes. Cancer Immunol Res 2018;6:87–97.

56. Lu P, Shih C, Qi H. Ephrin B1-mediated repulsion and signaling controlgerminal center T cell territoriality and function. Science 2017;356. doi:10.1126/science.aai9264.

57. Korff T, Dandekar G, Pfaff D, Fuller T, Goettsch W, Morawietz H, et al.Endothelial ephrinB2 is controlled by microenvironmental determinantsand associates context-dependently with CD31. Arterioscler Thromb VascBiol 2006;26:468–74.

58. Luo H, Yu G, Wu Y, Wu J. EphB6 crosslinking results in costimulation ofT cells. J Clin Invest 2002;110:1141–50.

59. Luo H, Yu G, Tremblay J, Wu J. EphB6-null mutation results in compro-mised T cell function. J Clin Invest 2004;114:1762–73.

60. Petrillo M, Zannoni GF, Martinelli E, Pedone Anchora L, Ferrandina G,Tropeano G, et al. Polarisation of tumor-associated macrophages towardM2 phenotype correlates with poor response to chemoradiation andreduced survival in patients with locally advanced cervical cancer.PLoS One 2015;10:e0136654.

61. Okubo M, Kioi M, Nakashima H, Sugiura K, Mitsudo K, Aoki I, et al. M2-polarizedmacrophages contribute to neovasculogenesis, leading to relapseof oral cancer following radiation. Sci Rep 2016;6:27548. doi: 10.1038/srep27548.

62. Yang X, Zhang X, Mortenson ED, Radkevich-Brown O, Wang Y, Fu YX.Cetuximab-mediated tumor regression depends on innate and adaptiveimmune responses. Mol Ther 2013;21:91–100.

www.aacrjournals.org Cancer Res; 79(10) May 15, 2019 2735

EphB4–Ephrin-B2 Blockade Remodels Immune TME

on December 5, 2020. © 2019 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst March 20, 2019; DOI: 10.1158/0008-5472.CAN-18-3257

Page 15: Inhibition of EphB4 Ephrin-B2 Signaling Reprograms the Tumor … · Tumor Biology and Immunology Inhibition of EphB4–Ephrin-B2 Signaling Reprograms the Tumor Immune Microenvironment

2019;79:2722-2735. Published OnlineFirst March 20, 2019.Cancer Res   Shilpa Bhatia, Ayman Oweida, Shelby Lennon, et al.   Immune Microenvironment in Head and Neck Cancers

Ephrin-B2 Signaling Reprograms the Tumor−Inhibition of EphB4

  Updated version

  10.1158/0008-5472.CAN-18-3257doi:

Access the most recent version of this article at:

  Material

Supplementary

  http://cancerres.aacrjournals.org/content/suppl/2019/03/20/0008-5472.CAN-18-3257.DC1

Access the most recent supplemental material at:

   

   

  Cited articles

  http://cancerres.aacrjournals.org/content/79/10/2722.full#ref-list-1

This article cites 58 articles, 14 of which you can access for free at:

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  [email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/79/10/2722To request permission to re-use all or part of this article, use this link

on December 5, 2020. © 2019 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst March 20, 2019; DOI: 10.1158/0008-5472.CAN-18-3257