GENETIC VARIABILITY OF EQUINE MILK PROTEIN … · 2017-05-03 · 3.5 Mare milk as a substitute in case of cow milk protein allergy ... The use of mare milk in human nutrition has

Aus dem Institut für Tierzucht und Tierhaltung

der Agrar- und Ernährungswissenschaftlichen Fakultät

der Christian-Albrechts-Universität zu Kiel

GENETIC VARIABILITY OF EQUINE MILK

PROTEIN GENES

Dissertation

zur Erlangung des Doktorgrades

der Agrar- und Ernährungswissenschaftlichen Fakultät

der Christian-Albrechts-Universität zu Kiel

Vorgelegt von

M. Sc. agr.

JULIA ELENA MARGOT ELISABETH BRINKMANN

aus Kiel.

Kiel, 2015

Dekan: Prof. Dr. Eberhard Hartung

1. Berichterstatter: Prof. Dr. Georg Thaller

2. Berichterstatter: Prof. Dr. Siegfried Wolffram

Tag der mündlichen Prüfung: 04. 11. 2015

Diese Dissertation wurde mit dankenswerter finanzieller Unterstützung des BMBF im

Rahmen des Kompetenznetzwerkes Food Chain Plus (FoCus) angefertigt

Meiner Familie

TABLE OF CONTENTS

GENERAL INTRODUCTION .................................................................................................. 1

CHAPTER I:

PRODUCTION, COMPOSITION AND UTILIZATION OF MARE MILK ........................... 3

1. Production ........................................................................................................................... 4

1.2. Milking ......................................................................................................................... 5

1.3 Hygiene standards ......................................................................................................... 6

1.4 Equine breeds for dairy production in Germany ........................................................... 6

2. Composition of mare milk .................................................................................................. 7

2.1 Gross composition of mare milk ................................................................................... 8

2.2 Lipid components .......................................................................................................... 8

2.3 Milk proteins ................................................................................................................. 8

2.3.1 Caseins ................................................................................................................. 10

2.3.1.1 αs1-casein ....................................................................................................... 12

2.3.1.2 ß-casein .......................................................................................................... 12

2.3.1.3 αs2-casein ....................................................................................................... 13

2.3.1.4 κ-casein .......................................................................................................... 13

2.3.2 Whey Proteins ...................................................................................................... 14

2.3.2.1 α-Lactalbumin ................................................................................................ 14

2.3.2.2 ß-Lactoglobulin ............................................................................................. 15

3. Utilization of mare milk ................................................................................................... 16

3.1 Disposal ....................................................................................................................... 16

3.2 Mare milk products ..................................................................................................... 16

3.3. Digestibility of mare milk proteins ............................................................................ 17

3.4 Health benefits ............................................................................................................ 18

3.5 Mare milk as a substitute in case of cow milk protein allergy .................................... 18

CHAPTER II:

DNA-BASED ANALYSIS OF PROTEIN VARIANTS REVEALS DIFFERENT GENETIC

VARIABILITY OF THE PARALOGOUS EQUINE ß-LACTOGLOBULIN GENES LGB1

AND LGB2 ............................................................................................................................... 31

CHAPTER III:

GENETIC VARIABILITY OF THE EQUINE CASEIN GENES .......................................... 49

CHAPTER IV:

CHARACTERIZATION OF AN EQUINE αs2-CASEIN VARIANT DUE A 1.3 KB

DELETION SPANNING TWO CODING EXONS ................................................................ 73

GENERAL DISCUSSION ....................................................................................................... 91

GENERAL SUMMARY ........................................................................................................ 107

ALLGEMEINE ZUSAMMENFASSUNG ............................................................................ 111

SUPPLEMENTAL TABLES ................................................................................................. 115

SUPPLEMENTAL FIGURES ............................................................................................... 119

1

GENERAL INTRODUCTION

The use of mare milk in human nutrition has a long tradition, as mare milk was already

mentioned by Homer in the Illiad (8th century BC). Especially nomadic tribes like the

Mongolians practiced the consumption of mare milk since ancient times. As there are several

positive effects of mare milk on human health described, the interest in mare milk arose in

Europe as well. Mare milk is used in naturopathy to cure several diseases; scientific evidence

was found for positive effects of mare milk consumption on cardiovascular diseases, atopic

dermatitis and chronic inflammatory bowel diseases. Nowadays, the mechanism of action of

mare milk was not elucidated.

The health beneficial effects made mare milk attractive for research within the scope of the

competence network Food Chain Plus (FoCus). The FoCus project is a joint research project

with scientists from the fields of agricultural and nutritional sciences, nutritional medicine, as

well as of the dairy and animal feed industry. One of the major goals of the projects is to identify

health promoting milk ingredients.

The composition of mare milk and especially the milk protein fraction is very different from

the composition of bovine milk. Mare milk is lower in fat and protein, but has a high lactose

content, similar to human milk. In ruminants, the protein fraction consists for the main part of

about 90 % of six milk proteins. In horses, these six milk proteins account for more than 70%

of the milk protein fraction. The six main milk proteins are divided into caseins and whey

proteins. The casein fraction can be subdivided into αs1-, ß-, αs2- and κ-casein whereas the main

equine whey proteins are ß-lactoglobulin I, ß-lactoglobulin II and α-lactalbumin, besides these

there are serum albumin, immunoglobulins, lysozyme, lactoferrin and other lesser proteins.

Different genetic variants of these milk proteins have been described in literature, especially in

cattle, sheep and goat several variants are known. Milk protein variants are mostly caused by

nucleotide exchanges within the milk protein encoding genes (CSN1S1, CSN2, CSN1S2, CSN3,

LGB1, LGB2, LALBA), which alter the amino acid sequence of the protein. Likewise, larger

structural variations within the gene (e.g. deletions or duplications) can lead to different milk

proteins. These variants may influence the nutritional value of the milk, as well as milk yield

and processing properties. Due to the altered amino acid sequence of the milk proteins, the

release of bioactive peptides during digestion can be influenced, as well as the allergenic

potential of the milk. As the milk proteins are hence assumed to contribute to the health effects

of mare milk, an extended knowledge about structure and variability of equine milk protein

2

genes is eligible. For this approach, all exons contributing to the open reading frames of the

equine milk protein genes and adjacent intronic regions were resequenced in 198 horses

belonging to 8 breeds. Furthermore, individual whole genome sequence calling data of 55

horses of 10 different breeds were incorporated in the study. For CSN1S2, the gene coding for

equine αs2-casein, part of the DNA-sequencing results were confirmed on RNA and protein

level as well. With this approach, most of the known variants, as well as several new variants

of the equine milk proteins were identified.

Chapter I of the present study gives an overview about the available literature. The production

of mare milk with regard to milking and processing of mare milk is shown as well as a short

overview of the history of the horse as a dairy animal. Furthermore, the composition of mare

milk with special regard to the milk proteins is described. Finally, the utilization of mare milk

as human nutrition is explained. Especially the effects of human health are mentioned

In Chapter II the results of the sequencing of equine LGB1 and LGB2 are illustrated. It was

possible to detect the known variants of the two paralogous genes as well as previously

unknown variants. A provisional nomenclature was established for the variants. The two genes

showed considerably differences in genetic variability, which may indicate different properties

of the two gene products.

Chapter III presents the results of the analysis of the four equine casein genes. Besides known

casein gene variants, several new variants were identified. For these variants a provisional

nomenclature was created. Furthermore, possible evolutionary pathways of these variants are

depicted.

In Chapter IV equine CSN1S2, the gene coding for αs2-casein, was subject to comprehensive

studies. A 1335 bp deletion, involving two coding exons, was substantiated not only on DNA

level, but on RNA and protein level as well. By comparing the obtained sequences with

published sequences, it was possible to show, that the deletion probably occurred before asses

and zebras diverged from the horse lineage.

3

CHAPTER I:

PRODUCTION, COMPOSITION AND UTILIZATION OF MARE MILK

REVIEW

4

1. Production

1.1 History of the horse as a dairy animal

Mare milk in human nutrition and especially in traditional naturopathic medicine has been

known since ancient times. Over the years, several positive effects of mare milk on human

health are empirically described. The oldest reference in literature for the utilization of the horse

as dairy animal can be found in Homer`s Iliad (8th century B.C.). The mare milking Scythians

in the steppes of South Russia are described by Hesiod in his didactic poem “Works and Days”,

as well as by other antique authors like Herodot (5th century B.C.). In the 13th century Marco

Polo refers to the use of mare milk at the Mongolians in his journey reports. Mare milk

production in Europe was established only slowly and sporadically. In the late 19th century there

was one mare milk farm in Austria, specialized on production of kumyß, an alcoholic fermented

beverage with claimed health benefits (Neuhaus, 1959). In 1858 the first mare milk sanatorium

was founded in Samara, Russia (URL 1). With the beginning of the 20th century, mare milk,

and especially kumyß production, became the focus of interest. Several large mare milk farms

were founded on the territory of the former USSR (Neuhaus, 1959). Dr. Rudolf Storch, war

prisoner in Second World War in Russia, brought the mare milk to Germany. During his

captivity, the veterinarian got committed about the quality and claimed health benefits of mare

milk. After his return home he founded the first mare milk farm in 1959 in Germany (URL 1).

Throughout the years, this mare milk farm evolved into the largest mare milk farm in Germany,

managed by descendants of Dr. Storch (URL 2). Today the most dairy herds are still found in

great quantities in the former USSR and in Mongolia, especially in Kazakhstan, Kirghizia

Tadzhikistan, Uzbekistan, in some parts of Russia near Kazakhstan: Kalmukia, Bachkiria, in

Mongolia and its periphery: Buryatia in Sibiria, Inner Mongolia in North China. Furthermore,

equine dairy production is found in Tibet and Xinjiang. In lower quantity, mare milk production

takes place in eastern Europe, particular in Belarus and Ukraine, and in central Europe in

Hungary, Austria, France, Belgium, The Netherlands and Germany (Doreau and Martin-Rosset,

2002; Uniacke-Lowe and Fox, 2012). The extend of mare milk production in Europe is roughly

one million kilogram per year (Fox and Uniacke, 2010).

5

1.2. Milking

Milking of the dairy mare can start between 20 to 45 days postpartum, when the foal is able to

be partly fed on concentrate and forage and to get along with a lesser amount of milk without

negative consequences in growth. Milking lasts 4-6 months (Doreau and Martin-Rosset, 2002).

The mare is separated from her foal for the milking procedure and milked roughly 5 times at

intervals of about 2.5 hours and produces up to 1 – 1.5 litres of milk at each milking (Uniacke-

Lowe, 2011). This procedure varies depending on the farm structure. A complete separation of

the foal, as done in dairy cattle, is not possible, because the mare requires permanent suckling

or milking to sustain lactation (Sixt, 2011). Additionally, the mare has a low udder capacity

(less than 2 litres with 75 – 86% alveolar milk) and the udder needs to be frequently emptied to

avoid a decrease in total milk yield, which can already occur when milking intervals extend 3

hours (Doreau and Martin-Rosset, 2002).

The high proportion of alveolar milk requires a good conditioning of the mares to the milking

procedure, so that milk ejection allows the maximal recovery of secreted milk (Doreau and

Martin-Rosset, 2002). To get the mares accustomed to milking, the transition from suckling to

milking can be improved by milking the mare with the foal in front of her, or milking one teat

while the foal suckles the other. When the mares got used to the milking, oat is offered while

milking (Caroprese et al., 2007). The mare can be milked by hand or by machine (Figure 1),

difficulties in milking can be caused by the two very short teats (Sixt, 2011) and the success of

milking essentially depends on manageability of mares, which shows the stockman`s ability of

a calm handling of the mares and the affinity of the mares to humans (Lansade et al., 2004). It

has been shown, that machine milking is

more efficient than hand milking

(Caroprese et al., 2007).

In Germany, mare milk is produced in

about 40 dairy farms (URL 1), most of

them producing ecologically. The

number of dairy mares varies from under

10 to over 100. In the German mare milk

farms usually a specific bucket milking

machine is used for milking. Only a small

number of farmers practice hand milking,

some farms have a heightened milking

shed, one farm has a tandem milking

Figure 1. Machine milking of a dairy mare

6

parlour for four horses. Which milking technology gets selected by the farm is certainly

dependent on the extent of the particular equine dairy production.

1.3 Hygiene standards

Mare Milk is filtrated after milking, then packaged mostly into 250 ml portions and quick-

frozen at -18 to -30°C (Sixt, 2011). Most equine dairy farms produce the mare milk as attested

milk (Vorzugsmilch, Tierische Lebensmittelhygiene Verordnung Anlage 9, URL 3). The milk

is subject to strict hygienic standards, is very low in germs and not pasteurized to preserve the

immunoglobulins in the milk (URL 1). Attested mare milk has to conform to additional

hygienic standards as compared to raw milk. The mares have to be clinically examined monthly

by veterinarians; furthermore, there must be monthly cytological tests of the milking of the

individual horses. If the somatic cell content exceeds 10.000 cells per millilitres, a

bacteriological test of the milk of each half of the udder is required. The standards for the

processing of the milk are very high as well (Sixt, 2011). Udder health is important for a

successful production of attested milk. Mastitis is very rare among mares and is only observed

if the udder or the teat is injured (Uniacke-Lowe, 2011).

1.4 Equine breeds for dairy production in Germany

Several breeds are used for the mare milk production. Differences between breeds in milk yield

are not clearly established and can often be explained by life weight variations when breeds

have very different adult weights (Doreau and Boulot, 1989). No specific breed is required for

dairy production; any breed can be milked. The crucial factor for selecting a breed as dairy

breed is the acceptance of milking by the mares (Doreau and Martin-Rosset, 2002).

The main dairy breed in Germany is the Haflinger. Also used for dairy production are Heavy

Breeds, Warmblood Horses and special breeds (URL 1). The Haflinger is a small sized breed

(heights at withers 150, life weight up to 500 kg) from Austria and it is known for its dairy

capacity. Also the calm character, good fertility and longevity make the Haflinger a suitable

dairy breed (Doreau and Martin-Rosset, 2002; Nissen, 1997).

A Heavy Breed used in Germany for dairy production is the Russian Heavy Draft Horse, a

breed which is common for dairy production in Russia. The Russian Heavy Draft is a

comparatively small Heavy Breed (~150 cm withers height, up to 700 kg life weight), which is

strong, easy to keep and economical in management and feeding. The horses of this breed

mature early; the foals reach 250 kilograms by weaning. The breed is famous for milk

7

production, can be used up to 25 years and has a good fertility and longevity, all this making

the Russian Heavy Draft an appropriate dairy breed (URL 4, URL 5).

Warmblood Horses are rather uncommon dairy animals, because of their sensitive character.

Nevertheless, mare milk can be a sideline for a Warmblood stud, while the sale of young horses

as sport or leisure horses is the main income. For the offspring of these horses, a potentially

higher market prize in comparison to previously mentioned breeds can be realized.

The expected higher market prices are the main argument for the use of special breeds in the

dairy production. The Icelandic Horse is a small horse (withers height 128 – 143 cm) with a

good health condition, with uncomplicated feedings needs and best fertility. The Icelandic

Horse has two additional gaits, tölt and pace, and is the favoured breed for gait riding in

Germany (Nissen, 1997).

Also used for mare milk production in Germany is the American Quarter Horse. This horse

(withers height 145 – 165 cm) was bred for farm work and is a popular show horse in disciplines

like reining and cutting and a favoured leisure horse and is known to be strong-nerved with

pleasant temperament (URL 7).

Another special breed in the German dairy production is the Argentine Criollo Horse (withers

height 138 – 150 cm). The Criollo is a tough and frugal horse, bred for cow work, today a

popular breed for leisure, trail riding, endurance, as well as show horse in reining and cutting

(URL 7).

2. Composition of mare milk

Milk is an important nutritional source which contains all nutrients for an optimal supply of the

infant. The milks of different species have different compositions, perfectly balanced for the

needs of the own offspring.

The composition of mare milk varies in course of lactation to support the foal best possible.

The colostral phase is comparatively short in horses, 24 -36 h after foaling the composition of

the milk is close to mature milk. As in other species, the colostrum contains more proteins,

immunoglobulins and enzymes especially important for the newborn´s immunity (Uniacke-

Lowe et al., 2010; Salimei and Fantuz, 2012). After the colostral phase, the protein content as

well as the mineral content decreases (Martuzzi and Doreau, 2006).

Further factors which may have an influence on the composition of mare milk are the mare`s

diet, the mineral supplementation of the mare and differences between breeds, although large

8

individual variability makes it difficult to determine a breed effect (Martuzzi and Doreau,

2006).

2.1 Gross composition of mare milk

Mare milk is known to have a composition close to that of human milk. Especially lactose

content as well as protein content and composition are close to that of human milk while bovine

milk is lower in lactose and higher in protein. Mare milk has less fat than human and bovine

milk and milk fatty acid composition differs (Doreau and Martin-Rosset, 2002). The average

energy content in mare milk is lower compared to human milk or bovine milk (Salimei and

Fantuz, 2012) (Table 1).

Table 1. Gross composition of mare milk in comparison to human and bovine milk

Mare Human Bovine

Fat (g kg-1) 12.1 (5 -20) 36.4 (35 – 40) 36.1 (35 -39)

Crude protein (g kg-1) 21.4 (15 – 28) 14.2 (9 – 17) 32.5 (31 – 38)

Lactose (g kg-1) 63.7 (58 – 70) 67.0 (63 – 70) 48.8 (44 – 49)

Ash (g kg-1) 4.2 (3 - 5) 2.2 (2 - 3) 7.6 (7 – 8)

Gross energy (kcal kg-1) 480 (390 – 550) 677 (650 – 700) 674 (650 – 712)

Data from Malacarne et al., 2002; Uniacke-Lowe et al., 2010

Mean values, between brackets minimum - maximum values reported in literature

2.2 Lipid components

Mare milk has a low fat content compared to human or cow`s milk (Tab.1). The fat globules

have a diameter of 2-3 mm (cow 3-5 mm, human ~4 mm). Mare milk fat contains less than 80%

triacylglycerols, while the milk fat of humans or cows is almost totally made of triacylglycerols.

The remaining part of mare milk fat is mainly composed of free fatty acids (~10 %), sterols

(~5%) and phospholipids (~5 %). Mare milk is poorer in stearic and oleic acids and richer in

palmitoleic, linoleic and linolenic acids compared to human and cow`s milk (Doreau and

Martin-Rosset, 2002; Malacarne et al., 2002).

2.3 Milk proteins

The two main fractions of equine milk protein are the caseins, divided into αs1-casein, ß-casein,

αs2-casein and κ-casein, and the whey proteins α-lactalbumin and ß-lactoglobulin. These

9

fractions account for more than 70% of the total protein in equine milk. The remaining part

consists mainly of serum albumin, lactoferrin, and lysozyme.

The composition of equine milk protein is considered to be very similar to that of human milk

regarding casein, whey and NPN content, even though human milk contains no αs2-casein and

no ß-lactoglobulin. Bovine milk has higher casein content compared to equine and human milk,

the whey protein fraction is almost 40% in equine milk, more than 50% in human and less than

20% in bovine milk. The protein fractions of equine milk in comparison to human and bovine

milk are summarized in Table 2.

The high whey protein content of equine milk makes the milk more favourable for human

nutrition than cow`s milk, because of the relatively higher supply of essential amino acids

(Hambræus, 1994; Malacarne et al., 2002).

Table 2. Protein fractions of equine milk

Protein Equine Human Bovine

Casein (g kg-1) 10.7 3.7 25.1

Fractions (%)

αs1-casein 17 13 42

ß-casein 79 66 34

αs2-casein 1.5 - 11

κ-casein 1.5 21 13

Micelles size (nm) 255 64 182

Whey (g kg-1) 8.3 7.6 5.7

Fractions (%)

ß-lactoglobulin 31 - 20

α-lactalbumin 29 42 54

Immunoglobulins 19 18 12

Serum albumin 4 8 6

Lactoferrin 7 30 8

Lysozyme 10 2 Traces

Data are mean values, taken from Salimei and Fantuz, 2012; Inglingstad et al., 2010; Uniacke-Lowe et al., 2010;

Malacarne et al., 2002

10

2.3.1 Caseins

The equine casein fraction is divided in the so called “calcium-sensitive” caseins αs1-casein

(17%), -casein (79%), αs2-casein (1.5%) and the physically and functional linked -casein

(1.5%) (Inglingstad et al., 2010; Malacarne et al., 2002; Miranda et al., 2004; Rijnkels, 2002)

(Table 2). The biological function of caseins is their ability to form macromolecular structures,

the casein micelles (Uniacke-Lowe et al., 2010). The casein micelle keeps the caseins soluble

and allows the transport of calcium and phosphate to the neonate (Alexander et al., 1988).

Especially ß-casein and κ-casein are important for micelle formation and determine micelle size

and curd firmness. Furthermore, κ-casein is important for milk coagulation. These functions are

of high physiology importance for the supply of the suckling infant, so there is a permanent

selection pressure conserving the structure of ß-casein and κ-casein. αs1-casein and αs2-casein

are important for the binding of calcium with phosphorylated amino acid residues. The structure

of these regions is highly conserved, the other regions of these caseins are much less conserved

(Stewart et al., 1987; Lenasi et al., 2003). The micelles in the milk of horses, cows and humans

show considerable differences in size. Equine casein micelles have an average diameter of 255

nm, bovine casein micelles are 182 nm on average. Human casein micelles are much smaller

with an average diameter of 64 nm. The low κ-casein content in equine milk is discussed as

reason for the large micelles (Martuzzi and Doreau, 2006).

The four caseins (αs1-, αs2-, β- and κ-casein) are encoded by four genes mapped to chromosome

3 (ECA 3) in a 290-kb cluster, gene order is CSN1S1 (αs1-CN-encoding gene), CSN2 (β-CN-

encoding gene), CSN1S2 (αs2-CN encoding gene), and CSN3 (κ-CN encoding gene)

(Milenkovic et al., 2002; Egito et al., 2002; Lenasi et al., 2003; Miranda et al., 2004; Girardet

et al., 2006; Miclo et al., 2007; Martin et al., 2009; Selvaggi et al., 2010) (Figure 2). The tight

linkage of casein genes is also observed in bovine species, where the casein cluster is localized

on chromosome 6 (BTA 6) (Threadgill and Womack, 1990), as well as in ovine species

(Leveziel et al., 1991), where the casein locus is found on chromosome 6 (OAR 6) (Phua et al.,

1992).

11

Figure 2. Genomic organization of the equine casein locus.

Caseins: αs1-CN (CSN1S1), β-CN (CSN2), αs2-CN (CSN1S2), κ-CN (CSN3).

A) Genomic organization of the equine casein locus

B) Structural organization of the four casein transcription units (full length). Open bars represent introns,

exons are depicted by grey (5`and 3` untranslated regions), green (part of exon encoding the signal

peptide) and light blue (exons and part of exon encoding for the matured proteins) boxes. Numbers of

exons are listed on top; size of exons is given under each exon in base pairs.

(Modified from Martin et al., 2002; Caroli et al., 2009)

12

2.3.1.1 αs1-casein

The sequence of a fragment of equine αs1-casein cDNA was reported by Milenkovic et al. in

2002. In 2003, Lenasi et al. determined the whole cDNA sequence of equine CSN1S1, from

which the amino acid sequence of equine αs1-casein was deduced. The mature protein contains

205 amino acids and the signaling peptide, a short N-terminal part of the protein, contains 15

amino acids, leading to a pre-form of αs1-casein of 220 amino acids. When the signal peptide

has delivered the protein to its associated location, it is cleaved and provided for digestion

(Williams et al., 2000). Due to its important function, the signal peptide is expected to be highly

conserved. The whole protein results from the reference sequence NM_001081883.1, plus exon

7 (24 bp), which is missing in this sequence. The gene CSN1S1 is divided into 20 exons

spanning over 16.5 kb, with 18 exons contributing to the open reading frame (Figure 2) (Lenasi

et al., 2003).

Beside the full length mRNA sequence of CSN1S1 (Lenasi et al., 2003), 3 kinds of mRNA

sequences probably due to exon skipping are noted for equine CSN1S1. Lenasi et al. (2003)

showed a lack of exon 7 in the mRNA sequence (αs1-casein∆7, GenBank AY040862), and

Milenkovic et al. (2002) isolated equine αs1-casein∆14 (GenBank AY049939). Miranda et al.

(2004) strongly suspected the existence of equine αs1-casein∆7,14. The existence of the four

known isoforms of equine αs1-casein was confirmed by Matéos et al. (2009), even though αs1-

CN∆7 and αs1-CN∆7,14 were observed to be the major isoforms of equine αs1-casein, leading to

the suggestion that exon 7 is mainly involved in the mechanism of alternative splicing.

2.3.1.2 ß-casein

The amino acid sequence of equine ß-casein was discovered by Lenasi et al. (2003), derived

from the cDNA sequence. Miranda et al. (2004) and Girardet et al. (2006) showed the existence

of an additional exon, leading to the insertion of eight amino acids (Glu27 to Lys34). The pre-

form of the protein is 241 amino acids, the cleavage of the 15 amino acids signal peptide leads

to a 226 bp mature protein. This protein results from the reference sequence NM_001081852.1,

plus exon 5 (24 bp), which is missing in this sequence. The gene is divided into 9 exons

spanning over 8.5 kb, with 7 exons belonging to the open reading frame (Figure 2).

Three isoforms of equine ß-casein were described in literature. Isoform 1 is corresponding to

the full length mRNA transcript (Girardet et al., 2006), isoform 2 (ß-CN∆5) is characterized by

the absence of exon 5 (Lenasi et al., 2003) and is the result of exon skipping (Miranda et al.,

2004). Due to the usage of a cryptic splice site, the region Val50 to Gln181, corresponding to the

main part of exon 7, is removed, leading to isoform 3 (Lenasi et al., 2006; Miclo et al., 2007).

13

A further isoform of equine ß-casein was accentuated by Lenasi et al. (2006), which is

characterized by alternative splicing of exon 5 and exon 8. The splicing of exon 8 would result

in a stop codon loss, but a corresponding protein to this splicing variant was not yet identified

in equine milk (Matéos et al., 2009).

2.3.1.3 αs2-casein

Probably due to its low amount, less is known about the equine αs2-casein. Ochirkhuyag et al.

(2000) and Egito et al. (2002; 2001) descried the existence of αs2-casein in mare milk first, this

was confirmed by Miranda et al. (2004).

Recently it was possible to show that there are two different DNA sequences of equine CSN1S2.

The two sequences of equine CSN1S2 are the result of ancient duplication and deletion events

in the equine CSN1S2 gene (Brinkmann et al., 2015). The long variant of the equine CSN1S2

gene has two more coding exons and leads to a 231 amino acids protein including the 15 amino

acids signal peptide, making the mature protein 216 amino acids in length. The short variant

results from 1.3 kb deletion along the CSN1S2 gene. The mRNA sequence encoding for this

variant of equine αs2-casein was directly submitted in 2009 by Martin et al. (GU196267.1).

Including the 15 amino acids signal peptide the pre-form of this protein is 214 amino acids in

length. After the cleavage of the signal peptide a 199 amino acids protein remains. The exon-

intron structure of the full length variant of CSN1S2 is presented in Figure 2.

2.3.1.4 κ-casein

The -casein content of equine milk is very low as well and was subject to discussion for years.

After Ochirkhuyag et al. (2000) did not detect -casein in equine milk, Iametti et al. (2001) and

Miranda et al. (2004) succeeded in providing the evidence of -casein in equine milk. Lenasi

et al. (2003) determined the cDNA sequence of equine κ-casein, from which the amino acid

sequence was deducted. The signal peptide of equine κ-casein is 20 amino acids in length and

the mature protein consists of 165 amino acids. This protein is derived from a 836 bp mRNA

(NM_001081884.1), the gene CSN3 is divided into 5 exons spanning 10.5 kb, 3 exons are part

of the open reading frame (Figure 2).

Hobor et al. (2006; 2008) found two SNPs with predicted effect on the amino acid sequence,

an A to T exchange (c. 383) leads to an isoleucine to lysine exchange (p 128) in the protein, an

A to G exchange (c. 517) leads to an threonine to alanine exchange (p 173).

14

2.3.2 Whey Proteins

Alpha-lactalbumin and β-lactoglobulin represent the major whey proteins in equine milk, each

accounting for roughly 30% of the whey protein fraction, further whey proteins are serum

albumin, immunoglobulins, lysozyme, lactoferrin and other lesser proteins (Table 2). Whereas

serum albumin and immunoglobulins are of hematic origin, α-lactalbumin and β-lactoglobulin

are both of mammary origin (Martuzzi and Doreau, 2006).

2.3.2.1 α-Lactalbumin

Alpha-lactalbumin is present in the milk of all mammals and is besides galactosyltransferase

responsible for the catalysis of the final step in lactose synthesis in the lactating mammary

gland. Furthermore, it has a strong Ca2+-binding site and thus can interact with proteins,

peptides, membranes and low molecular weight organic compounds (Brew, 2013; Permyakov

and Berliner, 2000; Brew et al., 1968). Probably due to its physiological importance, the gene

sequence of α-lactalbumin is highly conserved across species (Simpson and Nicholas, 2002).

The amino acid sequence of equine α-lactalbumin consists of 123 amino acids (Kaminogawa

et al., 1984), the signal peptide is 19 amino acids in length. The mRNA coding for this protein

(XM_001915789.2) is to the current state of knowledge 567 bp in length, divided into four

exons. Part of exon 1 and part of exon 4 are not part of the open reading frame. LALBA, the

gene coding for α-lactalbumin, was assigned to chromosome 6 (ECA 6, NCBI Gene ID

100146585) (Figure 2). Based on protein information, three different variants (A, B and C) of

the equine α-lactalbumin are known, which differ by a few amino acid exchanges (Table 3)

(Kaminogawa et al., 1984; Godovac-Zimmermann et al., 1987).

Table 3. Protein variants of equine Alpha-lactalbumin

Alpha-lactalbumin variant

Position within

protein Ref.Seq.1 A2 B3 C3

26 Glu Glu Gln Gln

52 Ser Ser Asn Asn

97 Asn Asp Asn Asn

114 Ile Ile Asp Ile

1 GenBank accession number NC_009149.2 2 Kaminogawa et al., 1984 3 Godovac-Zimmermann et al., 1987

15

2.3.2.2 ß-Lactoglobulin

Beta-lactoglobulin is absent in the milk of humans, camels, lagomorphs and rodents and

belongs to protein family of the lipocalins (Flower et al., 2000), which have a diverse series of

functions; particularly ligand-binding functions are established. Various functions of ß-

lactoglobulin have been discussed, but no definite physiological function was determined until

today. Beta-lactoglobulin of all species binds retinol, and ß-lactoglobulin of many species, but

not equine or porcine, binds fatty acids (Pérez and Calvo, 1995). Further functions like a

signaling or activity-modulator role are discussed (Kontopidis et al., 2004).

For equine ß-lactoglobulin, two isoforms named ß-lactoglobulin I and ß-lactoglobulin II have

been identified, which are due to the presence of two paralogous genes in horses, as well as in

several other species like the donkey, dog and the dolphin (Pervaiz and Brew, 1986; Halliday

et al., 1993; Godovac-Zimmermann et al., 1990). Three forms of ß-lactoglobulin have been

described in cats (Halliday et al., 1993; Pena et al., 1999). Equine ß-lactoglobulin II comprises

163 amino acids, one more than equine ß-lactoglobulin I, a glycine residue inserted after

position 116 (Halliday et al., 1991). Sequence homology between the two proteins is 70%, the

amino acid sequence differs in 52 positions (Conti et al., 1984; Godovac-Zimmermann et al.,

1985; Uniacke-Lowe et al., 2010). The signal peptide of both proteins consists of 18 amino

acids. LGB1 and LGB2, the genes coding for ß-lactoglobulin I and ß-lactoglobulin II,

respectively, show strong structural similarities and are divided into 7 exons, exons 1 to 6

contribute to the open reading frame. The two genes are located in the same direction in a 20

kb distance on chromosome 25 (NCBI Gene ID100034193 and 100034194) (Conti et al., 1984;

Godovac-Zimmermann et al., 1985; Halliday et al., 1991) (Figure 3).

16

Figure 3. Genomic organization of the whey proteins LGB1, LGB2 and LALBA.

Open bars represent introns, exons are depicted by grey (5`and 3` untranslated regions), green (part of exon

encoding the signal peptide) and light blue (exons and part of exon encoding for the matured proteins) boxes.

Numbers of exons are listed on the top; size of exons is given under each exon in base pairs.

3. Utilization of mare milk

3.1 Disposal

The main part of the in Germany produced mare milk is packaged into 250 ml portions, quick-

frozen and sold by direct marketing via farm shops or internet to the consumer. One litre mare

milk costs about 10 Euro. A smaller part of the produced mare milk is processed to mare milk

products, which are mainly sold by direct marketing as well; the prices depend on the products

and the producers (Sixt, 2011).

3.2 Mare milk products

The primary use of horse milk was mainly the processing to kumyß. This fermented horse milk

drink is of particular importance in Russia and West Asia, such as Kazakhstan and also

Mongolia, where it is also called airag and is the national drink. Kumyß is widely consumed in

17

these countries; the production of kumyß has long tradition. Several health benefits of kumyß

are known, based on empirical knowledge (Doreau and Martin-Rosset, 2002). A Mongolian

adage says “Kumyß cures 40 diseases” (Levine, 1998). Kumyß production is a traditional craft

and lasts 4-6 hours, the end product of fermentation includes lactate and ethanol, due to the

bacteria and yeast which seed the milk. Bacteria mainly belong to Lactobacillus and

Streptococcus species, yeast species are Saccharomyces, Torula, Torulopsis, and Candida. The

flora of kumyß varies depending on the production site. Kumyß contains about 2% alcohol and

it is slightly gaseous. Due to the not standardized processing of kumyß, an unpleasant taste of

the drink, caused by either the proliferation of the yeast or an excess of acidification, may be

problematic (Doreau and Martin-Rosset, 2002). Also in Germany kumyß is produced by a mare

milk farm and sold in 250 ml bottles by direct marketing as well as in pharmacies. Further mare

milk products sold in Germany are mare milk capsules, which contain lyophilized mare milk,

lyophilized mare milk powder, and mare milk drinks on the basis of lyophilized or fermented

horse milk.

Several mare milk cosmetics are also sold. Nowadays, no scientific evidence for the cosmetic

properties of mare milk in comparison to other milks is available, but mare milk has a good

image (Doreau and Martin-Rosset, 2002). A potential reason for the positive effects in

dermatology, which are observed for mare milk, is the lysozyme content. Lysozyme is

efficacious in soothing skin and scalp inflammations (Chiofalo et al., 2006). Products of mare

milk farms in Germany are for example creams, lotions, body washes and soaps.

Cheese making on the basis of mare milk is not possible because mare milk does not coagulate

from chymosin. Mare milk is able to coagulate under acidic conditions, so that not only the low

part of casein in comparison to bovine milk is the limiting factor. Also the low concentration

of κ-casein as well as the low interaction between calcium and caseins and a pH-value up to 7.0

may limit the activity of chymosin (Doreau and Martin-Rosset, 2002).

3.3. Digestibility of mare milk proteins

Equine milk protein is very valuable in human nutrition due to its high digestibility of about

95% and superior amino acid composition (Bos et al., 1999; Inglingstad et al., 2010). The high

digestibility can mainly be ascribed to a high susceptibility of the caseins for hydrolysis by

gastric enzymes. Due to the low content of -casein and the large size of equine casein micelles

a soft and readily digestible coagulum is formed in the stomach. Furthermore, equine milk

showed in vitro rapid duodenal degradation of β-lactoglobulin after 30 min leaving only 25%

18

of the protein intact. In contrast, bovine β-lactoglobulin was significantly less digested, and

more than 60% of the protein remained intact. No explanation for the high digestibility of

equine ß-lactoglobulin was discussed so far. Alpha-lactalbumin is in all species the most

resistant protein to human digestion (Inglingstad et al., 2010).

3.4 Health benefits

Several health beneficial effects of mare milk are empirically known. Various indications for

mare milk consumption in naturopathic medicine are common, from cardiovascular diseases up

to the improvement of general physical health. The knowledge about the effects of mare milk

is mainly based on long experience of Russian sanatoria. Various literature from the former

USSR is available, summarized by Lozovich (1995). Positive effects of mare milk on

gastrointestinal ulcers, digestive and cardiovascular diseases are described. Also diarrhea and

gastritis were treated with mare milk or kumyß, which seem to be more effective than raw milk.

Furthermore, mare milk was used to improve the health of patients suffering from tuberculosis,

chronic hepatitis, anaemia and nephritis. Several reasons for the effectiveness were suggested,

like the fatty acid pattern of mare milk or the high content of lysozyme and lactoferrin. Also

peptides from the hydrolysis of ß-casein may be responsible for health effects of mare milk.

Mare milk and kumyß contain peptides with hypotensive activity, but specific research on

bioactive peptides from mare milk is scarce (Doreau and Martin-Rosset, 2002).

A current study of Chen et al. (2010) describes the isolation of 4 peptides from kumyß, which

have angiotensin I-converting enzyme (ACE) inhibitor activities. ACE inhibitors have been

shown to reduce peripheral blood pressure and exert an antihypertensive effect in vivo. One of

the peptides was identified as part of equine ß-casein. Evidence for the health beneficial effects

of mare milk in case of chronic inflammatory bowel diseases were found in other studies

(Schubert et al., 2009). Also in case of atopic dermatitis mare milk seems to have a positive

effect on human health, especially the pruritus decreased in part of the probands after oral intake

of mare milk (Foekel et al., 2009). The health effects of mare milk are certainly a promising

study subject for the future.

3.5 Mare milk as a substitute in case of cow milk protein allergy

Cow milk allergy (CMA) is an IgE mediated allergenic reaction causing a broad range of

symptoms affecting skin, digestive system or lungs. Possible symptoms are skin rash, eczema,

constipation and infantile colic, as well as wheezing. Further symptoms are possible. This

condition affects approximately 2% of infants when nourished with milk replacements on cow

19

milk basis (Heine et al., 2002). The mechanism of an IgE-mediated CMA consists of 2

subsequent phases. Initially, sensitization leads to the development of allergen-specific memory

T cells and of IgE+ memory B cells, which produce high levels of allergen-specific IgE

antibodies after repeated contact with the allergen. If it comes to a contact with the allergen

again, the specific IgE antibodies on mast cells and basophiles bind via the immunoreactive

structures (epitopes) to the allergen (Valenta, 2002; Lisson, 2014).

Among the Caseins, αs1-casein has been identified as the protein with the highest allergenic

potential and many individuals affected by CMA show a high titre of IgE specific for this

protein (Shek et al., 2005; Ruiter et al., 2006; Gaudin et al., 2008; Schulmeister et al., 2009;

Lisson, 2014). Alpha-lactalbumin and ß-lactoglobulin are the main allergens among the whey

proteins. Even though the amino acid sequence of bovine and human α-lactalbumin shows

sequence homology of about 76%, several studies showed the allergenicity of this protein

(Baldo, 1984; Adams et al., 1991). Beta-lactoglobulin is a major allergen provoking CMA. The

genetic variability and the allergenicity of this protein are described in Chapter II. Beta-

lactoglobulin belongs to the ligand-binding protein family of lipocalins, which are known to be

food and airborne allergens (Mantyjarvi et al., 2000). The fact that ß-lactoglobulin is absent in

human milk is thought to play a role in allergenicity. Furthermore, it is resistant to acid digestion

and thus passes through stomach more or less intact, possibly enhancing its allergenic potential

(Heine et al., 2002). In case of an IgE mediated CMA, mare`s milk may be a possible substitute.

In vitro and in vivo studies have shown mare milk to be tolerated by 96% of the children with

CMA. The absence of relevant IgE binding epitopes in equine milk proteins, probably caused

by differences in the amino acid sequence, has been discussed as possible explanation (Businco

et al., 2000; Curadi et al., 2001). Another reason discussed for the better acceptance of mare

milk in case of CMA is the ratio of whey proteins to caseins, which is close to that in human

milk. It has been shown, that the balance between caseins and whey proteins can be an important

factor in determining the allergenicity of bovine milk proteins (Lara-Villoslada et al., 2005).

Furthermore, the high digestibility of equine ß-lactoglobulin, which is in contrast to bovine and

ovine ß-lactoglobulin highly degraded by gastrointestinal enzymes (Inglingstad et al., 2010),

may reduce its allergenic potential.

Although mare milk seems to be a good substitute in case of CMA, it has to be taken into

account that mare milk protein allergy is possible as well. One case of an IgE mediated allergy

to the proteins in mare milk as a consequence to sensitization to horse dander is reported in

literature (Fanta and Ebner, 1998).

20

References

Adams, S. L., Barnett, D., Walsh, B. J., Pearce, R. J., Hill, D. J., Howden, M. E. 1991. Human

IgE-binding synthetic peptides of bovine beta-lactoglobulin and alpha-lactalbumin. In vitro

cross-reactivity of the allergens. Immunol. Cell Biol. 69 (Pt 3):191–197.

Alexander, L. J., Stewart, A. F., Mackinlay, A. G., Kapelinskaya, T. V., Tkach, T. M.,

Gorodetsky, S. I. 1988. Isolation and characterization of the bovine kappa-casein gene. Eur. J.

Biochem. 178(2):395–401.

Baldo, B. A. 1984. Milk allergies. Aust. J. Dairy Technol.(39):120–128.

Bos, C., Mahé, S., Gaudichon, C., Benamouzig, R., Gausserès, N., Luengo, C., Ferrière, F.,

Rautureau, J., Tomé, D. 1999. Assessment of net postprandial protein utilization of 15N-

labelled milk nitrogen in human subjects. Br. J. Nutr. 81(3):221–226.

Brew, K. 2013. α-Lactalbumin. p. 261–273. In P. L. H. McSweeney, and P. F. Fox (eds.).

Advanced Dairy Chemistry. Springer US.

Brew, K., Vanaman, T. C., Hill, R. L. 1968. The role of alpha-lactalbumin and the A protein

in lactose synthetase: a unique mechanism for the control of a biological reaction. Proc Natl

Acad Sci U S A 59(2):491–497.

Brinkmann, J., Koudelka, T., Keppler, J. K., Tholey, A., Schwarz, K., Thaller, G., Tetens, J.

2015. Characterization of an Equine α-S2-casein Variant due to a 1.3 kb Deletion Spanning

Two Coding Exons. DOI: 10.1371/journal.pone.0139700

Businco, L., Giampietro, P. G., Lucenti, P., Lucaroni, F., Pini, C., Di Felice, G., Iacovacci, P.,

Curadi, C., Orlandi, M. 2000. Allergenicity of mare's milk in children with cow's milk allergy.

J. Allergy Clin. Immunol. 105(5):1031–1034.

Caroli, A. M., Chessa, S., Erhardt, G. J. 2009. Invited review: milk protein polymorphisms in

cattle: effect on animal breeding and human nutrition. J. Dairy Sci. 92(11):5335–5352.

21

Caroprese, M., Albenzio, M., Marino, R., Muscio, A., Zezza, T., Sevi, A. 2007. Behavior,

milk yield, and milk composition of machine-and hand-milked Murgese mares. J. Dairy Sci.

90(6):2773–2777.

Chen, Y., Wang, Z., Chen, X., Liu, Y., Zhang, H., Sun, T. 2010. Identification of angiotensin

I-converting enzyme inhibitory peptides from koumiss, a traditional fermented mare's milk. J.

Dairy Sci. 93(3):884–892.

Chiofalo, B., Drogoul, C., Salimei, E. 2006. Other utilization of mare`s and ass`s milk. p.

133–147. In N. Miraglia, W. Martin-Rosset, and European Association for Animal Production

(eds.). Nutrition and Feeding of the Broodmare: EAAP publication No. 120, Campobasso,

Italy, 20. -22. June 2006. Wageningen Academic Publishers.

Conti, A., Godovac-Zimmermann, J., Liberatori, J., Braunitzer, G. 1984. The primary

structure of monomeric beta-lactoglobulin I from horse colostrum (Equus caballus,

Perissodactyla). Hoppe-Seyler's Z. Physiol. Chem. 365(12):1393–1401.

Curadi, M. C., P. G. Giampietro, P. Lucenti, and M. Orlandi. 2001. Use of mare milk in

pediatric allergology., Firenze, 12.-15.06.2001.

Doreau, M., Boulot, S. 1989. Recent knowledge on mare milk production: A review.

Livestock Production Science 22(3-4):213–235.

Doreau, M., Martin-Rosset, W. 2002. Dairy animals: horse. p. 630–637. In H. Roginski, J. A.

Fuquay, and P. F. Fox (eds.). Encyclopedia of dairy sciences. Academic Press, London, UK.

Egito, A. S., Girardet, J.-M., Miclo, L., Mollé, D., Humbert, G., Gaillard, J. 2001.

Susceptibility of equine κ- and β-caseins to hydrolysis by chymosin. International Dairy

Journal 11(11-12):885–893.

Egito, A. S., Miclo, L., López, C., Adam, A., Girardet, J.-M., Gaillard, J. 2002. Separation

and characterization of mares' milk alpha(s1)-, beta-, kappa-caseins, gamma-casein-like, and

proteose peptone component 5-like peptides. J. Dairy Sci. 85(4):697–706.

22

Fanta, C., Ebner, C. 1998. Allergy to mare's milk. Allergy 53(5):539–540.

Flower, D. R., North, A. C., Sansom, C. E. 2000. The lipocalin protein family: Structural and

sequence overview. Biochimica et Biophysica Acta (BBA) - Protein Structure and Molecular

Enzymology 1482(1-2):9–24.

Foekel, C., Schubert, R., Kaatz, M., Schmidt, I., Bauer, A., Hipler, U.-C., Vogelsang, H.,

Rabe, K., Jahreis, G. 2009. Dietetic effects of oral intervention with mare's milk on the

Severity Scoring of Atopic Dermatitis, on faecal microbiota and on immunological

parameters in patients with atopic dermatitis. Int J Food Sci Nutr 60 Suppl 7:41–52.

Fox, P. F., Uniacke, T. 2010. Chemical and physico-chemical properties of equid milk. p. 39.

In Wageningen Academic Publishers (ed.). Book of Abstracts of the 61st Annual Meeting of

the European Association for Animal Production, Heraklion - Crete Island, Greece, 23-27

August 2010.

Gaudin, J.-C., Rabesona, H., Choiset, Y., Yeretssian, G., Chobert, J.-M., Sakanyan, V.,

Drouet, M., Haertle, T. 2008. Assessment of the immunoglobulin E-mediated immune

response to milk-specific proteins in allergic patients using microarrays. Clin. Exp. Allergy

38(4):686–693.

Girardet, J.-M., Miclo, L., Florent, S., Mollé, D., Gaillard, J. 2006. Determination of the

phosphorylation level and deamidation susceptibility of equine β‐casein. Proteomics

6(12):3707–3717.

Godovac-Zimmermann, J., Conti, A., Liberatori, J., Braunitzer, G. 1985. The amino-acid

sequence of beta-lactoglobulin II from horse colostrum (Equus caballus, Perissodactyla): beta-

lactoglobulins are retinol-binding proteins. Biol. Chem. Hoppe-Seyler 366(6):601–608.

Godovac-Zimmermann, J., Conti, A., Sheil, M., Napolitano, L. 1990. Covalent structure of

the minor monomeric beta-lactoglobulin II component from donkey milk. Biol. Chem.

Hoppe-Seyler 371(9):871–879.

23

Godovac-Zimmermann, J., Shaw, D., Conti, A., McKenzie, H. 1987. Identification and the

primary structure of equine alpha-lactalbumin B and C (Equus caballus, Perissodactyla). Biol.

Chem. Hoppe-Seyler 368(4):427–433.

Halliday, J. A., Bell, K., McAndrew, K., Shaw, D. C. 1993. Feline ß-lactoglobulins I, II and

III, and canine ß-lactoglobulins I and II: amino acid sequences provide evidence for the

existence of more tham one gene for ß-lactoglobulin in the cat and the dog. Protein sequences

& data analysis Journal(5):201–205.

Halliday, J. A., Bell, K., Shaw, D. C. 1991. The complete amino acid sequence of feline β-

lactoglobulin II and a partial revision of the equine β-lactoglobulin II sequence. Biochimica et

Biophysica Acta (BBA) - Protein Structure and Molecular Enzymology 1077(1):25–30.

Hambræus, L. 1994. Milk composition in animals and humans. Nutritional aspects. p. 13–23.

In Proceedings of 1st world congress: Dairy products in human health and nutrition, Madrid,

7–10 June 1993, pp. 13–23.

Heine, R. G., Elsayed, S., Hosking, C. S., Hill, D. J. 2002. Cow's milk allergy in infancy. Curr

Opin Allergy Clin Immunol 2(3):217–225.

Hobor, S., Kunej, T., Dovč, P. 2008. Polymorphisms in the kappa casein (CSN3) gene in

horse and comparative analysis of its promoter and coding region. Anim. Genet. 39(5):520–

530.

Hobor, S., Kunej, T., Lenasi, T., Dovč, P. 2006. Kappa casein gen (CSN3) in horse: Kappa

Casein Gen (CSN3) in Horse: Genetic Variability in Exon 1 and 4. Acta agriculturae

Slovenica 88(2):83–89.

Iametti, B. S., Tedeschi, G., Oungre, E., Bonomi, F. 2001. Primary structure of kappa-casein

isolated from mares' milk. J. Dairy Res. 68(1):53–61.

Inglingstad, R. A., Devold, T. G., Eriksen, E. K., Holm, H., Jacobsen, M., Liland, K. H.,

Rukke, E. O., Vegarud, G. E. 2010. Comparison of the digestion of caseins and whey proteins

24

in equine, bovine, caprine and human milks by human gastrointestinal enzymes. Dairy Sci.

Technol. 90(5):549–563.

Kaminogawa, S., McKenzie, H. A., Shaw, D. C. 1984. The amino acid sequence of equine

alpha-lactalbumin. Biochem Int 9(5):539–546.

Kontopidis, G., Holt, C., Sawyer, L. 2004. Invited review: beta-lactoglobulin: binding

properties, structure, and function. J. Dairy Sci. 87(4):785–796.

Lansade, L., Bertrand, M., Boivin, X., Bouissou, M.-F. 2004. Effects of handling at weaning

on manageability and reactivity of foals. Applied Animal Behaviour Science 87(1-2):131–

149.

Lara-Villoslada, F., Olivares, M., Xaus, J. 2005. The balance between caseins and whey

proteins in cow's milk determines its allergenicity. J. Dairy Sci. 88(5):1654–1660.

Lenasi, T., Peterlin, B. M., Dovč, P. 2006. Distal regulation of alternative splicing by splicing

enhancer in equine beta-casein intron 1. RNA 12(3):498–507.

Lenasi, T., Rogelj, I., Dovč, P. 2003. Characterization of equine cDNA sequences for αS1-, β-

and κ-casein. J. Dairy Res. 70(1):29–36.

Leveziel, H., Metenier, L., Guerin, G., Cullen, P., Provot, C., Bertaud, M., Mercier, J. C.

1991. Restriction fragment length polymorphism of ovine casein genes: close linkage between

the alpha s1-, alpha s2-, beta- and kappa-casein loci. Anim. Genet. 22(1):1–10.

Levine, M. A. 1998. Eating horses: the evolutionary significance of hippophagy. Antiquity

72(275):90–100.

Lisson, M. 2014. Appearance of epitopes in bovine milk protein variants, their allergenicity

and potential use in human nutrition. Zugl.: Gießen, Univ., Diss., 2014. 1. Aufl. Édition

scientifique. VVB Laufersweiler, Gießen.

25

Lozovich, S. 1995. Medical uses of whole and fermented mare milk in Russia. Cultured Dairy

Products Journal(30):18–21.

Malacarne, M., Martuzzi, F., Summer, A., Mariani, P. 2002. Protein and fat composition of

mare's milk: some nutritional remarks with reference to human and cow's milk. International

Dairy Journal 12(11):869–877.

Mantyjarvi, R., Rautiainen, J., Virtanen, T. 2000. Lipocalins as allergens. Biochimica et

Biophysica Acta (BBA) - Protein Structure and Molecular Enzymology 1482(1-2):308–317.

Martin, P. D., Miclo, L., Rebours, E., Matéos, A., Miranda, G. 2009. Equus caballus mRNA

encoding CSN1S2 (alphaS2-casein) precursor (GenBank GU196267). Genetique Animale et

Biologie Integrative (GAI), INRA, Domaine de Vilvert, Jouy-En-Josas 78350, France.

unpublished.

Martin, P. D., Szymanowska, M., Zwierzchowski, L., Leroux, C. 2002. The impact of genetic

polymorphisms on the protein composition of ruminant milks. Reprod Nutr Dev 42(5):433–

459.

Martuzzi, F., Doreau, M. 2006. Mare milk composition:recent findings about protein fractions

and mineral content. p. 65–77. In N. Miraglia, W. Martin-Rosset, and European Association

for Animal Production (eds.). Nutrition and Feeding of the Broodmare: EAAP publication

No. 120, Campobasso, Italy, 20. -22. June 2006. Wageningen Academic Publishers.

Matéos, A., Miclo, L., Mollé, D., Dary, A., Girardet, J.-M., Gaillard, J. 2009. Equine alpha

S1-casein: characterization of alternative splicing isoforms and determination of

phosphorylation levels. J. Dairy Sci. 92(8):3604–3615.

Miclo, L., Girardet, J.-M., Egito, A. S., Mollé, D., Martin, P. D., Gaillard, J. 2007. The

primary structure of a low-Mr multiphosphorylated variant of beta-casein in equine milk.

Proteomics 7(8):1327–1335.

26

Milenkovic, D., Martin, P. D., Guérin, G., Leroux, C. 2002. A specific pattern of splicing for

the horse αS1-Casein mRNA and partial genomic characterization of the relevant locus. Genet

Sel Evol 34(4):509.

Miranda, G., Mahé, M.-F., Leroux, C., Martin, P. D. 2004. Proteomic tools to characterize the

protein fraction of Equidae milk. Proteomics 4(8):2496–2509.

Neuhaus, U. 1959. Milch und Milchgewinnung von Pferdestuten. Zeitschrift für Tierzüchtung

und Züchtungsbiologie 73(1‐4):370–392.

Nissen, J. 1997. Enzyklopädie der Pferderassen: Europa. Kosmos, Stuttgart.

Ochirkhuyag, B., Chobert, J.-M., Dalgalarrondo, M., Haertle, T. 2000. Characterization of

mare caseins. Identification of αS1- and αS2- caseins. Lait 80(2):223–235.

Pena, R. N., Sánchez, A., Coll, A., Folch, J. M. 1999. Isolation, sequencing and relative

quantitation by fluorescent-ratio PCR of feline beta-lactoglobulin I, II, and III cDNAs.

Mamm. Genome 10(6):560–564.

Pérez, M. D., Calvo, M. 1995. Interaction of beta-lactoglobulin with retinol and fatty acids

and its role as a possible biological function for this protein: a review. J. Dairy Sci.

78(5):978–988.

Permyakov, E. A., Berliner, L. J. 2000. α-Lactalbumin: Structure and function. FEBS Letters

473(3):269–274.

Pervaiz, S., Brew, K. 1986. Purification and characterization of the major whey proteins from

the milks of the bottlenose dolphin (Tursiops truncatus), the Florida manatee (Trichechus

manatus latirostris), and the beagle (Canis familiaris). Archives of Biochemistry and

Biophysics 246(2):846–854.

27

Phua, S. H., Collins, L., Wood, N., McNabb, L., Davidson, B., Broad, T., Lewis, P. 1992. An

Eco RI restriction fragment length polymorphism at the ovine locus for alpha 1 type III

collagen (COL3A1). Anim. Genet. 23(5):477.

Rijnkels, M. 2002. Multispecies comparison of the casein gene loci and evolution of casein

gene family. J Mammary Gland Biol Neoplasia 7(3):327–345.

Ruiter, B., Tregoat, V., M'rabet, L., Garssen, J., Bruijnzeel-Koomen, C A F M, Knol, E. F.,

Hoffen, E. 2006. Characterization of T cell epitopes in alphas1-casein in cow's milk allergic,

atopic and non-atopic children. Clin. Exp. Allergy 36(3):303–310.

Salimei, E., Fantuz, F. 2012. Equid milk for human consumption. International Dairy Journal

24(2):130–142.

Schubert, R., Kahle, C., Kauf, E., Hofmann, J., Hobert, I., Gruhn, B., Häfer, R., Vogelsang,

H., Jahreis, G. 2009. Dietetic efficacy of mare’s milk for patients with chronic inflammatory

bowel diseases – clinical study. Ernährung/Nutrition 33(7-8):314–321.

Schulmeister, U., Hochwallner, H., Swoboda, I., Focke-Tejkl, M., Geller, B., Nystrand, M.,

Härlin, A., Thalhamer, J., Scheiblhofer, S., Keller, W., Niggemann, B., Quirce, S., Ebner, C.,

Mari, A., Pauli, G., Herz, U., Valenta, R., Spitzauer, S. 2009. Cloning, expression, and

mapping of allergenic determinants of alphaS1-casein, a major cow's milk allergen. J.

Immunol. 182(11):7019–7029.

Selvaggi, M., Pesce Delfino, A. R., Dario, C. 2010. Exon 1 polymorphisms in the equine

CSN3 gene: SNPs distribution analysis in Murgese horse breed. Anim. Biotechnol.

21(4):252–256.

Shek, L. P. C., Bardina, L., Castro, R., Sampson, H. A., Beyer, K. 2005. Humoral and cellular

responses to cow milk proteins in patients with milk-induced IgE-mediated and non-IgE-

mediated disorders. Allergy 60(7):912–919.

Simpson, K., Nicholas, K. 2002. The Comparative Biology of Whey Proteins. J Mammary

Gland Biol Neoplasia 7(3):313–326.

28

Sixt, M. 2011. Untersuchungen zum Nachweis und zum Vorkommen von Mykotoxinen und

Hemmstoffen in Stutenmilch. Univ., Diss.-Gießen, 2011. 1. Aufl. VVB Laufersweiler Verl.,

Giessen.

Stewart, A. F., Bonsing, J., Beattie, C. W., Shah, F., Willis, I. M., Mackinlay, A. G. 1987.

Complete nucleotide sequences of bovine alpha S2- and beta-casein cDNAs: comparisons

with related sequences in other species. Molecular Biology and Evolution 4(3):231–241.

Threadgill, D. W., Womack, J. E. 1990. Genomic analysis of the major bovine milk protein

genes. Nucleic Acids Res 18(23):6935–6942.

Uniacke-Lowe, T. 2011. Studies on equine milk and comparative studies on equine and

bovine milk systems. PhD Thesis. University College Cork, Cork, Ireland.

Uniacke-Lowe, T., Fox, P. F. 2012. Equid Milk: Chemistry, Biochmistry and Processing. p.

491–530. In B. K. Simpson (ed.). Food Biochemistry and Food Processing. Wiley.

Uniacke-Lowe, T., Huppertz, T., Fox, P. F. 2010. Equine milk proteins: Chemistry, structure

and nutritional significance. International Dairy Journal 20(9):609–629.

Valenta, R. 2002. The future of antigen-specific immunotherapy of allergy. Nat Rev Immunol

2(6):446–453.

Williams, E. J., Pal, C., Hurst, L. D. 2000. The molecular evolution of signal peptides. Gene

253(2):313–322.

URL

(1) http://www.bvds.info (29.08.2015)

(2) http://www.stutenmilch.de/unternehmen/ueber-das-gestuet/chronik (29.08.2015)

(3) http://www.gesetze-im-internet.de/bundesrecht/tier-lmhv/gesamt.pdf (29.08.2015)

29

(4) Dmitriev, N. G.; Ernst, L. K. (Hg.) (1989): Animal genetic resources of the

USSR. FAO. Rome (FAO animal production and health paper, 65)

http://www.fao.org/docrep/009/ah759e/ah759e00.htm (29.08.2015)

(5) Breeds of Lifestock: Russian Heavy Draft. Oklahoma State University.

http://www.ansi.okstate.edu/breeds/horses/ (29.08.2015)

(6) http://www.dqha.de/zucht/zuchtziel/ (29.08.2015)

(7) http://www.criollo-crzvd.de/criollo/rassestandard/ (29.08.2015)

30

31

CHAPTER II:

DNA-BASED ANALYSIS OF PROTEIN VARIANTS REVEALS DIFFERENT

GENETIC VARIABILITY OF THE PARALOGOUS EQUINE ß-LACTOGLOBULIN

GENES LGB1 AND LGB2

J. Brinkmann 1, V. Jagannathan 2,3, C. Drögemüller 2, S. Rieder 3,4, T. Leeb 2, G. Thaller 1 and

J. Tetens 1

1 Institute of Animal Breeding and Husbandry, Christian-Albrechts-University Kiel, Kiel,

Germany

2 Institute of Genetics, University of Bern, Bern, Switzerland

3 Swiss Competence Center of Animal Breeding and Genetics, University of Bern, Bern

University of Applied Sciences HAFL and Agroscope, Bern, Switzerland

4 Agroscope, Swiss National Stud Farm, Avenches, Switzerland

Submitted for Publication in Livestock Science

32

Abstract

The genetic variability of milk protein genes may influence the nutritive value or processing

and functional properties of the milk. While numerous protein variants are known in ruminants,

knowledge about milk protein variability in horses is still limited. Mare’s milk is, however,

produced for human consumption in many countries. Beta-lactoglobulin belonging to the

protein family of lipocalins, which are known as common food- and airborne allergens, is a

major whey protein. It is absent from human milk and thus a key agent in provoking cow’s milk

protein allergy. Mare’s milk is, however, usually better tolerated by most affected people.

Several functions of -lactoglobulin have been discussed, but its ultimate physiological role

remains unclear. In the current study, the open reading frames of the two equine -lactoglobulin

paralogues LGB1 and LGB2 were resequenced in 249 horses belonging to 14 different breeds

in order to predict the existence of protein variants at the DNA-level. Thereby, only a single

signal peptide variant of LGB1, but 10 different putative protein variants of LGB2 were

identified. In horses, both genes are expressed and in such this is a striking previously unknown

difference in genetic variability between the two genes. It can be assumed that LGB1 is the

ancestral paralogue, which has an essential function causing a high selection pressure. As horses

have very low milk fat content this unknown function might well be related to vitamin-uptake.

Further studies are, however, needed, to elucidate the properties of the different gene products.

Keywords: horse, whey proteins, milk protein variants, -lactoglobulin

Implications

Scientific interest in mare milk arose since positive effects on human health were observed.

Furthermore, mare’s milk is discussed as a possible substitute for cow milk in case of a cow

milk protein allergy. An improved knowledge about the protein fraction of mare’s milk and

especially of the genetic structure and variability of the milk protein genes may lead to a better

understanding of these effects. The results of this study are a helpful tool for further research in

allergenicity of mare’s milk as well as well as its effects on human health.

Introduction

Whey proteins account for approximately 40% of total equine milk protein, which is

intermediate between human and bovine milk with shares of about 50% and 20%, respectively.

In most species, α-lactalbumin and β-lactoglobulin represent the major whey proteins, while

33

the latter is absent from the milk of humans, camels, lagomorphs and rodents. In horses, each

of the two proteins accounts for ~30% of the whey protein fraction (Uniacke-Lowe et al., 2010).

Beta-lactoblobulin belongs to the ligand-binding protein family of lipocalins, which are known

to be major food and airborne allergens (Mäntyjärvi et al., 2000). Beta-lactoglobulin generally

binds retinol and in many species also fatty acids, but not in horse or pig (Pérez and Calvo,

1995). Furthermore, roles as signalling molecule or activity-modulator have been discussed

(Kontopidis et al., 2004). However, no definite physiological function of the protein has been

determined until today.

Two fractions of equine ß-lactoglobulin, ß-lactoglobulin I and ß-lactoglobulin II, have been

identified arising from the presence of two paralogous genes. This is also the case in other

species such as donkey and dog, while in cats e.g. even three paralogues are present (Halliday

et al., 1993; Godovac-Zimmermann et al., 1990).

Beta-lactoglobulin is known to be a major allergen provoking cow milk protein allergy (CMA),

an IgE mediated allergenic reaction causing a broad range of symptoms, such as atopic

dermatitis, constipation and infantile colic. This condition affects approximately 2% of infants

when nourished with milk replacements on cow milk basis. In these cases, mare`s milk can be

regarded as a possible substitute, which is better tolerated by most of the affected children

(Businco et al., 2000; Curadi et al., 2001). Moreover, positive effects of mare’s milk

consumption on diseases like atopic dermatitis (Foekel et al., 2009), Morbus Crohn (Schubert

et al., 2009) or cardiovascular diseases (Chen et al., 2010) have been reported.

There are many studies about whey protein variability in cattle and other species (Caroli et al.,

2009; Selvaggi et al., 2014), and also in the donkey different genetic variants of whey proteins

have been reported (Herrouin et al., 2000; Cunsolo et al., 2007; Chianese et al., 2013), but the

knowledge about equine whey proteins genetic variability is limited. However, the presence of

different genetic variants might alter the allergenicity, but also other properties such as the

nutritive value of the milk. Furthermore, milk protein variants are valuable tools for breed

characterizations, biodiversity investigations, and evolutionary studies (Caroli et al., 2009). The

major aim of the current study was therefore to identify genetic -lactoglobulin variants in the

domestic horse. Furthermore, a hypothesis regarding the evolution of different variants was

established.

34

Material and methods

Animals and samples

Genomic DNA was extracted from full blood and hair samples of 198 horses from 8 different

breeds that are actually used for mare’s milk production in Germany applying a modified

protocol according to Miller et al. (1988). The animals were selected to be as unrelated as

possible. Additionally, individual whole genome sequence variant calling data of a total 51

horses of 10 different breeds available from other studies were incorporated in the analyses (for

details on individual coverage see Supplemental Table 1). Bioinformatic details were reported

before (Drögemüller et al., 2014; Frischknecht et al., 2014). In total, 249 horses belonging to

14 different breeds or populations were analyzed (Table 1).

Table 1 Animals used in the sequencing of equine LGB1 and LGB2 (n=249)

Breed Acronym Sanger1 [N] WGS2 [N] Total [N]

Akhal-Teke AK 1 1

Dairy Crossbreed3 CB 21 21

Argentine Criollo Horse CR 27 27

Fjord Horse FJ 3 3

Franches-Montagnes FM 26 26

Haflinger HF 39 1 40

Icelandic Horse IC 25 1 26

Dutch Warmblood (KWPN) WBNL 1 1

Quarter Horse QH 22 3 25

Russian Heavy Draft RU 24 24

Shetlandpony SP 2 2

Swiss Warmblood WBCH 2 2

UK Warmblood WBUK 2 2

German Warmblood WBD 37 12 47

Total 198 51 249

1 Sequencing data from individual Sanger resequencing of open reading frames 2 Sequencing data from Illumina HiSeq whole genome sequencing (WGS) 3 Crossbreed mainly composed of German Riding Pony, Haflinger Horse, Connemara Pony and New Forrest

Pony that has been intuitively bred for higher milk yield

DNA sequencing

A total of 12 Primer pairs (Supplemental Table 2) were designed to amplify all exons

contributing to the open reading frames of the genes and adjacent intronic regions using the

35

Primer 3 software (Rozen and Skaletsky, 2000) based on the genomic reference sequences of

both lactoglobulin genes (Acc. No NC_009168.2).

PCR amplification and DNA sequencing were done as described by Gallinat et al. (2013). The

obtained sequences were analyzed and compared with the genomic reference sequence (Acc.

No. NC_009168.2) using the software Sequencher 4.9 (Gene Codes Corp., Ann Arbor, MI).

Results

The open reading frames of equine LGB1 and LGB2 were successfully sequenced in 223 horses

each (Table 2). The analysis revealed a previously unknown signal peptide variant of the LGB1

gene as well as 10 non-synonymous variants of the LGB2 gene, 8 of which were considered

novel. A preliminary nomenclature was established for these variants. The counted allele

frequencies of the variants of LGB1 and LGB2 in samples of > 15 animals per breed are given

in Table 2.

36

Table 2 Number of successfully sequenced animals per breed and counted allele frequencies for LGB1 and LGB2 variants

LGB1 LGB2

Breed1 N A A* N A B1 B2 C1 C2 D1 D2 E F G

AK 1 +2 + 1 - + + - - - - - - -

CB 19 1 -3 18 0.39 - - 0.16 - - 0.14 0.28 - 0.03

CR 25 1 - 27 0.48 0.24 0.06 0.12 - 0.04 0.06 - - -

FJ 3 + - 2 - - - + - - - - - -

FM 26 1 - 26 0.5 0.04 - 0.27 - 0.11 0.07 - - -

HA 38 1 - 38 0.45 0.02 0.04 0.25 - - 0.2 0.04 - -

IC 23 1 - 25 0.58 - 0.02 0.26 0.02 0.06 0.02 0.04 - -

WBNL4 1 + - 1 + + - - - - - - - -

QH 22 0.98 0.02 19 0.45 0.18 0.06 0.15 - - 0.13 0.03 - -

RD 17 1 - 22 0.93 - - 0.02 - - 0.05 - - -

SP 2 + - 2 + - - + - - - - - -

WBCH4 2 + - 2 + + - + - - - - - -

WBUK4 2 + - 2 + - - + - + - - - -

WBD4 42 1 - 36 0.46 0.38 - 0.05 - - 0.08 - 0.03 -

WBTOTAL4 73 1 - 41 0.45 0.35 - 0.09 - 0.01 0.07 - 0.03 -

1 For an explanation of breed acronyms see Table 1 2 A plus sign indicates that the correspondent variant is present in, but the number of animals is too low to determine allele frequencies (N3) 3 A minus sign indicates that the correspondent variant is not present in that breed 4 Breeds belonging to the European Warmblood population (Dutch, Swiss, UK and German Warmblood) were also analysed jointly as WBTOTAL

37

LGB1

In most of the analyzed animals no differences to the genomic reference sequence

(NC_009168.2:38250776-38255515) were found. Only one Quarter Horse as well as the Akhal-

Teke were found to be heterozygous for a previously unknown A>G transition at position 37

of the open reading frame leading to a predicted amino acid exchange from methionine to valine

at position 13 of the signal peptide.

LGB2

Eight nonsynonymous mutations were identified within the LGB2 gene, 5 of which were

previously undescribed. Based on the observed genotypes, the presence of 10 distinct protein

variants was predicted. Preliminary designations (LGB2*A – LGB2*G) were assigned to these

variants, which will be used throughout the following sections; for details see Table 3 and

Figure 1.

The most common and probably ancestral (see below) LGB2 variant, which was thus designated

LGB*A did occur in all breeds except for Fjord Horses and the single Akhal-Teke. It differs

from the genomic GenBank reference sequence (NC_009168.2:38266531-38271345) in a

single position corresponding the 164th nucleotide of the open reading frame leading to the

presence of alanine in position 55 of the protein (Table 3 and Figure 1). In this position, the

reference sequence NC_009168.2 codes for valine; the variant was termed LGB*B1. It was

present in most of the examined breed samples except for the crossbred ponies, Fjord Horses,

Icelandic Horses, Russian Heavy Drafts, Shetlandponies and UK-Warmbloods. The presence

of an additional transversion (c.394 G>T; Ala132Ser) that was found in Akhal-Teke, Criollo

Horses, Haflinger Horses, Icelandic Horses and Quarter Horses leads to variant LGB2*B2. In

most breeds but Fjord Horses and Dutch Warmblood, a variant denoted as LGB2*C1 was

identified that differs from variant A by an additional nonsynonymous transition at position 230

of the coding sequence (p.Arg77His). A further nucleotide exchange leading to a predicted

replacement of alanine by threonine on position 83 of the protein, which was only found in the

Icelandic Horse, differentiates LGB*C2 from that variant. Only in Criollos, Franches-

Montagnes and Icelandic Horses, variant LGB2*D1 was found, which differs from variant A

by the presence of an additional mutation in position 157 of the open reading frame (c.157

G>A; p.Glu53Lys), also present in the mRNA reference sequence NM_001082494). A further

nonsynonymous exchange (c.515 G>C; p.Pro172Arg) leads to variant LGB2*D2, which

completely corresponds to the mRNA reference sequence (NM_001082494).This variant was

38

found at low frequencies in most of the breeds except for Akhal-Teke, Fjord Horses, Dutch

Warmblood, Shetlandponies, Swiss Warmblood, and UK-Warmblood. Particularly in the

crossbreed, but also in Haflinger, Icelandic Horses and Quarter Horses, variant LGB2*E was

found. This variant shows a nonsynonymous transversion in position 520 of the coding

sequence (c.520 G>C; p.Gly174Arg) as compared to variant A. The same mutation but in

conjunction with the mutation defining LGB2*B1 characterizes LGB2*G, which most likely

arose by recombination and was only detected in the crossbred ponies. Very rare and only found

in the German Warmblood Horse was variant LGB2*F, which differs from variant A by a

transversion from A to T in position 70 of the open reading frame leading to a predicted

exchange of threonin for serin in codon 24.

Table 3 Sequence variation and resulting amino acid substitutions for LGB2 variants

Position1

LGB2 variant

A B12 B2 C1 C2 D1 D23 E F G4

70

24

ACG

Thr

TCG

Ser

157

53

GAG

Glu

AAG

Lys

AAG

Lys

164

55

GCC

Ala

GTC

Val

GTC

Val

GTC

Val

230

77

CGC

Arg

CAC

His

CAC

His

247

83

GCA

Ala

ACA

Thr

394

132

GCT

Ala

TCT

Ser

515

172

CCG

Pro

CTG

Leu

520

174

GGG

Gly

CGG

Arg

CGG

Arg

1 The upper number denotes the position within the coding sequence and the lower number within the protein 2 Variant B1 corresponds to the genomic reference sequence (NC_009168.2:38266531-38271345) 3 Variant D2 corresponds to mRNA sequence NM_001082494 4 Variant G is probably a recombinant between variants B1 and E

39

Discussion

Methodology

In the current study, we resequenced the open reading frames of the equine LGB1, and LGB2

genes to identify putative protein variants at the DNA level. This is advantageous over protein

analyses, because DNA material such as hair samples can more easily be obtained than milk

samples. Furthermore, DNA sequencing directly identifies the mutations underlying the protein

variants and is also able to detect variation that only causes minor changes of the protein

properties, which can go undetected in standard protein analyses. However, nothing can be said

about the actual expression of the variants or mutations that affect splicing (Gallinat et al.,

2013). Thus, the designations assigned to the variants identified at the DNA level within this

study have to be regarded as preliminary and are subject to confirmation.

Although focussed on breeds that are actually kept for milk production, this study covers a

comparatively wide range of partly distantly related breeds, which increases the amount of

variation. The sample size per breed is, however, small so that the counted allele frequencies

have to be taken with care.

Breed specific variation

Only little variability was found in LGB1, while 10 different variants were found in LGB2. The

highest degree of variability was seen in the Icelandic Horses with 7 variants one of which was

private to the breed (LGB2*C2) This is notable as the breed originates from a small founder

population brought to Iceland approximately 1100 years ago and remained isolated since then

(Adalsteinsson, 1981). However, it has to be taken into account that samples were not collected

on Iceland, because Hreidarsdóttir et al. (2014) reported a higher diversity in terms of effective

founders for abroad as compared to the Icelandic population.

In each the Criollo, Haflinger and Quarter Horse breeds, 6 different variants of LGB2 were

detected. Notably, the variant LGB2*D1 occurs in Criollos and Icelandic Horses, but also in

Franches-Montagnes at a considerable frequency (Table 2). The lowest amount of variability

was found in the Russian Heavy Drafts, which almost uniformly carried variant LGB2*B with

an allele frequency of 0.93. This breed has been founded in the 1860s by grading up native

horses with Ardennes. The first world war, followed by the civil war, nearly wiped out the

breed, the stock of purebreds was reconstituted and isolated as an independent breed not before

1937 (Dmitriev and Ernst, 1989). Thus, the breed faced a serious bottleneck, which might be

an explanation for the low amount of variation.

40

The Warmblood samples from different countries (Germany, Switzerland, United Kingdom and

The Netherlands) can principally be considered belonging to the same horse breed or to be at

least very similar. Thus, these samples were also jointly analyzed revealing that the major

variants in this breed are LGB2*A and B1. This is different from Franches-Montagnes Horses,

which can also be considered as heavy Warmbloods, as variant B1 is rare in this breed, while

C1 is rather common.

Evolution of LGB2 variants

Due to the small sample size, conclusions about the evolution of the identified gene variants of

LGB2 are difficult, especially for rare variants. The determination of a variant is only

unequivocally possible on haplotypes with not more than one heterozygous position. On the

basis of the available information, we derived a simple model for the evolution of variants under

the constraint of as few mutations as possible (Figure 1).

The variant LGB2*A was also found by BLAST analysis in the LGB2 sequence of the donkey

(Equus asinus, lactoglobulin II variants B and C, GenBank accession number HM012799.1 and

HM012800.1). The domestic donkey represents a sister lineage of modern horses and shares a

most common recent ancestor with horses 4.0 – 4.5 Mya ago (Orlando et al., 2013) indicating

that LGB2*A is an ancestral variant.

Variant LGB2*B1 is also common in most of the examined breeds and was assumed to have

evolved from variant LGB2*A as a result of a single nucleotide exchange (c.164 C>T). From

this variant, LGB2*B2 evolved by means of an additional nonsynonymous mutation

(c.394G>T; p.Ala132Ser). The variants LGB2*C1, LGB2*D1, LGB2*E, and LGB2*F (c.164

T>G) each differ in a single amino acid position from variant A (Table 3 and Figure 1).

Subsequent mutations of variants C1 and D1 could have given rise to the variants LGB2*C2

and LGB2*D2. Finally, we observed variant LGB2*G, which is only present in the crossbred

animals and is characterized by the presence of both the mutations defining variants B1 and E,

respectively. Thus, it probably represents a recombinant haplotype.

41

Figure 1 Most likely evolution of equine LGB2 gene variants

Variability and function

The two paralogous lactoglobulin genes LGB1 (Gene ID 100034193) and LGB2 (Gene ID

100034194) are located adjacently on equine chromosome 25 with a distance of ~10 kbp.

Equine ß-lactoglobulin II comprises 163 amino acids, one more than equine ß-lactoglobulin I

(Halliday et al., 1991). Sequence homology between the two proteins is 70%, the amino acid

sequence differs in 52 positions (Conti et al., 1984; Godovac-Zimmermann et al., 1985). In

contrast to ruminants, which have been shown to possess LGB pseudogenes (Passey and

Mackinlay, 1995; Folch et al., 1996), both genes are expressed. In the current study, LGB1 was

found to be strongly conserved across breeds, while LGB2 was highly variable. This indicates

a higher selective pressure on LGB1 and suggests that it is the ancestral paralogue, which has a

crucial function that has to be maintained. The actual function of -lactoglobulin has, however,

not been determined to date. It seems likely that it acts as a transporter, which is the case for

many lipocalins (Kontopidis et al., 2004). Beta-lactoblobulin has been shown to bind small

42

hydrophobic compounds such as retinol and other lipophilic vitamins (Kontopidis et al., 2004;

Mensi et al., 2013), isothiocyanate (Keppler et al., 2014), and various polyphenols (Riihimäki

et al., 2008; Wu et al., 2013) as well as fatty acids, which is, however, not the case for equine

-lactoglobulin (Pérez and Calvo, 1995). Especially the role as a transporter for retinol and

carotenoids has been discussed, but it has been argued that retinol is highly soluble in the fat

phase of milk and will probably be transported from mother to offspring by that route

(Kontopidis et al., 2004). Equine milk, however, has a low fat content making it possible that

this function is more essential in horses than in other species with a higher fat content such as

cattle or humans. In fact, bovine -lactoglobulin is much more variable than equine -

lactoglobulin (Caroli et al., 2009) and the protein is completely absent from human milk

(Uniacke-Lowe et al., 2010). It seems possible, that the definite function of ß-lactoglobulin

varies from species to species (Kontopidis et al., 2004).

Allergenic potential

Lipocalins are common food and airborne allergens (Mäntyjärvi et al., 2000). In case of a cow

milk protein allergy (CMA), ß-lactoglobulin appears to be the main allergen, especially because

it is absent from human milk and resistant to acid digestion, especially in cattle and goats (Heine

et al., 2002). Inglingstad et al. (2010) showed that equine ß-lactoglobulin on the other hand is

highly degraded by gastrointestinal enzymes. Furthermore, in vitro and in vivo studies have

shown that mare’s milk is tolerated by 96% of the children with CMA. The absence of relevant

IgE binding epitopes in equine milk proteins, probably caused by differences in the amino acid

sequence, has been discussed as possible explanation (Businco et al., 2000; Curadi et al., 2001).

Also donkey’s milk is better tolerated by CMA patients (Iacono et al., 1992; Monti et al., 2012),

which has been linked to quantitative LGB2 polymorphisms leading to a very low -

lactoglobulin content (Chianese et al., 2013).

For cattle, it has been shown that genetic milk protein variants are leading to modifications of

the relevant epitopes and thus do change the allergenic potential of milk (Lisson et al., 2013).

It would thus be worth investigating how the high degree of variability at the equine LGB2

locus affects allergenicity of mare’s milk.

Acknowledgements

This project was founded by the German Federal Ministry of Education and Research (Bonn,

Germany) within the competence network “Food Chain Plus” (FoCus, grant no. 0315539A).

43

The authors would like to thank all the mare’s milk producers for providing samples, Julia

Tetens for her help with sample collection and Gabriele Ottzen-Schirakow for expert technical

assistance.

References

Adalsteinsson, S. 1981. Origin and conservation of farm animal populations in Iceland.

Zeitschrift für Tierzüchtung und Züchtungsbiologie 98(1-4):258–264.

Businco, L., Giampietro, P. G., Lucenti, P., Lucaroni, F., Pini, C., Di Felice, G., Iacovacci, P.,

Curadi, C., Orlandi, M. 2000. Allergenicity of mare’s milk in children with cow’s milk

allergy. Journal of Allergy and Clinical Immunology 105(5):1031–1034.

Caroli, A. M., Chessa, S., Erhardt, G. J. 2009. Invited review: milk protein polymorphisms in

cattle: effect on animal breeding and human nutrition. J. Dairy Sci. 92(11):5335–5352.

Chen, Y., Wang, Z., Chen, X., Liu, Y., Zhang, H., Sun, T. 2010. Identification of angiotensin

I-converting enzyme inhibitory peptides from koumiss, a traditional fermented mare's milk. J.

Dairy Sci. 93(3):884–892.

Chianese, L., Simone, C. de, Ferranti, P., Mauriello, R., Costanzo, A., Quarto, M., Garro, G.,

Picariello, G., Mamone, G., Ramunno, L. 2013. Occurrence of qualitative and quantitative

polymorphism at donkey beta-Lactoglobulin II locus. Food. Res. Int. 54(1):1273–1279.

Conti, A., Godovac-Zimmermann, J., Liberatori, J., Braunitzer, G., MINORI, D. 1984. The

Primary Structure of Monomeric β-Lactoglobulin I from Horse Colostrum (Equus caballus,

Perissodactyla). Physiol. Chem. Hoppe-Seyler 365(2):1393–1402.

Cunsolo, V., Costa, A., Saletti, R., Muccilli, V., Foti, S. 2007. Detection and sequence

determination of a new variant beta-lactoglobulin II from donkey. Rapid Commun. Mass

Spectrom. 21(8):1438–1446.

Curadi, M. C., P. G. Giampetro, P. Lucenti, and M. Orlandi. 2001. Use of mare milk in

pediatric allergology., Firenze, 12.-15.06.2001.

44

Dmitriev, N. G., and L. K. Ernst. 1989. Animal genetic resources of the USSR. FAO animal

production and health paper 65, Rome.

Drögemüller, M., Jagannathan, V., Welle, M. M., Graubner, C., Straub, R., Gerber, V.,

Burger, D., Signer-Hasler, H., Poncet, P.-A., Klopfenstein, S., Niederhäusern, R. von, Tetens,

J., Thaller, G., Rieder, S., Drögemüller, C., Leeb, T. 2014. Congenital hepatic fibrosis in the

Franches-Montagnes horse is associated with the polycystic kidney and hepatic disease 1

(PKHD1) gene. PloS ONE 9(10):e110125.

Foekel, C., Schubert, R., Kaatz, M., Schmidt, I., Bauer, A., Hipler, U.-C., Vogelsang, H.,

Rabe, K., Jahreis, G. 2009. Dietetic effects of oral intervention with mare's milk on the

Severity Scoring of Atopic Dermatitis, on faecal microbiota and on immunological

parameters in patients with atopic dermatitis. Int J Food Sci Nutr 60 Suppl 7:41–52.

Folch, J. M., Coll, A., Hayes, H. C., Sànchez, A. 1996. Characterization of a caprine beta-

lactoglobulin pseudogene, identification and chromosomal localization by in situ

hybridization in goat, sheep and cow. Gene 177(1-2):87–91.

Frischknecht, M., Neuditschko, M., Jagannathan, V., Drögemüller, C., Tetens, J., Thaller, G.,

Leeb, T., Rieder, S. 2014. Imputation of sequence level genotypes in the Franches-Montagnes

horse breed. Genet. Sel. Evol. 46:63.

Gallinat, J. L., Qanbari, S., Drögemüller, C., Pimentel, E. C. G., Thaller, G., Tetens, J. 2013.

DNA-based identification of novel bovine casein gene variants. J. Dairy Sci. 96(1):699–709.

Godovac-Zimmermann, J., Conti, A., Liberatori, J., Braunitzer, G. 1985. The amino-acid

sequence of beta-lactoglobulin II from horse colostrum (Equus caballus, Perissodactyla):

beta-lactoglobulins are retinol-binding proteins. Biol. Chem. Hoppe-Seyler 366(6):601–608.

Godovac-Zimmermann, J., Conti, A., Sheil, M., Napolitano, L. 1990. Covalent structure of

the minor monomeric beta-lactoglobulin II component from donkey milk. Biol. Chem.

Hoppe-Seyler 371(9):871–879.

45

Halliday, J. A., Bell, K., McAndrew, K., Shaw, D. C. 1993. Feline ß-lactoglobulins I, II and

III, and canine ß-lactoglobulins I and II: amino acid sequences provide evidence for the

existence of more tham one gene for ß-lactoglobulin in the cat and the dog. Protein Sequences

& Data Analysis Journal(5):201–205.

Halliday, J. A., Bell, K., Shaw, D. C. 1991. The complete amino acid sequence of feline beta-

lactoglobulin II and a partial revision of the equine beta-lactoglobulin II sequence. Biochim.

Biophys. Acta 1077(1):25–30.

Heine, R. G., Elsayed, S., Hosking, C. S., Hill, D. J. 2002. Cow's milk allergy in infancy. Curr

Opin Allergy Clin Immunol 2(3):217–225.

Herrouin, M., Mollé, D., Fauquant, J., Ballestra, F., Maubois, J. L., Léonil, J. 2000. New

genetic variants identified in donkey's milk whey proteins. J. Protein Chem. 19(2):105–115.

Hreidarsdóttir, G., Árnason, T., Svansson, V., Hallson, J. 2014. Analysis of the history and

population structure of the Icelandic horse using pedigree data and DNA analyses. Icel. Agric.

Sci.(27):63–79.

Iacono, G., Carroccio, A., Cavataio, F., Montalto, G., Soresi, M., Balsamo, V. 1992. Use of

ass' milk in multiple food allergy. J. Pediatr. Gastroenterol. Nutr. 14(2):177–181.

Inglingstad, R. A., Devold, T. G., Eriksen, E. K., Holm, H., Jacobsen, M., Liland, K. H.,

Rukke, E. O., Vegarud, G. E. 2010. Comparison of the digestion of caseins and whey proteins

in equine, bovine, caprine and human milks by human gastrointestinal enzymes. Dairy

Science & Technol. 90(5):549–563.

Keppler, J. K., Koudelka, T., Palani, K., Stuhldreier, M. C., Temps, F., Tholey, A., Schwarz,

K. 2014. Characterization of the covalent binding of allyl isothiocyanate to β-lactoglobulin by

fluorescence quenching, equilibrium measurement, and mass spectrometry. J. Biomol. Struct.

Dyn. 32(7):1103–1117.

Kontopidis, G., Holt, C., Sawyer, L. 2004. Invited review: beta-lactoglobulin: binding

properties, structure, and function. J. Dairy Sci. 87(4):785–796.

46

Lisson, M., Lochnit, G., Erhardt, G. 2013. Genetic variants of bovine β- and κ-casein result in

different immunoglobulin E-binding epitopes after in vitro gastrointestinal digestion. J. Dairy

Sci. 96(9):5532–5543.

Mäntyjärvi, R., Rautiainen, J., Virtanen, T. 2000. Lipocalins as allergens. Biochim. Biophys.

Acta 1482(1-2):308–317.

Mensi, A., Choiset, Y., Rabesona, H., Haertlé, T., Borel, P., Chobert, J.-M. 2013. Interactions

of β-lactoglobulin variants A and B with Vitamin A. Competitive binding of retinoids and

carotenoids. J. Agric. Food Chem. 61(17):4114–4119.

Miller, S. A., Dykes, D. D., Polesky, H. F. 1988. A simple salting out procedure for extracting

DNA from human nucleated cells. Nucleic Acids Res. 16(3):1215.

Monti, G., Viola, S., Baro, C., Cresi, F., Tovo, P. A., Moro, G., Ferrero, M. P., Conti, A.,

Bertino, E. 2012. Tolerability of donkey's milk in 92 highly-problematic cow's milk allergic

children. J. Biol. Regul. Homeost. Agents 26(3 Suppl):75–82.

Orlando, L., Ginolhac, A., Zhang, G., Froese, D., Albrechtsen, A., Stiller, M., Schubert, M.,

Cappellini, E., Petersen, B., Moltke, I., Johnson, P. L. F., Fumagalli, M., Vilstrup, J. T.,

Raghavan, M., Korneliussen, T., Malaspinas, A.-S., Vogt, J., Szklarczyk, D., Kelstrup, C. D.,

Vinther, J., Dolocan, A., Stenderup, J., Velazquez, A. M. V., Cahill, J., Rasmussen, M.,

Wang, X., Min, J., Zazula, G. D., Seguin-Orlando, A., Mortensen, C., Magnussen, K.,

Thompson, J. F., Weinstock, J., Gregersen, K., Røed, K. H., Eisenmann, V., Rubin, C. J.,

Miller, D. C., Antczak, D. F., Bertelsen, M. F., Brunak, S., Al-Rasheid, K. A. S., Ryder, O.,

Andersson, L., Mundy, J., Krogh, A., Gilbert, M. T. P., Kjær, K., Sicheritz-Ponten, T., Jensen,

L. J., Olsen, J. V., Hofreiter, M., Nielsen, R., Shapiro, B., Wang, J., Willerslev, E. 2013.

Recalibrating Equus evolution using the genome sequence of an early Middle Pleistocene

horse. Nature 499(7456):74–78.

Passey, R. J., Mackinlay, A. G. 1995. Characterisation of a Second, Apparently Inactive,

Copy of the Bovine beta-lactoglobulin Gene. Eur J Biochem 233(3):736–743.

47

Pérez, M. D., Calvo, M. 1995. Interaction of beta-lactoglobulin with retinol and fatty acids

and its role as a possible biological function for this protein: a review. J. Dairy Sci.

78(5):978–988.

Riihimäki, L. H., Vainio, M. J., Heikura, J. M. S., Valkonen, K. H., Virtanen, V. T., Vuorela,

P. M. 2008. Binding of phenolic compounds and their derivatives to bovine and reindeer beta-

lactoglobulin. J. Agric. Food Chem. 56(17):7721–7729.

Rozen, S., Skaletsky, H. 2000. Primer3 on the WWW for general users and for biologist

programmers. Methods Mol. Biol. 132:365–386.

Schubert, R., Kahle, C., Kauf, E., Hofmann, J., Hobert, I., Gruhn, B., Häfer, R., Vogelsang,

H., Jahreis, G. 2009. Dietetic efficacy of mare’s milk for patients with chronic inflammatory

bowel diseases – clinical study. Ernährung/Nutrition 33(7-8):314–321.

Selvaggi, M., Laudadio, V., Dario, C., Tufarelli, V. 2014. Major proteins in goat milk: an

updated overview on genetic variability. Molecular biology reports 41(2):1035–1048.

Uniacke-Lowe, T., Huppertz, T., Fox, P. F. 2010. Equine milk proteins: Chemistry, structure

and nutritional significance. International Dairy Journal 20(9):609–629.

Wu, X., Dey, R., Wu, H. U., Liu, Z., He, Q., Zeng, X. 2013. Studies on the interaction of -

epigallocatechin-3-gallate from green tea with bovine β-lactoglobulin by spectroscopic

methods and docking. Int J Dairy Technol 66(1):7–13.

48

49

CHAPTER III:

GENETIC VARIABILITY OF THE EQUINE CASEIN GENES

J. Brinkmann 1, V. Jagannathan 2,3, C. Drögemüller 2,3, S. Rieder 3,4, T. Leeb 2,3, G. Thaller 1

and J. Tetens 1

1 Institute of Animal Breeding and Husbandry, Christian-Albrechts-University Kiel, Kiel,

Germany

2 Institute of Genetics, University of Bern, Bern, Switzerland

3 Swiss Competence Center of Animal Breeding and Genetics, University of Bern, Bern

University of Applied Sciences HAFL and Agroscope, Bern, Switzerland

4 Agroscope, Swiss National Stud Farm, Avenches, Switzerland

Submitted for Publication to Journal of Dairy Science

50

Interpretive Summary

Mare milk is known to exhibit several positive effects on human health. Furthermore, mare

milk can be used as hypoallergenic foodstuff in case of cow milk protein allergy. With this

study, the knowledge about the structure and genetic variability of the equine casein genes was

improved. A total of 31 putative casein gene isoforms were detected by re-sequencing of the

four casein genes CSN1S1, CSN2, CSN1S2 and CSN3, 26 of them were considered novel. The

results are a useful tool for further studies about effects of mare milk on human health.

Abstract

The casein genes are known to be highly variable in typical dairy species such as cattle and

goat, but the knowledge about equine casein genes is limited. Nevertheless, mare’s milk

production and consumption is gaining more and more importance because of its high nutritive

value, use in naturopathy and hypoallergenic properties with respect to cow milk protein

allergy. In the current study, the open reading frames of the four casein genes CSN1S1 (αs1-

casein), CSN2 (ß-casein), CSN1S2 (αs2-casein) and CSN3 (κ-casein) were resequenced in 253

horses of 14 breeds. The analysis revealed 21 non-synonymous nucleotide exchanges, as well

as 11 synonymous nucleotide exchanges, leading to a total of 31 putative protein isoforms, 26

of which considered novel, predicted at the DNA-level. Although the majority of the alleles

need to be confirmed at the transcript and protein level, a preliminary nomenclature was

established for the equine casein alleles.

Introduction

The genetic diversity of milk protein genes in typical dairy species such as cattle (Caroli et al.,

2009) and goat (Selvaggi et al., 2014) has been considered in numerous studies and distinct

genetic variants have been described at both the protein and the DNA level. Despite a

longstanding tradition of mare’s milk consumption in countries of the Central Asian Steppes

and a growing interest in horse milk in Central Europe, the knowledge about equine milk

proteins and especially their genetic variability is still very limited.

Due to their ability to form micelles, the caseins are important for the supply of the neonate

with calcium, phosphate, and amino acids. (Lenasi et al., 2003; Uniacke-Lowe et al., 2010).

Whereas the casein fraction in bovine milk is accounting for about 75% of the whole milk

protein (Martin and Grosclaude, 1993), caseins only make up half of the equine milk protein

fraction (Malacarne et al., 2002). The equine casein fraction is divided in αs1-casein (17%), -

51

casein (79%), αs2-casein (1.5%) and -casein (1.5%) (Inglingstad et al., 2010; Malacarne et al.,

2002; Miranda et al., 2004). The genes encoding these proteins are located on equine

chromosome (ECA) 3 in a tightly linked 290-kb gene cluster. The order is CSN1S1 (encoding

αs1-casein), CSN2 (encoding β- casein), CSN1S2 (encoding αs2- casein), and CSN3 (encoding

κ- casein) (Egito et al., 2002; Girardet et al., 2006; Lenasi et al., 2003; Lenasi et al., 2005;

Martin et al., 2009; Miclo et al., 2007; Milenkovic et al., 2002; Miranda et al., 2004; Selvaggi

et al., 2010). The recent knowledge about the individual caseins and their genetic variability is

summarized in Table 1.

The aim of this study was to provide extended knowledge about the genetic variability of equine

casein genes and to identify putative protein variants at the DNA level.

Table 1. Current knowledge about equine casein genes and their genetic variability.

Casein Gene

Symbol

Location

EquCab2.0

Chromosome 3

NC_009146.2

Remarks

αs1 CSN1S1 64,954,285…

64,970,471

Full length cDNA sequence: Lenasi et al. (2003).

Two variants due to exon skipping (Miranda et al., 2004).

Genomic (NC_009146.2) and mRNA (NM_ 001081883.1)

reference sequences differ (c.406 C>A).

ß CSN2 64,938,110…

64,946,489

Full length cDNA sequence: Lenasi et al. (2003) and Girardet

et al. (2006).

Two smaller variants reported (Miranda et al., 2004).

αs2 CSN1S2 64,795,317...

64,811,812

First described in 2000 (Egito et al., 2001; Egito et al., 2002;

Miranda et al., 2004; Ochirkhuyag et al., 2000).

Two major variants (CSN1S2*A, CSN1S2*B) due to a

genomic 1.3 kb deletion covering two coding exons

(Brinkmann et al., 2015).

CSN3 64,683,856…

64,694,148

First described in 2001 (Iametti et al., 2001; Miranda et al.,

2004).

Full lenghth cDNA sequence: Lenasi et al. (2003).

Two putative variants described at the DNA-level by Hobor

et al. (2006; 2008): Ile383Lys and Thr173Ala.

52

Material and Methods

Animals and Samples

Genomic DNA was extracted from hair samples of 198 horses from eight different breeds

actually used for mare milk production in Germany applying a modified protocol according to

Miller et al. (1988). The animals were selected to be as unrelated as possible. Additionally,

individual whole genome sequence variant calling data of a total 55 horses from 10 different

breeds available from other studies were incorporated in the analyses. The animals were

sequenced to a mean coverage of 15.8X; bioinformatic details were reported before

(Drögemüller et al., 2014; Frischknecht et al., 2014). In total, 253 horses belonging to 14

different breeds or populations were analyzed (Table 2).

Table 2. Animals used in the sequence analysis of the equine casein genes (n=253).

Breed Acronym SEQ1 WGS2 TOTAL

Akhal-Teke AK 1 1

Dairy Crossbreed3 CB 21 - 21

Argentine Criollo Horse CR 27 - 27

Fjord Horse FJ 3 - 3

Franches-Montagnes FM - 29 29

Haflinger HF 39 1 40

Icelandic Horse IC 25 1 26

Dutch Warmblood (KWPN) WBNL - 1 1

Quarter Horse QH 22 3 25

Russian Heavy Draft RU 24 - 24

Shetlandpony SP - 2 2

Swiss Warmblood WBCH - 3 3

UK Warmblood WBUK - 2 2

German Warmblood WBD 37 12 49

TOTAL 198 55 253

1 Data from DNA Sanger-sequencing. 2 Data from whole genome sequencing. 3 Breeds that are crossed include German Riding Pony, Haflinger Horse, Connemara Pony, New Forrest Pony and

further pony breeds to achieve a preferable high milk yield.

53

DNA Sequencing

A total of 37 primer pairs (Supplemental Table 1) were designed to amplify all exons

contributing to the open reading frames of the genes and adjacent intronic regions: The Primer

3 software (Rozen and Skaletsky, 2000) was used based on the genomic reference sequences

of the casein genes CSN1S1, CSN2, CSN1S2, and CSN3 (Acc. No NC_009146.2). The genomic

sequence of CSN1S1 was found to contain a gap spanning a coding exon. A flanking primer

pair was designed in order to close the gap by Sanger sequencing.

PCR amplification and DNA sequencing were done as described by Gallinat et al. (2013). The

obtained sequences were analyzed and compared with the genomic GenBank sequence

NC_009146.2 using the software Sequencher 4.9 (Gene Codes Corp., Ann Arbor, MI). The

discrimination of the known CSN1S2 variants A or B was done by fragment length analysis as

described by Brinkmann et al. (2015). Allele frequencies for all observed variants of CSN1S1,

CSN2, CSN1S2, and CSN3 were calculated by direct counting for the examined breeds.

Results

The open reading frames of the 4 casein genes were successfully sequenced in 244 horses

belonging to 8 breeds (numbers differ between genes; details are given in Table 3). Six, four,

eight and 13 variants were identified in CSN1S1, CSN2, CSN1S2, and CSN3, respectively. This

makes a total of 31 casein variants identified at the DNA level, two of which do represent signal

peptide variants and 26 of which can be regarded as novel. Moreover, 11 synonymous

nucleotide exchanges were identified. The counted allele frequencies of all variants are

summarized in Table 3, allele frequencies were only determined in breeds with at least 10

samples available.

Provisional names were assigned to the variants (CSN1S1*A - CSN1S1*D; CSN2*A - CSN2*C;

CSN1S2*A - CSN1S2*F; CSN3*A - CSN3*M). The numbering of positions on the gene refers

to the coding sequence for the full length proteins, including the signal peptide. For αs1-casein

this results in a 220 amino acid protein, resulting from the mRNA sequence NM_001081883.1

plus exon 7 (24 bp), which is missing in this sequence. The full length protein of -casein is

241 amino acids in length, resulting from the coding sequence NM_001081852.1 plus exon 5

(24 bp) which is missing in this sequence. Resulting from the reference sequence KP658381.1

the full length αs2- casein is 231 amino acids in length. The reference sequence

NM_001081884.1 codes for -casein, which is 185 amino acids in length.

54

Table 3. Number of examined animals per breed and counted allele frequencies at the 4 casein encoding genes CSN1S1, CSN2, CSN1S2 and CSN3.

Gene and variant

CSN1S1 CSN2 CSN1S2 CSN3

Breed1 n A A*2 B C D E n A A*2 B C n A B C D1 D2 E1 E2 F n A B C D E F G H I J K L M

AK 1 +3 -4 - - - - 1 + - - - 1 + - - - - - - - 1 + - - - - - - - - - - - -

CB 20 0.65 0.35 - - - - 21 0.88 0.12 - - 1

8 0.83 0.17 - - - - - - 21 0.88 - 0.12 - - - - - - - - - -

CR 18 0.47 0.50 0.30 - - - 27 0.98 0.02 - - 1

6 1.00 - - - - - - - 26 0.73 - 0.13 0.1 - 0.04 - - - - - - -

FJ 3 + + + - - - 3 + - - - 3 + + + - - + - - 3 + - - - - - + + + - - - -

FM 29 0.67 0.30 - - - 0.03 29 0.98 0.20 - - 2

9 1.00 - - - - - - - 29 0.74 - - - - - - - - 0.02 0.24 - -

HF 34 0.52 0.47 - - 0.01 - 37 0.82 0.18 - - 3

6 0.54 0.35 0.01 - - 0.05 0.04 - 38 0.68 - 0.28 - - - 0.01 0.02 - 0.01 - - -

IC 22 0.55 0.27 - 0.09 0.09 - 26 0.80 0.04 0.08 0.08 1

7 0.74 0.06 - 0.06 - - - 0.14 26 0.38 - 0.29 0.21 - 0.02 0.06 - - 0.02 - 0.02 -

WBNL5 1 + - - - - - 1 + - - - 1 + - - - - - - - 1 + - - - - - - - - - - - -

QH 10 0.65 0.35 - - - - 23 1.00 - - - 2

1 0.69 0.05 0.17 0.02 - 0.02 0.05 - 23 0.68 0.16 - - 0.04 0.04 - - 0.02 0.04 - - 0.02

RD 17 0.82 0.18 - - - - 24 0.98 0.02 - - 1

8 0.89 0.08 - 0.03 - - - - 24 0.42 - 0.02 0.25 - 0.20 0.11 - - - - - -

SP 2 + - + - - - 2 + - - - 2 + - - - - - - - 2 + - - - - - - - - + - - -

WBCH5 3 + + - - - - 3 + - - - 3 + - - - - - - - 3 + - - - - - - - - - + - -

WBUK5 2 + + - - - - 2 + - - - 2 + - - - - - - - 2 + - - - - - - - - - + - -

WBD5 35 0.63 0.36 - - - 0.10 44 0.99 0.01 - - 3

8 0.83 0.01 0.08 0.07 0.01 - - - 45 0.82 - 0.06 - - 0.01 - 0.01 0.04 0.01 0.03 0.01 -

WBtotal

5 41 0.60 0.39 - - - 0.1 50 0.99 0.01 - - 4

4 0.85 0.01 0.07 0.06 0.01 - - - 51 0.84 - 0.04 - - 0.01 - 0.01 0.04 0.01 0.04 0.01 -

1 For an explanation of breed acronyms see Table 1. 2 Asterisks indicate that the allele contains a signal peptide variant. 2 Crosses indicate that the correspondent variant is present in that breed, but the number of animals is too low to determine allele frequencies. 3 Dashes indicate that the correspondent variant is not present in that breed. 4 Breeds belonging to the European Warmblood population (Dutch, Swiss, UK and German Warmblood) were also analyzed jointly as WBTOTAL

55

CSN1S1

The genomic reference sequence NC_009146.2 (EquCab2.0) was found to contain a gap with an

estimated size of 674 bp spanning exon 16, which is present in the mRNA reference sequence

NM_001081883.1. The gap was closed by Sanger sequencing of a PCR product revealing an exact

gap size of 731bp (see Supplemental Figure 1).

Subsequently, sequence data of 197 animals were compared in order to find putative variants. As

compared to the genomic reference sequence (Acc. No. NC_009146.2), five previously unknown

non-synonymous nucleotide exchanges were identified within the open reading frame of CSN1S1

defining five putative protein isoforms (Table 4). One of the variants is predicted to affect the signal

peptide sequence; the corresponding allele with the signal peptide variant was termed CSN1S1*A*.

No sequence corresponding to the mRNA reference sequence NM_001081883.1 was found in the

analyzed samples.

The allele CSN1S1*A corresponding to the genomic reference sequence was the most common one

among the examined animals and was found in all breeds (Table 3). A signal peptide variant (c.25

C>A / Leu9Ile) defines the allele CSN1S1*A*), which was common in all breeds except Akhal-

Teke, Dutch Warmblood and Shetlandpony. A nucleotide exchange c.88 G>A (Glu30Lys)

characterizes allele CSN1S1*B, which was identified in Criollo Horses, Fjord Horses and

Shetlandponies. Allele CSN1S1*C is defined by an additional transition (c.470 T>C /

p.Val157Ala). This haplotype was exclusively found in Icelandic Horses. CSN1S1*D differs from

allele A by a T>G transversion in position 428 of the ORF (c.428T>G / p.Leu143Arg) and was

detected in Haflinger and Icelandic Horses. Allele CSN1S1*E is caused by a single nucleotide

exchange from C to A in position 329 (c.329C>A; pPro110Ala) and was found in German

Warmblood Horses as well as in Franches-Montagnes. Additionally, a synonymous nucleotide

exchange was found (c. 633G>A), which was in perfect linkage disequilibrium to the sequence

polymorphism defining allele CSN1S1*D.

56

Table 4. Sequence variants and putative protein alleles of the equine CSN1S1 gene.

αs1-casein protein alleles

Position in

ORF and

protein

Ref. Seq.1

A

A*

B

C

D

E

c.252

p.9

CTT

Leu

ATT

Ile

c.88

p.30

GAA

Glu

AAA

Lys

AAA

Lys

c.329

p.110

CCA

Pro

CAA

Gln

c.428

p.143

CTT

Leu

CGT

Arg

c.470

p.157

GTA

Val

GCA

Ala

1 Variant CSN1S1*A is corresponding to the genomic reference NC_009146.2 2 c.25 is located in the sequence coding for the signal peptide and leads to the signal peptide variant CSN1S1*A*

CSN2

The open reading frame of the CSN2 gene was successfully examined in 243 horses and four

previously unknown nonsynonymous nucleotide exchanges, each defining a putative protein

isoform, were detected (Table 5). Also for this gene, one of the variants affects the signal peptide.

The genomic reference sequence (NC_009146.2) was designated as CSN2*A and represented the

most common allele at this locus (Table 3). The allele with the signal peptide variant CSN2*A* is

characterized by a single nucleotide exchange c. 16C>T leading to a predicted amino acid exchange

from leucine to phenylalanine (p.Leu6Phe) in the signal peptide; this variant was detected with

allele frequencies up to 0.2 in the crossbred horses for dairy production, Criollo Horses, Franches-

Montagnes, Haflinger Horses, Icelandic Horses, Russian Heavy Draft and German Warmblood. A

single transition (c. 277G>A / p.Val93Ile) defines allele CSN2*B, which was found to be rare and

was only detected in Icelandic Horses. A haplotype of two nucleotide exchanges in positions 91

57

and 479 of the open reading frame gives rise to allele CSN2*C (Table 5). Furthermore, 6

synonymous nucleotide exchanges were found in the equine CSN2 gene (c.36C>T; c. 102C>T;

c.123G>A; c. 162G>A; c. 417C>T; c. 465C>T).

Table 5. Sequence variants and putative protein alleles of the equine CSN2 gene.

-casein protein alleles

Position in ORF

and protein

Ref. Seq.1

A

A*

B

C

c.162

p.6

CTT

Leu

TTT

Phe

c.91

p.31

CTT

Leu

TTT

Phe

c.277

p.93

GTT

Val

ATT

Ile

c.479

p.160

CTG

Leu

CCG

Pro

1 Variant CSN2*A is corresponding to the genomic reference NC_009146.2 2 c.16 is located in the sequence coding for the signal peptide and leads to the signal peptide variant CSN2*A*

CSN1S2

Sequencing of the CSN1S2 gene was successfully completed in 205 animals. A total of 6

nonsynonymous single nucleotide variants and one large deletion leading to 8 distinct putative

protein isoforms were identified, 6 of which were considered novel (Table 6).

Allele CSN1S2*A (Acc. No. KT368778) corresponding to the genomic reference sequence

(NC_009146.2) was found to be most frequent across all analyzed breeds. Allele CSN1S2*B (Acc.

No. KT368779), which has already been described by Brinkmann et al. (2015), differs from allele

A by the presence of a 1,339 bp deletion covering two coding exons. It was found in Crossbred

Horses, Fjord Horses, Icelandic Horses, Quarter Horses, Russian Heavy Draft Horses and German

Warmbloods with allele frequencies ranging from 0.01 in Warmblood Horses to 0.35 in Haflinger

58

Horses. The putative allele CSN1S2*C on the other hand, defined by a single nucleotide exchange

c.398C>T leading to a predicted amino acid exchange from threonine to isoleucine in position 133

of the protein (Table 6), was found to be rare occurring at low frequencies in Fjord, Haflinger, and

Quarter Horses as well as German Warmbloods. A non-synonymous transition in position 218 of

the ORF (c.218C>T / p.Thr73Ile) defines allele D. This exchange was found to occur on the long

allele CSN1S2*A as well as on the short allele B and the resulting alleles were thus designated

CSN1S2*D1 and CSN1S2*D2, respectively. Allele D1 was detected at low frequencies in Icelandic

and Quarter Horses as well as Russian Heavy Drafts and German Warmbloods, while CSN1S2*D2

was found in German Warmblood Horses only (Table 3). Equivalently, allele E, which is defined

by two nucleotide exchanges in codons 129 and 217 (see Table 6 for details) was found in

conjunction with the long as well as the short variant and the respective alleles arising from those

haplotypes were termed CSN1S2*E1 and CSN1S2*E2. The former was detected in Fjord,

Haflinger, and Quarter Horses, while the latter was only found in Haflinger and Quarter Horses.

Finally, two transitions in positions 182 and 640 of the ORF (Table 6) characterize the rare allele

CSN1S2*F, which was exclusively detected in Icelandic Horses. Additionally, four synonymous

nucleotide exchanges were detected in equine CSN1S2 (c.21C>T; c.24C>T; c.225A>G;

c.402A>G). The synonymous nucleotide exchange c.225 A>G was always observed in

combination with allele CSN1S2*F in Icelandic horses.

59

Table 6. Sequence variants and putative protein alleles of the equine CSN1S2 gene.

αs2-casein protein alleles

Position in

ORF and

protein

Ref. Seq.1

A

B

C

D1

D2

E1

E2

F

c.182

p.61

AGG

Arg

AAG

Arg

c.218

p.73

ACA

Thr

ATA

Ile

ATA

Ile

c.199-2492

p.67-83

ins.

del.

del.

del.

c.386

p.129

CGG

Arg

CAG

Gln

CAG

Gln

c.398

p.133

ACC

Thr

ATC

Ile

c.640

p.214

CGG

Arg

TGG

Try

c.651

p.217

AGA

Arg AGT

Ser

AGT

Ser

1 Variant CSN1S2*A is corresponding to the genomic reference NC_009146.2. 2 This variant is represented by a large deletion, which has been described by Brinkmann et al. (2015).

CSN3

The ORF of the CSN3 gene was successfully resequenced in 244 animals revealing 6

nonsynonymous nucleotide exchanges, 4 of which had not been described before. A total of 13

putative protein isoforms were predicted from these nucleotide exchanges (Table 7).

The allele represented by the genomic reference sequence (Acc. No. NC_009146.2) was denoted

CSN3*A. It was found to be the most common one in all examined breeds with frequencies of up

to 0.88. Four alleles, namely CSN3*B, CSN3*F, CSN3*H and CSN3*J, were found to differ from

the genomic reference by only one nucleotide exchange each (Table 7). Allele B, which is

characterized by an amino acid exchange from threonine to alanine in codon 29, occurred at a rather

60

high frequency of 0.16 (Table 3) in Quarter Horses, while allele F, which is defined by an

asparagine to lysine exchange in codon 24, was seen at a frequency of 0.2 in Russian Heavy Drafts.

Allele H, which is also defined by a threonine to alanine exchange, but at codon 173, has been

described before (Hobor et al., 2006; Hobor et al., 2008) and was found to occur in Haflinger

Horses and German Warmbloods in our study. The putative protein isoform CSN3*J is

characterized by the occurrence of a premature stop codon leading to a truncated protein lacking

amino acid positions 183 to 185. The allele was found in several breeds at low frequencies. The

variants defining alleles B and J were also identified in conjunction with the variant characterizing

the putative allele CSN3*C (Table 7), which was found in high frequencies of up to almost 0.3 in

Haflinger and Icelandic Horses (Table 3). Likewise, the nucleotide exchanges defining alleles H

and J were found together in a haplotype giving rise to the rare allele CSN3*L. The variations

causing alleles F and H, respectively, were found to jointly define CSN3*G, which was only found

in Haflinger and German Warmbloods. A further non-synonymous nucleotide exchange was

identified in codon 22 (Table 7). This variant did not occur independently, but was only seen along

with the exchange in codon 24, together defining the haplotype of the rare allele CSN3*I (Tables

3 and 7). Finally, an already described (Hobor et al., 2006; Hobor et al., 2008) non-synonymous

nucleotide exchange was found in codon 128 (c.282T>A), which was also not detected

independently. Against the background of allele L e.g., it defines CSN3*K, which was the second

most frequent variant in Franches-Montagnes (Tables 3 and 7). Furthermore, the nucleotide

exchanges were found to exist in additional combinations, namely defining alleles CSN3*D,

CSN3*E, and CSN3*M (Table 7). Allele D was found to exhibit a high frequency in Icelandic

Horses, while variants M and E were only found in Quarter Horses with the latter differing from

the reference sequence in 5 positions.

61

Table 7. Sequence variants and putative protein alleles of the equine CSN3 gene.

-casein protein alleles

Position in

ORF and

protein

Ref. Seq.1

A

B

C

D

E

F

G

H

I

J

K

L

M

c.65

p.22

GTG

Val

GCG

Ala

GCG

Ala

c.72

p.24

AAC

Asn

AAG

Lys

AAG

Lys

AAG

Lys

AAG

Lys

AAG

Lys

c.85

p.29

ACA

Thr

GCA

Ala

GCA

Ala

GCA

Ala

c.3832

p.128

ATA

Ile

AAA

Lys

AAA

Lys

c.5172

p.173

ACC

Thr

GCC

Ala

GCC

Ala

GCC

Ala

GCC

Ala

GCC

Ala

GCC

Ala

GCC

Ala

c.547

p.183

CAA

Gln

TAA

STOP

TAA

STOP

TAA

STOP

TAA

STOP

TAA

STOP

TAA

STOP

1 Variant CSN1S2*A is corresponding to the genomic reference NC_009146.2 2 Hobor et al., 2006; Hobor et al., 2008

Discussion

Methodolgy

Within the current study, DNA sequencing of the open reading frames was used to identify putative

protein variants of the equine caseins. Thereby, 26 new casein variants, including two signal

peptide variants, were detected. As discussed by Gallinat et al. (2013), the main advantages of this

methodology are the easy applicability and the better availability of DNA samples as compared to

protein samples, especially when breeds from different countries are considered. The main

disadvantage, however, is that neither the actual expression of variants nor posttranslational

modifications can be evaluated. Furthermore, variations due to differential alternative splicing

cannot readily be detected. For αs1-casein and ß-casein e.g., shorter variants have been identified

(Girardet et al., 2006; Lenasi et al., 2003; Miranda et al., 2004; Table 1), which can only be

characterized at the transcript or protein level.

62

To confirm the novelty of the identified variants, a BLAST search

(http://blast.ncbi.nlm.nih.gov/Blast.cgi) of the generated sequence data against public databases

was conducted. None of the variants denoted as novel in the current study were identified

confirming their novelty. Interestingly, one polymorphism in CSN1S2 (c.386G>A / p.Arg129Gln)

was not found in the CSN1S2 sequences of Equus caballus, but was identified in the predicted

mRNA sequence of CSN1S2 in Equus przewalskii (Acc. No. XM_008510698.1).

Allele frequencies within breeds were determined by counting. These frequencies have to be taken

with care, because the number of animals per breed was rather small. Nevertheless, these figures

give an overview of the breed distribution for the identified variants. The provisional nomenclature

for the alleles established here will be subject to confirmation at the protein level. Furthermore, in

some instances two or more variants were only found heterozygously within one gene hampering

the unequivocal definition of haplotypes. This was the case for CSN3*I. Due to the large number

of identified variants, it was, however, necessary to establish a nomenclature to simplify

referencing and discussion.

The selection of animals for the study was initially limited to breeds that are actually used for mare

milk production in Germany. Especially the Haflinger Horse is, not only in Germany, a favored

breed for dairy production and is used by many mare milk farmers. But also other breeds such as

the German Warmblood and the Russian Heavy Draft, or even special breeds such as Criollo,

Quarter Horse, and Icelandic Horse are used by German mare milk farmers, potentially yielding a

higher selling price especially for the male offspring. Thus, a comparatively wide spectrum of

breeds has been covered. Notably, one of the sampled populations represents a crossbreed

including German Riding Pony, Haflinger Horse, Connemara Pony, and New Forrest Pony as well

as further Pony breeds. According to the owner, this breed has especially been produced for dairy

farming and selected for milkability und milk yield. It remains, however, unclear how phenotypes

have been recorded and selection has been conducted.

Breed specific variation patterns

The Icelandic Horse exhibited the highest degree of variability within this study. A total of 19

different casein gene alleles were found in this breed, four of which (CSN1S1*C, CSN2*B,

CSN2*C, CSN1S2*F) were found exclusively within this breed. This seems unexpected in the first

instance, because the breed originates from a small founder population. These animals were

63

brought to Iceland approximately 1,100 years ago and the population has been closed since then

(Adalsteinsson, 1981). However, the samples were not taken on Iceland and Hreidarsdóttir et al.

(2014) reported a higher diversity in terms of effective founders for abroad as compared to the

Icelandic population.

With 18 different alleles, the second most isoforms were identified in German Warmblood Horses

followed by Quarter Horses with 16 alleles, three of which were exclusively found in this breed

(CSN3*B, CSN3*E, CSN3*M). While alleles E and M were found to be rare, CSN3*B had an allele

frequency of 0.15 and might thus be designated as a characteristic allele in Quarter Horses. A

comparatively low variation was found in the crossbreed for dairy production with only 8 casein

gene variants. This is noteworthy as several different breeds have been crossed here. It might,

however, be possible that selection for milk yield has reduced the casein variability, because some

variants have a strong effect on the target trait.

Evolution of the casein variants

Based on the current data, it is in many instances difficult to draw conclusions about the exact

evolution of the putative casein alleles. In most cases, however, the ancestral allele and possible

routes of variant evolution can be inferred.

In the case of CSN1S1, allele A seems to represent the ancestral haplotype because of the high allele

frequencies distributed over all examined breeds (Table 3). The alleles CSN1S1*A*, CSN1S1*B,

CSN1S1*D, and CSN1S1*E differ from CSN1S1*A by only one nucleotide exchange each and

might have directly evolved from the ancestral allele. Allele CSN1S1*C can be derived from allele

B by one additional non-synonymous nucleotide exchange in position 470 of the open reading

frame.

Likewise, allele CSN2*A was found in all breeds at high frequencies, which indicates an ancestral

status of this allele. The other alleles were found to be rare (Table 3) and differ from allele A by

one (CSN2*A*, CSN2*B) or two (CSN2*C) nucleotide exchanges (Table 5).

The situation for CSN1S2 seems to be more complicated. In a previous study, we have identified

two major alleles (CSN1S2*A and CSN1S2*B) differing in length by 17 amino acids due to a large

genomic deletion spanning two coding exons and determined that the deletion has probably

occurred before the ancestor of present-day asses and zebras diverged from the horse lineage

(Brinkmann et al., 2015). Alleles CSN1S2*C and CSN1S2*F differ from the long reference allele

64

A by one and two mutations, respectively, and might have evolved from this allele (Table 6). Two

other alleles, CSN1S2*D and CSN1S2*E, however, do occur in conjunction with both the long and

the short allele; the resulting alleles were termed D1/D2 and E1/E2, respectively (Table 6). Overall,

these are rare, but allele D1 does occur more frequently than D2 (Table 3). Thus, it is possible, that

CSN1S2*D1 might have evolved from the long allele CSN1S2*A and that CSN1S2*D2 represents

a recombinant haplotype. The alleles E1 and E2 are comparably rare and it is possible that the

underlying polymorphisms have been segregating together for a long period. Notably, one of the

polymorphisms defining these alleles (c.386 A>G) was found also in the CSN1S2 sequences of

Equus przewalskii (Acc. No. XM_008510698.1) by BLAST analysis, which supports this

hypothesis.

Several alleles of CSN3 were detected in the current study. It is likely, that either CSN3*A or

CSN3*F might be an ancestral allele. From CSN3*A allele CSN3*B could have evolved by one

sequence variant (c.85A>G) and a further mutation (c.547 C>T) might have led to CSN3*C.

CSN3*F seems to be the basis for the development of the alleles CSN3*G and CSN3*I, each caused

by an additional exchange (Table 7). From CSN3*G, allele CSN3*D might have evolved, which

subsequently could have led to the development of CSN3*E. However, due to the large number of

alleles arising from the various possible haplotypes, the evolution of CSN3 cannot be further

elucidated based on the current data.

Equine casein isoforms - consequences for production and human consumption

In the dairy sector, mare’s milk is a high priced niche product, which is marketed under several

health claims. The production is costly as mares can only be milked with foal at foot. Thus,

selection for milk yield or contents has not taken place so far. Attempts to select for these traits are

furthermore hampered by a lack of routine milk recording schemes, which would be difficult to

implement for several reasons. Especially, the foal’s milk consumption cannot readily be

determined (Doreau and Martuzzi, 2006). A main criterion in the selection of dairy mares would,

however, be good milking ease (Doreau and Boulot, 1989; Doreau and Martuzzi, 2006), but with

the exception of the aforementioned crossbreed for dairy production, no selection does take place

and the potential is still unexploited.

From other dairy species, effects of casein isoforms on performance traits are known (Boettcher et

al., 2004; Heck et al., 2009; Martin et al., 2002), but for the above reasons this cannot be analyzed

65

in dairy mares. However, several of the health benefits empirically ascribed to horse milk might be

attributable to the protein fraction and thus depend on the pattern of protein variants. These benefits

include putative positive effects on gastrointestinal ulcers, digestive and cardiovascular diseases,

diarrhea and gastritis. Also other diseases like tuberculosis, anaemia, chronic hepatitis and nephritis

were traditionally treated with horse milk or kumyß, an alcoholic fermented mare’s milk drink,

especially in Russian sanatoria. Several reasons for the effectiveness were suggested, such as the

fatty acid pattern or the high content of lysozyme and lactoferrin. Also peptides arising from the

hydrolysis of ß-casein may be responsible for health effects. Mare milk and kumyß contain peptides

with hypotensive activity, but specific research on bioactive peptides from mare milk is scarce

(Doreau and Martin-Rosset, 2002). Some current studies provided first scientific evidence of the

health effects of mare milk, there are studies about beneficial effects on atopic dermatitis (Foekel

et al., 2009), chronic-inflammatory bowel diseases (Schubert et al., 2009) or cardiovascular

diseases (Chen et al., 2010). The extended knowledge about the equine milk protein genes might

provide a basis for further studies about the effect of mare milk on human health, especially related

to the release of bioactive peptides.

Mare’s milk is also considered a hypoallergenic foodstuff. It has been shown in vitro and in vivo,

that this milk is tolerated by 96% of children, who are affected by cow milk allergy (CMA)

(Businco et al., 2000; Curadi et al., 2001). CMA is an IgE mediated allergenic reaction causing a

broad range of symptoms such as atopic dermatitis, constipation and infantile colic. This condition

affects approximately 2% of infants when nourished with milk replacements on cow milk basis

(Heine et al., 2002). Among the caseins, αs1-casein has been identified as the protein with the

highest allergenic potential and many individuals affected by CMA show a high titer of IgE specific

for this protein (Gaudin et al., 2008; Lisson, 2014; Ruiter et al., 2006; Schulmeister et al., 2009;

Shek et al., 2005). Several reasons for the low allergenicity of mare’s milk are discussed, for

example the absence the epitopes relevant for the IgE binding. In the current study, a signal peptide

variant leading to the allele CSN1S1*B* was detected, which might principally cause a reduced

content or absence of αS1-casein. This variant was found to be very common with allele frequencies

of up to 0.5. We were, however, not able to assess, whether the altered signal peptide affects protein

expression. This should be subject to further studies.

66

Conclusions

Within the current study, the genetic diversity of equine casein genes was assessed at the DNA-

level in 253 horses belonging to 14 different breeds or populations. Thereby, 32 different putative

casein isoforms were identified, 26 of which can be considered novel. This study gives, for the first

time, a comprehensive overview of genetic variability at the casein loci in horses including

noteworthy findings such as the high degree of variability in Icelandic horses. The results provide

a foundation for further research into the properties of the equine milk protein fraction.

Acknowledgements

This project was founded by the German Federal Ministry of Education and Research (Bonn,

Germany) within the competence network “Food Chain Plus” (FoCus, grant no. 0315539A). The

authors would like to thank all the mare’s milk producers for providing samples, Julia Tetens for

her help with sample collection and Gabriele Ottzen-Schirakow for expert technical assistance.

References

Adalsteinsson, S. 1981. Origin and conservation of farm animal populations in Iceland.

Zeitschrift für Tierzüchtung und Züchtungsbiologie 98(1-4):258–264.

Brinkmann, J., Koudelka, T., Keppler, J. K., Tholey, A., Schwarz, K., Thaller, G., Tetens, J.

2015. Characterization of an Equine α-S2-casein Variant due to a 1.3 kb Deletion Spanning Two

Coding Exons. DOI: 10.1371/journal.pone.0139700

Businco, L., Giampietro, P. G., Lucenti, P., Lucaroni, F., Pini, C., Di Felice, G., Iacovacci, P.,

Curadi, C., Orlandi, M. 2000. Allergenicity of mare’s milk in children with cow’s milk allergy.

Journal of Allergy and Clinical Immunology 105(5):1031–1034.

Caroli, A. M., Chessa, S., Erhardt, G. J. 2009. Invited review: milk protein polymorphisms in

cattle: effect on animal breeding and human nutrition. J. Dairy Sci. 92(11):5335–5352.

67

Chen, Y., Wang, Z., Chen, X., Liu, Y., Zhang, H., Sun, T. 2010. Identification of angiotensin I-

converting enzyme inhibitory peptides from koumiss, a traditional fermented mare's milk. J.

Dairy Sci. 93(3):884–892.

Curadi, M. C., P. G. Giampietro, P. Lucenti, and M. Orlandi. 2001. Use of mare milk in pediatric

allergology., Firenze, 12.-15.06.2001.

Doreau, M., Boulot, S. 1989. Recent knowledge on mare milk production: A review. Livestock

Production Science 22(3-4):213–235.

Doreau, M., Martin-Rosset, W. 2002. Dairy animals: horse. p. 630–637. In H. Roginski, J. A.

Fuquay, and P. F. Fox (eds.). Encyclopedia of dairy sciences. Academic Press, London, UK.

Doreau, M., Martuzzi, F. 2006. Milk yield of nursing and dairy mares. p. 77–87. In N. Miraglia,

and W. Martin-Rosset (eds.). Nutrition and feeding of the broodmare. Academic Publishers,

Wageningen.

Drögemüller, M., Jagannathan, V., Welle, M. M., Graubner, C., Straub, R., Gerber, V., Burger,

D., Signer-Hasler, H., Poncet, P.-A., Klopfenstein, S., Niederhäusern, R. von, Tetens, J., Thaller,

G., Rieder, S., Drögemüller, C., Leeb, T. 2014. Congenital hepatic fibrosis in the Franches-

Montagnes horse is associated with the polycystic kidney and hepatic disease 1 (PKHD1) gene.

PloS one 9(10):e110125.

Egito, A. S., Girardet, J.-M., Miclo, L., Mollé, D., Humbert, G., Gaillard, J.-L. 2001.

Susceptibility of equine κ- and β-caseins to hydrolysis by chymosin. International Dairy Journal

11(11-12):885–893.

Egito, A. S., Miclo, L., López, C., Adam, A., Girardet, J.-M., Gaillard, J.-L. 2002. Separation and

characterization of mares' milk alpha(s1)-, beta-, kappa-caseins, gamma-casein-like, and proteose

peptone component 5-like peptides. J. Dairy Sci. 85(4):697–706.

68

Foekel, C., Schubert, R., Kaatz, M., Schmidt, I., Bauer, A., Hipler, U.-C., Vogelsang, H., Rabe,

K., Jahreis, G. 2009. Dietetic effects of oral intervention with mare's milk on the Severity Scoring

of Atopic Dermatitis, on faecal microbiota and on immunological parameters in patients with

atopic dermatitis. Int J Food Sci Nutr 60 Suppl 7:41–52.

Frischknecht, M., Neuditschko, M., Jagannathan, V., Drögemüller, C., Tetens, J., Thaller, G.,

Leeb, T., Rieder, S. 2014. Imputation of sequence level genotypes in the Franches-Montagnes

horse breed. Genetics, selection, evolution GSE 46:63.

Gallinat, J. L., Qanbari, S., Drögemüller, C., Pimentel, E. C. G., Thaller, G., Tetens, J. 2013.

DNA-based identification of novel bovine casein gene variants. J. Dairy Sci. 96(1):699–709.

Gaudin, J.-C., Rabesona, H., Choiset, Y., Yeretssian, G., Chobert, J.-M., Sakanyan, V., Drouet,

M., Haertlé, T. 2008. Assessment of the immunoglobulin E-mediated immune response to milk-

specific proteins in allergic patients using microarrays. Clin. Exp. Allergy 38(4):686–693.

Girardet, J.-M., Miclo, L., Florent, S., Mollé, D., Gaillard, J.-L. 2006. Determination of the

phosphorylation level and deamidation susceptibility of equine beta-casein. Proteomics

6(12):3707–3717.

Heine, R. G., Elsayed, S., Hosking, C. S., Hill, D. J. 2002. Cow's milk allergy in infancy. Curr

Opin Allergy Clin Immunol 2(3):217–225.

Hobor, S., Kunej, T., Dovč, P. 2008. Polymorphisms in the kappa casein (CSN3) gene in horse

and comparative analysis of its promoter and coding region. Anim. Genet. 39(5):520–530.

Hobor, S., Kunej, T., Lenasi, T., Dovč, P. 2006. Kappa casein gen (CSN3) in horse: Kapa

kazeinski gen (CSN3) pri konju genetic variability in exon 1 and 4 genetska variabilnost v eksonu

1 in 4. Acta agriculturae Slovenica 88(2):83–89.

69

Hreidarsdóttir, G., Árnason, T., Svansson, V., Hallson, J. 2014. Analysis of the history and

population structure of the Icelandic horse using pedigree data and DNA analyses. Icel. Agric.

Sci.(27):63–79.

Iametti, B. S., Tedeschi, G., Oungre, E., Bonomi, F. 2001. Primary structure of kappa-casein

isolated from mares' milk. J. Dairy Res. 68(1):53–61.

Inglingstad, R. A., Devold, T. G., Eriksen, E. K., Holm, H., Jacobsen, M., Liland, K. H., Rukke,

E. O., Vegarud, G. E. 2010. Comparison of the digestion of caseins and whey proteins in equine,

bovine, caprine and human milks by human gastrointestinal enzymes. Dairy Sci. Technol.

90(5):549–563.

Lenasi, T., Kokalj-Vokac, N., Narat, M., Baldi, A., Dovč, P. 2005. Functional study of the equine

beta-casein and kappa-casein gene promoters. J. Dairy Res. 72 Spec No:34–43.

Lenasi, T., Rogelj, I., Dovč, P. 2003. Characterization of equine cDNA sequences for αS1-, β-

and κ-casein. J. Dairy Res. 70(1):29–36.

Lisson, M. 2014. Appearance of epitopes in bovine milk protein variants, their allergenicity and

potential use in human nutrition. Zugl.: Gießen, Univ., Diss., 2014. 1. Aufl. Édition scientifique.

VVB Laufersweiler, Gießen.

Malacarne, M., Martuzzi, F., Summer, A., Mariani, P. 2002. Protein and fat composition of

mare's milk: some nutritional remarks with reference to human and cow's milk. International

Dairy Journal 12(11):869–877.

Martin, P., Grosclaude, F. 1993. Improvement of milk protein quality by gene technology.

Livestock Production Science 35(1-2):95–115.

Martin, P. D., Miclo, L., Rebours, E., Matéos, A., Miranda, G. 2009. Equus caballus mRNA

encoding CSN1S2 (alphaS2-casein) precursor (GenBank GU196267). Genetique Animale et

70

Biologie Integrative (GAI), INRA, Domaine de Vilvert, Jouy-En-Josas 78350, France.

Unpublished.

Miclo, L., Girardet, J.-M., Egito, A. S., Mollé, D., Martin, P., Gaillard, J.-L. 2007. The primary

structure of a low-Mr multiphosphorylated variant of beta-casein in equine milk. Proteomics

7(8):1327–1335.

Milenkovic, D., Martin, P., Guérin, G., Leroux, C. 2002. A specific pattern of splicing for the

horse αS1-Casein mRNA and partial genomic characterization of the relevant locus. Genet Sel

Evol 34(4):509.

Miller, S. A., Dykes, D. D., Polesky, H. F. 1988. A simple salting out procedure for extracting

DNA from human nucleated cells. Nucleic Acids Res. 16(3):1215.

Miranda, G., Mahé, M.-F., Leroux, C., Martin, P. 2004. Proteomic tools to characterize the

protein fraction of Equidae milk. Proteomics 4(8):2496–2509.

Ochirkhuyag, B., Chobert, J.-M., Dalgalarrondo, M., Haertlé, T. 2000. Characterization of mare

caseins. Identification of αS1 - and αS2 - caseins. Lait 80(2):223–235.

Rozen, S., Skaletsky, H. 2000. Primer3 on the WWW for general users and for biologist

programmers. Methods Mol. Biol. 132:365–386.

Ruiter, B., Trégoat, V., M'rabet, L., Garssen, J., Bruijnzeel-Koomen, C A F M, Knol, E. F.,

Hoffen, E. 2006. Characterization of T cell epitopes in alphas1-casein in cow's milk allergic,

atopic and non-atopic children. Clin. Exp. Allergy 36(3):303–310.

Schubert, R., Kahle, C., Kauf, E., Hofmann, J., Hobert, I., Gruhn, B., Häfer, R., Vogelsang, H.,

Jahreis, G. 2009. Dietetic efficacy of mare’s milk for patients with chronic inflammatory bowel

diseases – clinical study. Ernährung/Nutrition 33(7-8):314–321.

71

Schulmeister, U., Hochwallner, H., Swoboda, I., Focke-Tejkl, M., Geller, B., Nystrand, M.,

Härlin, A., Thalhamer, J., Scheiblhofer, S., Keller, W., Niggemann, B., Quirce, S., Ebner, C.,

Mari, A., Pauli, G., Herz, U., Valenta, R., Spitzauer, S. 2009. Cloning, expression, and mapping

of allergenic determinants of alphaS1-casein, a major cow's milk allergen. J. Immunol.

182(11):7019–7029.

Selvaggi, M., Laudadio, V., Dario, C., Tufarelli, V. 2014. Major proteins in goat milk: an updated

overview on genetic variability. Mol. Biol. Rep. 41(2):1035–1048.

Selvaggi, M., Pesce Delfino, A. R., Dario, C. 2010. Exon 1 polymorphisms in the equine CSN3

gene: SNPs distribution analysis in Murgese horse breed. Anim. Biotechnol. 21(4):252–256.

Shek, L. P. C., Bardina, L., Castro, R., Sampson, H. A., Beyer, K. 2005. Humoral and cellular

responses to cow milk proteins in patients with milk-induced IgE-mediated and non-IgE-

mediated disorders. Allergy 60(7):912–919.

Uniacke-Lowe, T., Huppertz, T., Fox, P. F. 2010. Equine milk proteins: Chemistry, structure and

nutritional significance. International Dairy Journal 20(9):609–629.

72

73

CHAPTER IV:

CHARACTERIZATION OF AN EQUINE αs2-CASEIN VARIANT DUE A 1.3 KB

DELETION SPANNING TWO CODING EXONS

Julia Brinkmann1, Tomas Koudelka2, Julia K. Keppler3, Andreas Tholey2, Karin Schwarz3, Georg

Thaller1, Jens Tetens1

1 Institute of Animal Breeding and Husbandry, Christian-Albrechts-Universität Kiel, Kiel,

Germany

2 Systematic Proteomics & Bioanalytics, Institute for Experimental Medicine, Christian-

Albrechts-Universität Kiel, Kiel, Germany

3 Institute of Human Nutrition and Food Science, Division of Food Technology, Christian-

Albrechts-Universität Kiel, Kiel, Germany

Published in PLOS ONE (2015)

DOI: 10.1371/journal.pone.0139700

74

Abstract

The production and consumption of mare’s milk in Europe has gained importance, mainly based

on positive health effects and a lower allergenic potential as compared to cows’ milk. The

allergenicity of milk is to a certain extent affected by different genetic variants. In classical dairy

species, much research has been conducted into the genetic variability of milk proteins, but the

knowledge in horses is scarce. Here, we characterize two major forms of equine αS2-casein arising

from genomic 1.3 kb in-frame deletion involving two coding exons, one of which represents an

equid specific duplication. Findings at the DNA-level have been verified by cDNA sequencing

from horse milk of mares with different genotypes. At the protein-level, we were able to show by

SDS-page and in-gel digestion with subsequent LC-MS analysis that both proteins are actually

expressed. The comparison with published sequences of other equids revealed that the deletion has

probably occurred before the ancestor of present-day asses and zebras diverged from the horse

lineage.

Introduction

Horses are of minor importance in global dairy production, but mare’s milk has traditionally been

consumed in Mongolia, Kazakhstan, Kyrgyzstan or Tajikistan (Uniacke-Lowe et al., 2010). The

global amount of production is not exactly known, but it has been estimated that approximately 30

million people worldwide are regularly consuming mare’s milk (Martuzzi and Vaccari Simonini,

2010). Also in Europe, especially in Italy, Hungary, The Netherlands and Germany, the production

and consumption of mare’s milk have gained more and more importance; roughly 1 million kg of

mare’s milk are produced in Europe (Fox and Uniacke, 2010). This increased interest is mainly

based on positive health effects. The milk of horses and donkeys is e.g. tolerated by the majority

of children suffering from cow’s milk protein allergy, a condition that affects approximately 2% of

infants when nourished with milk replacements on cow milk basis (Curadi et al., 2001; Businco et

al., 2000). Moreover, positive effects of mare’s milk consumption on diseases like atopic dermatitis

(Foekel et al., 2009), Morbus Crohn (Schubert et al., 2009) or cardiovascular diseases (Chen et al.,

2010) have been reported.

The composition of equine milk, and especially the milk protein fraction, is very different from

that of cows’ milk. It is lower in fat and protein, but has a high lactose content similar to what is

75

found in human milk (Malacarne et al., 2002; Uniacke-Lowe et al., 2010). While in cattle the casein

fraction accounts for the major part of the total milk protein, the casein to whey ration in horses is

around 1.1:1, which more closely resembles human milk (Malacarne et al., 2002; Uniacke-Lowe

et al., 2010). In fact, it has been reported that the balance between caseins and whey proteins is a

major determinant of cow’s milk allergenicity (Lara-Villoslada et al., 2005) possibly giving an

explanation for the low allergenic potential of horse milk. However, there is also strong evidence

that genetic milk protein variants affect the allergenicity of milk protein based on the presence or

absence of particular epitopes (Lisson et al., 2013; Lisson et al., 2014). While there has been intense

research into the genetic variability of milk proteins in ruminants and especially in dairy cows

(Caroli et al., 2009), the knowledge about equine milk protein variation is scarce, especially for the

caseins. However, in the donkey different variants of αS2-casein have been described, also

involving a large deletion exons 4-6 (Saletti et al., 2012).

In the present study, we characterized a major protein variant arising from a 1.3 kb in-frame-

deletion covering two exons and proved the protein by means of LC-MS based analytics at the

protein level.

Material and Methods

Animals and samples

Genomic DNA was extracted from hair samples of 193 domestic horses from 8 different breeds

that are actually used for mare’s milk production in Germany applying a modified Miller protocol

(Miller et al., 1988). The animals were selected to be as unrelated as possible. Hair samples were

obtained from 14 different private studs with permission of and in cooperation with the owners by

pulling out several hairs from the mane or the tail. Furthermore, individual milk samples were

collected from four Haflinger mares with known genotype. These samples were taken by the

owners during routine milking of the mares. In concordance with German Animal welfare

legislation, these sampling procedures do not require a permission or approvement.

DNA sequencing

Primer pairs were designed to amplify the coding exons contributing of equine CSN1S2 and

adjacent intronic regions using the Primer 3 software (Rozen and Skaletsky, 2000) based on the

genomic reference sequence of the casein gene CSN1S2 (Acc. No NC_009146.2). A further Primer

76

pair (Forward: 5’- GGAAAAGATTTGTGAGCCATTTG-3’, Reverse: 5’-

GCTGGATAATTGCTCAACACTCA-3’) was designed to specifically amplify the entire region

of CSN1S2 encompassing the deletion. PCR amplification and DNA sequencing were done as

previously described (Gallinat et al., 2013). The obtained sequences were analyzed and compared

with the genomic reference sequence (Acc. No. NC_009168.2) using the software Sequencher 4.9

(Gene Codes Corp., Ann Arbor, MI).

RNA isolation from milk samples and cDNA synthesis

Individual milk samples were obtained from four mares with known deletion genotype. An aliquot

of 40 ml was centrifuged at 6,000 g for 10 minutes. The supernatant including the milk fat layer

was discarded and remaining milk fat was thoroughly removed with alcohol wipes. The cell pellet

was washed three times with 1x phosphate buffered saline. Cells were homogenized using

QIAShredder columns (Qiagen, Hilden, Germany) and total RNA was isolated using the Qiagen

RNeasyMini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The

isolated RNA was transcribed into cDNA using SuperScript® III First-Strand Synthesis SuperMix

kit (Invitrogen) with oligo-dT primers. PCR amplification and sequencing was done with primers

located in the untranslated regions (Forward: 5’-TGCCTGCACTTTCTTGTCTTCCA-3’, Reverse:

5’-TGCACAGTCTTCATTTGGCTTGA-3’).

Protein and peptide analysis

Individual milk samples of two mares with known genotype were used for protein analysis. These

samples were dialyzed to remove lactose, subsequently freeze dried and stored at -18 °C for 4

months. Lyophilized milk powder was dissolved in Laemmli buffer (1x) at a concentration of 2

mg/mL and 10 and 20 µg of crude protein was loaded onto a 12% SDS-PAGE gel (150V for 85

min). Gel bands were destained, reduced and alkylated and then subsequently in gel-digested

overnight with trypsin (60 ng) using standard protocols. Peptides were extracted from the gel, dried

down using vacuum centrifugation and resuspended in 3% acetonitrile (ACN) and 0.1%

trifluroacetic acid (TFA) before being analyzed by LC-MS.

Nano-UHPLC-MS was performed on an UltiMate 3000 RSL Nano/Cap System (Thermo Fisher

Scientific, Bremen, Germany) coupled online to an Orbitrap QExactive (Thermo Fisher Scientific).

Samples were desalted for 4 minutes (Acclaim PepMap100 C-18, 300 µm I.D. x 5 mm, 5 µm, 100

77

Å, Thermo Fisher Scientific) at a flow rate of 30 µL/min using 3% ACN, 0.1% TFA. An Acclaim

PepMap100 C-18 column (75 µm I.D. x 500 mm, 2 µm, 100 Å, Thermo Fisher Scientific) was

used for analytical separation at a flow rate of 300 nL/min using binary gradients of buffers A

(0.05% FA) and B (80% ACN and 0.04% FA). The elution used gradient steps of 5-50% B (4-30

min) and 50-90% B (30-35 min) followed by an isocratic wash (90% B, 35-45 min) and column

re-equilibration (5% B, 45-60 min) steps.

MS scans were acquired in the mass range of 300 to 2,000 m/z at a resolution of 70,000. The ten

most intense signals were subjected to HCD fragmentation using a dynamic exclusion of 15 s.

MS/MS parameters - minimum signal intensity: 1000, isolation width: 3.0 Da, charge state: ≥2,

HCD resolution: 15,000, Normalized collision energy of 25. Lock mass (445.120025) was used for

data acquired in MS mode.

HCD spectra were searched using Proteome Discoverer 1.4 (1.4.0.288, Thermo Fisher Scientific)

with the Sequest-HT search algorithm against the complete reviewed and unreviewed Equus

caballus database (28,188 sequences, downloaded 2015.07.16) with common contaminants

(ftp://ftp.thegpm.org/fasta/cRAP/) appended. The following database search settings were used:

MS tolerance; ± 10 ppm, MS2 Tolerance; 0.02 Da, enzyme specificity; trypsin with up to three

missed cleavages allowed. Carbamidomethylation on cysteine residues was set as a fixed

modification while, oxidation on methionine, and phosphorylation on serine and threonine residues

was set as a variable modification. Only peptides which were identified with medium confidence

(FDR <5%) were included.

Results and Discussion

DNA sequencing and mutation screening

The current annotation of the equine CSN1S2 gene (GeneID 100327035) is based on the mRNA

reference sequence NM_001170767.2 containing 15 coding exons with an open reading frame of

645 bp. In an attempt to resequence the open reading frame using exon flanking primer pairs, we

recognized that the PCR reactions for exons 8 and 9 consistently failed in particular horses. In order

to unravel the possible cause for this phenomenon, we amplified a 2.6 kb fragment spanning the

entire region. While the expected product was obtained from samples that had been successfully

amplified before, the product obtained from initially unsuccessful samples was found to be

approximately 1.3 kb shorter (Figure 1). Subsequent Sanger sequencing of the products revealed

78

the presence of a 1,339 bp deletion in the short variant (Figure 2A), while the long product was

found to completely correspond to the genomic reference sequence (NC_009146.2). Analysis of

this sequence revealed the presence of a 309 bp duplication of the region encompassing exon 8 of

the gene (Figure 2A). Because this duplication is located exactly at the boundary of the deletion,

the exact position cannot be determined, i.e. it cannot be ruled out, whether the upstream or

downstream duplicate is involved in the deletion.

A total of 193 horses belonging to 8 breeds (Table 1) were tested for the presence of the deletion

by PCR and subsequent agarose gel electrophoresis (Figure 1). The deletion was found to be

present in all analyzed breeds; the highest frequencies of 0.36 and 0.25 were observed in Haflinger

and Icelandic horses, respectively. Notably, these breeds are common in mare’s milk production,

especially the Haflinger breed is widely used. This might possibly indicate an effect of the mutation

or a certain casein-haplotype on milk yield as this is e.g. the case in cattle (McLean et al., 1984;

Ikonen et al., 2001).

Table 1. Frequencies of the 1.3 kb deletion in different horse breeds.

Breed n ins/insa ins/dela del/dela Frequency of deletion

Crossbredb 21 14 6 1 0.19

Criollo 27 24 3 0 0.06

Fjord Horse 3 2 1 0 -c

Haflinger Horse 39 17 16 6 0.36

Icelandic Horse 24 13 10 1 0.25

Quarter Horse 20 16 3 1 0.13

Russian Heavy Draft 24 20 3 1 0.10

German Warmblood 35 33 2 0 0.03

TOTAL 193 139 44 10 0.17

a ins = long variant corresponding to the genomic reference NC_009146.2; del = short variant encompassing the 1,339

bp deletion spanning two coding exons. b A synthetic cross involving German Riding Pony, Haflinger Horse, Connemara Pony and New Forrest Pony; bred

for milk yield. c The frequency in Fjord Horses is not reported with respect to the small sample size, but the breed is included in the

total values.

79

Figure 1. Agarose gel electrophoresis of PCR products spanning the 1.3 kb deletion. The upper visible band

corresponds to the long variant (denoted as +), the lower one to the short variant containing the deletion (denoted as

). Only in heterozygotes, a third band with a size of approximately 2.1 kb is visible, which is possibly arising from

asymmetric hybridization of the alleles due to the presence of a duplication. The breeds of the corresponding samples

are given above the lanes (RHD = Russian Heavy Draft, GWb = German Warmblood, IC = Icelandic Horse, HF =

Haflinger).

Figure 3. Agarose gel electrophoresis of equine CSN1S2 cDNA. The RNA was isolated from the milk of a mare

being homozygous for the deletion (/).and three mares homozygous for the long variant (+/+).

80

Figure 2. Structure of the long and short equine αs2-casein variants. A. Genomic organization of the respective gene segment. Grey shading indicates the equid

specific 309 bp duplication comprising coding exons 8 and 10, respectively. The 1.3 kb in-frame-deletion is indicated above the figure. B. Structures the resulting

transcript variants. C. Protein alignment of available ungulate αs2-casein protein sequences.

81

Analysis of transcripts

The duplicated region within the 1.3 kb deletion contains a coding exon with a length of 24 bp.

The two copies were found to be completely identical including intact splice sites. However, only

one of the identical exons is present in the current RefSeq transcript NM_001170767.2. Thus, it

was unclear which exons are transcribed and whether both variants are transcribed at all. Therefore,

we purified total RNA from the skimmed milk of four mares, three of them being homozygote for

the long and one for the short variant, respectively. After reverse transcription, the CSN1S2

transcripts were amplified using primers located in the untranslated regions. Agarose gel

electrophoresis of the PCR products revealed a difference of approximately 50 bp between the

alternatively homozygote animals (Figure 3) showing that both, a long and a short transcript, were

actually expressed. Subsequently, the open reading frames of both transcripts were sequenced. The

difference was found to be due to a 51 bp in-frame insertion/deletion after exon eight encompassing

the duplicated exon as well as a previously not annotated exon that perfectly aligns within the 1.3

kb deletion (Figure 2A/B). Exon numbering was consequently adapted counting the newly

annotated exon as exon 9 and the duplicate of exon 8 as exon 10. Although the genome assembly

(EqCab2.0) comprises the long variant, the RefSeq transcript NM_001170767.2 used for

annotation represents the short variant. A BLAST search showed that both transcripts had been

reported before (GenBank KP658381.1 and KP658382.1) and both variant transcripts have recently

been added to the unreviewed UniProt database (Acc. No. A0A0C5DH76 and D2KAS0), but no

further information or publication is available. The transcript sequences from the current study are

available under the accession numbers KT368778 and KT368779.

Comparative analysis

Translations of the long and short transcript, respectively, were aligned to available protein

sequences of domestic donkey (Acc. No. CAV00691.1 (Chianese et al., 2010)), cattle (Acc. No.

NP776953.1), sheep (Acc. No. NP_001009363.1), goat (Acc. No. NP_001272514.1) and pig (Acc.

No. NP_001004030.1). From Figure 2C it can be seen that the duplication of exon 8/10 is unique

to donkey and horse, while the equine exon 9 appears to have a homologous sequence in other

ungulates. A BLAST search against the genome assembly of Przewalski’s horse (Burgud assembly,

CGF0000696695.1), a species that separated from the ancestral population of domesticated horses

38-72 kyr BP ago (Schubert et al., 2014; Orlando et al., 2013), also revealed the presence of the

82

long variant including the duplicated exon. Furthermore, the small read archive data sets of a

Middle Pleistocene horse, the “Thistle Creek horse” sequenced by Orlando and colleagues

(Orlando et al., 2013) (BioProject Accession PRJNA205517), as well as of several asses and zebras

sequenced by Jónsson and colleagues ((2014), BioProject Accession PRJEB7446) were checked

for reads either falling into the deleted region (indicating the long variant) or being split at the

boundaries (indicating the short variant). Only a single read almost perfectly aligning within the

deletion was found in the Middle Pleistocene horse, which might point to the presence of the long

variant. In the Somalian wild ass (E. asinus somalicus), we only identified the long variant, while

both alleles were found in the Tibetian Kiang (E. kiang). The sequenced Onager (E. hemionus

onager) was found to be homozygous for the deletion. These findings indicate that the duplication

event giving rise to an additional coding exon as well the deletion might be specific to equids and

must both have occurred before the ancestor of present-day asses and zebras dispersed into the Old

World 2.1–3.4 Mya (Jónsson et al., 2014). However, all analyzed zebras (Jónsson et al., 2014)

(Hartmanns Mountain zebra, E. zebra hartmannae; Grevy zebra, E. grevyi; Böhm’s plains zebra,

E. quagga boehmi as well as the extinct Quagga, E. q. quagga) were found to be homozygous for

the complete deletion. It seems also possible that the deletion initially occurred in horses and

represents the result of a gene flow between horses and ass species. It has been shown that this has

played a significant role in equid evolution (Jónsson et al., 2014).

Protein and peptide analysis

Lyophilized milk powder from two mares being homozygote for the long and short variant,

respectively, were analyzed using SDS-PAGE resulting in different patterns of distinct bands

(Figure 4). In-gel trypsin digestion and analysis by LC-MS revealed the presence of unique

peptides only for the long form of αs2-casein (A0A0C5DH76) in milk of the animal homozygous

for the insertion, i.e., peptides FPTEVYSSSSSSEESAK, FPTEVYSSSSSSEESAKFPTER,

FPTEVYSSSSSSEESAKFPTEREEK and NINEMESAKFPTEVYSSSSSSEESAK. Interestingly,

these peptides were identified in both phosphorylated (singly phosphorylated at different residues)

and non-phosphorylated forms. Evidence for multiple phosphorylations on these peptides was also

observed. Unique peptides for the short form of αs2-casein (D2KAS0) were only identified in milk

from the mare homozygous for the deletion, i.e., NINEMESAKFPTER,

NINEMESAKFPTEREEK, NINEMESAKFPTEREEKEVEEK (Figure 5, Table 2). As commonly

83

observed in MS based protein analytics, a 100% sequence coverage was not reached; however, the

proteotypic peptides identified allowed clearly to distinguish the two equine αS2-casein variants.

Therefore, it can be concluded that both protein variants differing in length by 17 aa are expressed.

The comparative analysis has shown that the long variant is probably the equid specific ancestral

variant, but the deletion also seems to have been present before zebras and asses diverged from

horses. Thus, we propose to term the long variant CSN1S2*A and the short variant CSN1S2*B.

Generally, the milk proteome is very complex both due to the presence of genetic variants and

posttranslational modifications (Uniacke-Lowe et al., 2013). Here, both genetic variants as well as

differently phosphorylated peptides have been detected. Recent proteomic studies (Uniacke-Lowe

et al., 2013; Hinz et al., 2012) have demonstrated considerable microheterogeneity for equine

caseins, especially -casein (Uniacke-Lowe et al., 2013). However, these studies did not report any

findings regarding αS2-casein, probably due to its very low concentration in horse milk (Uniacke-

Lowe et al., 2010). However, Ochirkhuyag et al. (2000) reported the presence of two distinct bands

for this protein.

84

Table 2. Bands excised from a mare with +/+-genotype (upper part) and / genotype (lower part), respectively, and

major milk proteins identified are shown (only those with > 20 PSMs). αS2-Casein with accession no. A0A0C5DH76

is the long form (231 AA) while αS2-casein with accession no. D2KAS0 is the shorter form of αS2-casein (214 AAs).

Unique peptides were only identified for the long form of αS2-casein (A0A0C5DH76) in the +/+-mare, while unique

peptides for the short form of αS2-casein (D2KAS0) were identified only in milk from the /-mare.

Band Accession Description Coverage (%) #Unique

Peptides #Peptides #PSMs

Mare homozygous for long variant (+/+)

1

Q9GKK3 ß-casein 35.68 9 9 87

D2KAS0 αs2-casein 49.53 0 13 35

A0A0C5DH76 CSN1S2 protein 45.89 0 13 35

2

Q9GKK3 ß-casein 32.78 8 8 45

A0A0C5DH76 αs2-casein 72.73 2 17 45

D2KAS0 αs2-casein 64.02 0 15 43

P82187 κ-casein 23.78 7 9 40

Q95KZ7 αs1-casein 41.35 1 12 31

3

Q9GKK3 ß-casein 35.68 11 11 138

Q95KZ7 αs1-casein 45.67 2 15 47

A0A0C5DH76 αs2-casein 58.01 1 14 31

D2KAS0 αs2-casein 54.67 0 13 30

P82187 κ-casein 23.78 4 6 21

4

Q95KZ7 αs1-casein 45.67 2 15 67

Q9GKK3 ß-casein 35.68 10 10 35

A0A0C5DH76 αs2-casein 60.17 2 16 31

D2KAS0 αs2-casein 54.67 0 14 29

5

A0A0A1E470 Immunoglobulin lambda

light chain variable

region (fragment)

46.46 2 12 62

A0A0C5DH76 αs2-casein 71.86 3 20 59

D2KAS0 αs2-casein 63.08 0 17 52

Mare homozygous for short variant (/)

1 Q9GKK3 ß-casein 35.68 10 10 80

2

Q9GKK3 ß-casein 35.68 12 12 139

Q95KZ7 αs1-casein 45.67 2 16 75

Q8SPR1 αs1-casein 63.68 0 18 65

D2KAS0 αs2-casein 73.36 2 20 60

A0A0C5DH76 αs2-casein 58.44 0 18 58

P82187 κ-casein 29.73 3 6 34

3

D2KAS0 αs2-casein 73.36 1 24 82

Q9GKK3 ß-casein 35.68 11 11 80

A0A0C5DH76 αs2-casein 67.97 0 23 78

Q95KZ7 αs1-casein 31.25 2 9 24

85

Figure 4. SDS-PAGE of crude mare’s milk being homozygous for the deletion (Δ/Δ) and homozygous for the

long variant (+/+). Ten and 20 µg of crude milk from both mares was loaded in duplicate. Excised bands that were

in-gel digested with trypsin and later analyzed by LC-MS are indicated. M (Roti®-Mark Bicolor protein standard); B

(Blank, Laemmli buffer).

Figure 5 Combined sequence coverage (all bands excised) of αS2-casein in mare with +/+ genotype (A) and Δ/Δ

genotype (B). From the +/+ genotype only unique peptides were identified for the longer αS2-casein form (Accession

no. A0A0C5DH76, 231 AAs). Sequence which is unique to A0A0C5DH76 is underlined. For the Δ/Δ genotype only

unique peptides were identified for the shorter alphaS2-casein form (Accession no. D2KAS0, 214 AAs). Sections in

green represents parts of the protein which were identified by the sequest-HT algorithm.

86

Conclusion

Within the current study, we have characterized two major variants of equine αS2-casein, which we

named CSN1S2*A and CSN1S2*B. The variation is due to a 1.3 kb in-frame deletion involving two

coding exons corresponding to 17 amino acid residues. One of those exons has arisen from a

duplication that is probably specific to the equid lineage. We verified both genomic variants at the

transcript as well as the protein level and were able to demonstrate that these variants are also

segregating in asses, meaning that they are likely to have occurred before the first ancestor of

present-day asses and zebras dispersed into the Old World 2.1–3.4 Mya.

Acknowledgements

This project was funded by the German Federal Ministry of Education and Research (Bonn,

Germany) within the competence network “Food Chain Plus” (FoCus, grant no. 0315539A). The

authors would like to thank all the mare’s milk producers for providing hair samples, Haflinger

stud Seraphin for providing milk samples, Julia Tetens for her help with sample collection and

Gabriele Ottzen-Schirakow for expert technical assistance.

References

Businco, L., Giampietro, P. G., Lucenti, P., Lucaroni, F., Pini, C., Di Felice, G., Iacovacci, P.,

Curadi, C., Orlandi, M. 2000. Allergenicity of mare’s milk in children with cow’s milk allergy.

Journal of Allergy and Clinical Immunology 105(5):1031–1034.

Caroli, A. M., Chessa, S., Erhardt, G. J. 2009. Invited review: milk protein polymorphisms in

cattle: effect on animal breeding and human nutrition. J. Dairy Sci. 92(11):5335–5352.

Chen, Y., Wang, Z., Chen, X., Liu, Y., Zhang, H., Sun, T. 2010. Identification of angiotensin I-

converting enzyme inhibitory peptides from koumiss, a traditional fermented mare's milk. J.

Dairy Sci. 93(3):884–892.

87

Chianese, L., Calabrese, M. G., Ferranti, P., Mauriello, R., Garro, G., Simone, C. de, Quarto, M.,

Addeo, F., Cosenza, G., Ramunno, L. 2010. Proteomic characterization of donkey milk

"caseome". J Chromatogr A 1217(29):4834–4840.

Curadi, M. C., P. G. Giampietro, P. Lucenti, Orlandi, M. 2001. Use of mare milk in pediatric

allergology., Firenze, 12.-15.06.2001.

Foekel, C., Schubert, R., Kaatz, M., Schmidt, I., Bauer, A., Hipler, U.-C., Vogelsang, H., Rabe,

K., Jahreis, G. 2009. Dietetic effects of oral intervention with mare's milk on the Severity Scoring

of Atopic Dermatitis, on faecal microbiota and on immunological parameters in patients with

atopic dermatitis. Int J Food Sci Nutr 60 Suppl 7:41–52.

Fox, P. F., Uniacke, T. 2010. Chemical and physico-chemical properties of equid milk. p. 39. In

Book of Abstracts of the 61st Annual Meeting of the European Association for Animal

Production: Heraklion - Crete Island, Greece, 23-27 August 2010. Wageningen Academic Pub.

Gaillard, J.-L., Qanbari, S., Drögemüller, C., Pimentel, E. C. G., Thaller, G., Tetens, J. 2013.

DNA-based identification of novel bovine casein gene variants. J. Dairy Sci. 96(1):699–709.

Ikonen, T., Bovenhuis, H., Ojala, M., Ruottinen, O., Georges, M. 2001. Associations between

casein haplotypes and first lactation milk production traits in Finnish Ayrshire cows. J. Dairy Sci.

84(2):507–514.

Jónsson, H., Schubert, M., Seguin-Orlando, A., Ginolhac, A., Petersen, L., Fumagalli, M.,

Albrechtsen, A., Petersen, B., Korneliussen, T. S., Vilstrup, J. T., Lear, T., Myka, J. L.,

Lundquist, J., Miller, D. C., Alfarhan, A. H., Alquraishi, S. A., Al-Rasheid, K. A. S., Stagegaard,

J., Strauss, G., Bertelsen, M. F., Sicheritz-Ponten, T., Antczak, D. F., Bailey, E., Nielsen, R.,

Willerslev, E., Orlando, L. 2014. Speciation with gene flow in equids despite extensive

chromosomal plasticity. Proceedings of the National Academy of Sciences of the United States of

America 111(52):18655–18660.

88

Lara-Villoslada, F., Olivares, M., Xaus, J. 2005. The balance between caseins and whey proteins

in cow's milk determines its allergenicity. J. Dairy Sci. 88(5):1654–1660.

Lisson, M., Lochnit, G., Erhardt, G. 2013. Genetic variants of bovine beta- and kappa-casein

result in different immunoglobulin E-binding epitopes after in vitro gastrointestinal digestion. J.

Dairy Sci. 96(9):5532–5543.

Lisson, M., Novak, N., Erhardt, G. 2014. Immunoglobulin E epitope mapping by microarray

immunoassay reveals differences in immune response to genetic variants of caseins from

different ruminant species. J. Dairy Sci. 97(4):1939–1954.

Malacarne, M., Martuzzi, F., Summer, A., Mariani, P. 2002. Protein and fat composition of

mare's milk: some nutritional remarks with reference to human and cow's milk. International

Dairy Journal 12(11):869–877.

Martuzzi, F., Vaccari Simonini, F. 2010. Advances on equine milk and derivatives for human

consumption. p. 40. In Book of Abstracts of the 61st Annual Meeting of the European

Association for Animal Production: Heraklion - Crete Island, Greece, 23-27 August 2010.

Wageningen Academic Pub.

McLean, D. M., Graham, E. R., Ponzoni, R. W., McKenzie, H. A. 1984. Effects of milk protein

genetic variants on milk yield and composition. Journal of Dairy Research 51(04):531–546.

Miller, S. A., Dykes, D. D., Polesky, H. F. 1988. A simple salting out procedure for extracting

DNA from human nucleated cells. Nucleic Acids Res. 16(3):1215.

Orlando, L., Ginolhac, A., Zhang, G., Froese, D., Albrechtsen, A., Stiller, M., Schubert, M.,

Cappellini, E., Petersen, B., Moltke, I., Johnson, P. L. F., Fumagalli, M., Vilstrup, J. T.,

Raghavan, M., Korneliussen, T. S., Malaspinas, A.-S., Vogt, J., Szklarczyk, D., Kelstrup, C. D.,

Vinther, J., Dolocan, A., Stenderup, J., Velazquez, A. M. V., Cahill, J., Rasmussen, M., Wang,

X., Min, J., Zazula, G. D., Seguin-Orlando, A., Mortensen, C., Magnussen, K., Thompson, J. F.,

89

Weinstock, J., Gregersen, K., Røed, K. H., Eisenmann, V., Rubin, C. J., Miller, D. C., Antczak,

D. F., Bertelsen, M. F., Brunak, S., Al-Rasheid, K. A. S., Ryder, O., Andersson, L., Mundy, J.,

Krogh, A., Gilbert, M. T. P., Kjær, K., Sicheritz-Ponten, T., Jensen, L. J., Olsen, J. V., Hofreiter,

M., Nielsen, R., Shapiro, B., Wang, J., Willerslev, E. 2013. Recalibrating Equus evolution using

the genome sequence of an early Middle Pleistocene horse. Nature 499(7456):74–78.

Rozen, S., Skaletsky, H. 2000. Primer3 on the WWW for general users and for biologist

programmers. Methods Mol. Biol. 132:365–386.

Saletti, R., Muccilli, V., Cunsolo, V., Fontanini, D., Capocchi, A., Foti, S. 2012. MS-based

characterization of α(s2)-casein isoforms in donkey's milk. J Mass Spectrom 47(9):1150–1159.

Schubert, M., Jónsson, H., Chang, D., Der Sarkissian, C., Ermini, L., Ginolhac, A., Albrechtsen,

A., Dupanloup, I., Foucal, A., Petersen, B., Fumagalli, M., Raghavan, M., Seguin-Orlando, A.,

Korneliussen, T. S., Velazquez, A. M. V., Stenderup, J., Hoover, C. A., Rubin, C.-J., Alfarhan, A.

H., Alquraishi, S. A., Al-Rasheid, K. A. S., MacHugh, D. E., Kalbfleisch, T., MacLeod, J. N.,

Rubin, E. M., Sicheritz-Ponten, T., Andersson, L., Hofreiter, M., Marques-Bonet, T., Gilbert, M.

T. P., Nielsen, R., Excoffier, L., Willerslev, E., Shapiro, B., Orlando, L. 2014. Prehistoric

genomes reveal the genetic foundation and cost of horse domestication. Proc. Natl. Acad. Sci.

U.S.A. 111(52):E5661-9.

Schubert, R., Kahle, C., Kauf, E., Hofmann, J., Hubert, I., Gruhn, B., Hafer, R., Vogelsang, H.,

Jahreis, G. 2009. Dietetic efficacy of mare's milk for patients with chronic inflammatory bowel

diseases - clinical study. Ernährung 33(7/8):314–321.

Uniacke-Lowe, T., Huppertz, T., Fox, P. F. 2010. Equine milk proteins: Chemistry, structure and

nutritional significance. International Dairy Journal 20(9):609–629.

90

91

GENERAL DISCUSSION

The present study is part of the competence network FoCus (Food Chain Plus) which aims to

identify health-promoting ingredients of milk and to use them for functional dairy products. The

exploration of the functional dairy products and the investigation of the effects of these products

on nutrition related disorders are a focal point of the project. The effects of milk and milk products

on human health are of interest not only for science but also for the dairy industry and the

disposability of products, which are optimized with respect to their bioactive components.

Primarily, cow milk and cow milk products were investigated in the FoCus project. The interest in

mare milk arose due to the observed health benefit effects of mare milk and mare milk products on

diseases like atopic dermatitis (Foekel et al., 2009), chronic inflammatory bowel diseases (Schubert

et al., 2009) or cardiovascular disorders (Chen et al., 2010). Furthermore, mare milk is tolerated by

96 % of children affected by cow milk protein allergy (Businco et al., 2000; Curadi et al., 2001).

The milk proteins are known to contribute to the health affecting components of milk, and the high

nutritional value of milk is based not only on the supply of many vitamins, minerals and fatty acids,

but also in the high quality protein, which provides all essential amino acids. During digestion,

milk proteins are degraded into peptides which may have bioactive functions and influence human

health. Whereas there are several studies dealing with the release of bioactive peptides from bovine

milk proteins (Clare and Swaisgood, 2000), the knowledge about the release of these peptides from

horse milk is scarce. Due to alterations in the amino acid sequence caused by single nucleotide

exchanges or deletions as well as duplications on the DNA level, the release of these bioactive

peptides may be affected as gene mutations can alter the cleavage sites for proteolytic enzymes.

Furthermore, amino acid exchanges can modify the binding epitopes for IgE mediated allergenic

reactions, which affects the allergenic potential of the milk. In addition, milk protein variants may

influence the processing properties of the milk. Therefore, the aim of this study was to unravel the

degree of genetic variability in equine milk protein genes. To this end, the six main milk protein

genes of 198 horses were resequenced. Furthermore, data from next generation sequencing of 55

horses was evaluated and the structure of CSN1S2, the gene coding for αs2-casein, was analyzed on

RNA, DNA and protein level. The results of the sequencing of equine ß-lactoglobulin are illustrated

in Chapter II, variants of equine casein genes are summarized in Chapter III and the results of the

examination of equine CSN1S2 are topic of Chapter IV. Altogether, 44 milk protein gene variants

92

were identified, 35 of them considered as novel. Moreover, two additional coding exons were

identified for equine CSN1S2, and ancient duplication and deletion events in this gene were shown

on DNA, as well as on the RNA and protein level. The result of the sequencing of equine α-

lactalbumin will be illustrated in the following and discussed together with the results of the other

milk protein genes in a general context.

Resequencing of equine α-lactalbumin

In Chapter II the results of the sequencing of the equine whey protein genes LGB1 and LGB2 are

described. The results of the sequencing of LALBA, the gene coding for α-lactalbumin, were not

incorporated in this study. As these results are interesting for the general discussion they are

presented in the following.

For the resequencing of the open reading frame of LALBA a total of four primer pairs was designed

(Supplemental Table 5). PCR amplification and DNA sequencing were done as described by

Gallinat et al. (2013). Equine LALBA was successfully sequenced in 183 horses belonging to 8

breeds (Supplemental Table 6). All the examined animals showed no differences to the genomic

GenBank reference sequence NC_009149.2 and the corresponding mRNA sequence

XM_001915789 and no genetic variability was found in this gene. The uniformity of equine

LALBA will be subject to discussion below.

Selected animals and applied methods

Equine DNA was isolated from blood and hair samples which were collected from farms in

Germany. We focused on breeds which are used for dairy production in Germany. Nevertheless,

we tried to cover a wide spectrum of different breeds that provide high genetic variability.

Therefore, not only samples of the widely used dairy breed Haflinger were analyzed, but also from

German Warmblood Horses, some special breeds as well as one heavy breed. One of the examined

breeds was a crossbreed for dairy production. Mares kept in this stud have been selected for some

generations for milk yield and milkability, which is a very rare breeding objective in horse

breeding. The blood samples and the hair samples showed no considerable differences of the

isolated DNA regarding DNA yield and quality. The main advantage of hair samples is that no

veterinarian is required for sample collection. To properly take a hair sample, some hairs with roots

from mane or tail need to be ripped out. This procedure was very easy and needed only scarce

93

intervention to the animals. Furthermore, the handling of hair samples was uncomplicated with

regard to transport and storage. The DNA isolated from these samples was examined by direct

sequencing. Almost all known variants of equine milk protein genes and 35 newly identified

variants were found with this method, which demonstrates that it presents an advantageous

approach for detecting milk protein variants on the genetic level. Recent progress in DNA-

sequencing made this method feasible with regard to costs and time, results can be generated

quickly and genotypes for each animal are available, which is an advantage compared to milk

protein analysis from pooled samples. Furthermore, DNA material is easier to sample than milk,

which is required for protein analysis. The main disadvantage of our method is that it provides no

information about the expression of the identified variants. As there are already splicing variants

described in equine milk proteins, analysis of RNA would be eligible. A first step towards this

approach was the RNA analysis of CSN1S2 (Chapter IV). For RNA isolation milk samples are

indispensable even though they are more difficult to gain. Due to the fact that we had Haflinger

mares from a local dairy stud in our study, it was possible to obtain milk samples from four mares

which were already genotyped. The RNA isolation from this milk was done with a RNeasyMini

Kit (Qiagen GmbH, Hilden, Germany) as described by the manufacturer. This method was a

suitable method for mare milk and we were able to extract adequate RNA yield from the fresh

whole mare milk. Certainly, it was of special importance to monitor strict hygienic standards during

milking and preperation to prevent the RNA from degradation by RNase. Likewise, the time

between milking and processing the milk in the lab should be as short as possible, to achieve a high

RNA yield. cDNA was written from the RNA with SuperScript® III First-Strand Synthesis

SuperMix kit (Invitrogen). For optimum results in sequencing the cDNA, the RNA should be

cleaned off thoroughly to remove free dNTPs, primers and further contaminations. With the

generated cDNA it was possible to confirm our DNA based results of the structure of CSN1S2 and

to expand the mRNA sequence for one coding exon which was previously not annotated.

Furthermore, duplication and deletion events in this gene were elucidated. By in-gel digestion of

crude milk from two mares it was possible to confirm the differences in length of equine αs2-caseins

observed on the genetic level on the protein level as well.

To expand our selection of equine breeds, individual whole genome sequence variant calling data

of a total 55 horses of 11 different breeds were incorporated in the study. The results of the

sequencing of the German equine dairy breeds were confirmed with this data to a large extent.

94

A problem in equine dairy production is that nearly no milk performance data is recorded. Data

about milk yield, protein and fat content of the equine milk are hardly available, so that possible

association of genotype data with phenotypes cannot be investigated. Conclusions about

advantages or disadvantages of a certain milk protein genotype compared to cattle (Caroli et al.,

2009) are difficult to make.

With the applied methods, it was possible to archieve substantial new information about the equine

milk protein genes. Nevertheless, the genetic variants of equine milk protein genes and the

provisional nomenclature of these variants should be validated in future studies on RNA and

protein level.

Impact of variability of milk protein genes in horses

Genetic variability of milk protein genes is well characterized in bovine milk and several different

variants of the six main milk proteins are known (Caroli et al., 2009). Ovine (Giambra and Erhardt,

2012) and caprine (Selvaggi et al., 2014) milk protein variants were subject to scientific interest as

well. In these typical dairy species, the knowledge about different milk protein variants, which

might alter the quality of the milk and influence the nutritive value as well as the processing

properties, is of interest for the economic value of the milk and consequently for breeding decisions.

Recently, commercial interest arises for functional milk products with optimized bioactive

components. Claimed health benefits of milk products may be an important argument for the

customer making a purchase decision. Horses are not a typical dairy species and the extent of mare

milk production is much lower than milk production in cattle or even in sheep or goat. As the mare

milk production in Europe amounts to roughly 1 million kg (Fox and Uniacke, 2010), the economic

impact of mare milk is negligible compared to the typical dairy species. The sale of mare milk is

therefore mostly based on direct marketing. However, there is specific interest in mare milk

because health effects of mare milk have empirically been known since decades. So far, studies

about mare milk proteins are mainly based on protein level (Miranda et al., 2004), some studies are

dealing with RNA analysis (Lenasi et al., 2003). DNA based results are scarce (Hobor et al., 2006;

2008) and knowledge about equine milk protein variants is marginal. However, the present study

identified several previously unknown equine milk protein variants. For αs1-casein, 6 gene variants

were found and 4 gene variants of ß-casein were detected. The analysis of αs2-casein revealed 8

gene variants and 13 variants of equine κ-casein were found (Chapter III). Equine lactoglobulin I

95

was less variable with only two genetic variants, besides the reference sequence only one signal

peptide variant of this gene was found. With 10 genetic variants, equine ß-lactoglobulin II showed

more genetic variability (Chapter II). Equine α-lactalbumin was least variable, all animals involved

in our study were uniform considering the open reading frame of LALBA, the gene coding for this

protein.

The uniformity of equine LALBA is probably due to its particular importance in lactose synthesis.

Stacey et al. (1995) showed that in mice an α-lactalbumin deficit caused by a deletion of the

LALBA gene leads to a reduced amount of thickened milk containing little or no lactose, which is

not sufficient to nurse the offspring. Nevertheless, prior studies described multiple forms of equine

α-lactalbumin. Girardet et al. (2004) found different isoforms of equine α-lactalbumin, explained

by posttranslational modifications, which were not investigated in our study. Godovac-

Zimmermann et al. (1987) detected three different isoforms of α-lactalbumin, declared by amino

acid exchanges in the mature protein (Chapter I). In case of the two lactoglobulin genes, LGB1 was

found to be strongly conserved across breeds, while LGB2 was highly variable. This indicates a

higher selective pressure on LGB1 and suggests that it is the ancestral paralogue which has a crucial

function that has to be maintained. In ruminants there is only one gene coding for ß-lactoglobulin,

but the existence of a ß-lactoglobulin pseudogene was demonstrated (Passey and Mackinlay, 1995).

Eleven variants of bovine ß-lactoglobulin were described (Caroli et al., 2009), nearly as variable

as the equine ß-lactoglobulin II. Equine κ-casein was the most variable gene among the casein

genes with 13 variants detected within our study. Similar variability of κ-casein was observed in

cattle, with 14 variants of this gene noted (Caroli et al., 2009). In sheep, this gene showed almost

no variability (Ceriotti et al., 2004; Feligini et al., 2005), the selection for good cheese making

properties in sheep was discussed as a possible reason for the conservation of ovine κ-casein

(Ceriotti et al., 2004; Tetens, 2014). Even though this gene was shown to be highly variable in

horses as well as in cattle, κ-casein is essential for lactation. Shekar et al. (2006) showed that a lack

of this gene leads to destabilization of micelles, resulting in failure of lactation in mice. This result

was in contrast to comparable studies in goats with a lack of αs1-casein (Chanat et al., 1999) and in

mice with a lack of ß-casein (Kumar et al., 1994). A lack of these genes was not critical for lactation

or milk micelle formation, although the lack of αs1-casein reduces the rate of transport of the other

caseins. Even though lactation was sustained in the animals lacking αs1- or ß-casein, the growth of

the suckling pup was reduced in mice (Kolb et al., 2011; Kumar et al., 1994). Shekar et al. (2006)

96

concluded, that these caseins are functionally redundant. Nevertheless, equine αs1-, ß- and αs2-

casein were observed to be less variable than κ-casein in our study. The least variable casein was

ß-casein with only four gene variants, one of them a signal peptide variant. In contrast, bovine ß-

casein showed a considerably high variability with 14 variants (Caroli et al., 2009; Gallinat et al.,

2013), being therefore the most variable bovine milk protein. A signal peptide variant was found

for αs1-casein as well, with considerably high allele frequencies up to 0.5. Whether this genetic

variant can be translated into a protein remains to be demonstrated. Possibly a lack of this protein

in animals homozygote for the signal peptide variant is compensated by the functional redundancy

of the other calcium sensitive casein genes. The equine casein genes were similar to other species

genetic variability but the casein cluster is highly conserved concerning organization and

orientation of the genes (Rijnkels, 2002), due to the importance of the caseins in lactation and

therefore in successful rear of the offspring.

Breed diversity regarding milk protein variants

The horse breeds in the current study differed in their genetic variability of milk protein genes. On

the one hand the dairy crossbreed with only 15 variants within the six main milk protein genes, on

the other hand the Icelandic Horse with 28 variants in total, nearly twice as many as the crossbreed.

Differences in variability can originate from breeding histories of the individual breeds; influencing

factors may be long time isolation as in Icelandic Horses or bottleneck effects as in Russian Heavy

Drafts. Due to the crossing of several different pony breeds (German Riding Pony, Haflinger Horse,

Connemara Pony, New Forrest Pony and further pony breeds), a high genetic variability for these

animals was expected, but this was not the case. Only two variants of CSN3, the gene coding for

equine κ-casein, were detected even though this gene was quite variable in other breeds with up to

seven different variants. Also the other caseins of crossbreed animals showed comparatively low

variability. In contrast, LGB2 of crossbred horses was more variable, with one variant exclusive to

this population. Maybe the selection of milk yield and milkability in crossbreed horses is the reason

for this low variability in caseins. Due to the close linkage of the casein genes, effects of individual

caseins are different to estimate (Lien et al., 1995), but studies on bovine casein genes showed that

some casein haplotypes influence the quality of the milk concerning fat or protein content.

Furthermore, effects on milk yield were observed (Boettcher et al., 2004). Possibly, a specific

casein haplotype leads to advantages in milk quality or yield, and animals with this genotype were

97

preferred in breeding selections. In German Warmblood Horses 25 variants of the six main milk

proteins were detected. The Warmblood samples from other countries were similar to German

Warmbloods. Due to fact, that only two UK Warmbloods, two Swiss Warmbloods and one Dutch

Warmblood were incorporated in the study it is possible that more infrequent variants of these

breeds were not found. In these animals the main German Warmblood variants were present, maybe

because extensive exchange of breeding stock between breeding organizations has been going on

for many years (Koenen et al., 2004). Only in one UK Warmblood Horse a variant was detected

which was not found in other Warmblood breeds, but in Haflinger Horses, Criollos and Franches-

Montagnes (LGB2*D1). Franches-Montagnes can be considered as light Draft or as heavy

Warmblood. The gene variants of LGB2, detected in this breed, showed considerable differences

to those from Warmblood Horses, being more similar to Haflinger Horses than to Warmbloods. In

case of the caseins, the Franches-Montagnes showed more similarities to Warmblood Horses. With

variants CSN1S1*E and CSN3*K, the Franches-Montagnes had two casein gene variants, which

are otherwise only common to warmblood breeds. These results contribute to the classification

between warmblood and draft horses, since influence from draft horses is discussed for the

Haflinger as well (Nissen, 1997).

Derivation of Casein Haplotypes

The four equine casein genes CSN1S1, CSN2, CSN1S2 and CSN3 are in close linkage in a 290 kb

cluster on chromosome 3 (ECA3) (Milenkovic et al., 2002; Egito et al., 2002; Lenasi et al., 2003;

Miranda et al., 2004; Lenasi et al., 2005; Girardet et al., 2006; Miclo et al., 2007; Martin et al.,

2009; Selvaggi et al., 2010). In Chapter III, 31 different casein gene variants were described, 26 of

them considered novel. As described in cattle, different casein variants can influence the nutritional

value of the milk (Martin et al., 2002), but the close physical location of the four caseins, which is

comparable in cattle and horses, makes it difficult to estimate effects of individual casein genes

(Lien et al., 1995). Studies on bovine casein genes showed that some casein haplotypes influence

the quality of the milk concerning fat or protein content, furthermore, effects on milk yield were

reported (Boettcher et al., 2004). The different breeds in our study showed considerable differences

in the variability of their casein genes. Presently, no studies about the influence of equine casein

haplotypes on the nutritional quality of mare milk were available; hence our intention was to

derivate the main equine casein haplotypes and to demonstrate differences between breeds. For

98

haplotype reconstruction, PHASE 2.1 (Stephens et al., 2001; Stephens and Donnelly, 2003) was

used, a program which implements a Bayesian statistical method for reconstructing haplotypes

from population genotype data. For the estimation of haplotypes, German Warmblood Horses and

crossbreed horses were selected. Furthermore, Haflinger Horses, which are the most frequent used

breed for mare milk production in Germany, were included in the analysis. In total, 102 individuals

and all 21 identified non-synonymous nucleotide exchanges were included in the haplotype

reconstruction. The default model of a case-control permutation test was used and the German

Warmblood Horses, Haflingers and crossbreed horses are subdivided into 3 groups. The estimated

haplotypes have to be taken with care, because the sample size is low, but the estimated haplotypes

may provide a first insight of casein haplotype distribution among equine breeds. Haplotype

frequencies of 0.1 and lower were not specified in the analysis. Figure 1 summarizes the most

frequent haplotypes across all breeds (Crossbreed, German Warmblood, Haflinger) and their

distribution within each breed. Haplotype order is CSN1S1, CSN2, CSN1S2 and CSN3 (αs1- ß-, αs2-

, and κ-casein encoding gene) and the haplotypes were previously deducted from genotypes.

99

Figure 1. Percentage of the most frequent casein haplotypes (CSN1S1, CSN2, CSN1S2, CSN3) within Haflinger

Horses, German Warmblood Horses and crossbreed horses

A total of 21 equine casein haplotypes were identified. The most frequent haplotype was AAAA

(CSN1S1*A-CSN2*A-CSN1S2*A-CSN3*A), with frequencies from 0.29 in Haflinger Horses up to

0.63 in Warmblood Horses. The second most frequent haplotype was A*AAA, in Haflinger Horses

with a frequency of 0.29 as common as AAAA. Again, considerable differences in haplotype

frequencies were observed between the different breeds, the crossbreed horses have an A*AAA

frequency similar to Haflinger Horses (0.21), whereas in Warmblood Horses it is only 0.08.

Nevertheless, it should be taken into account that the haplotype A*AAA includes a signal peptide

variant of CSN1S1, and currently it is not clear whether this variant is translated into a protein or

whether this variant is a null allele, as well as for other haplotypes including signal peptide variants

100

of CSN1S1 or CSN2. In general, the three breeds showed considerable differences in haplotype

distribution. In crossbreed horses, seven main haplotypes are deviated. The haplotypes AAAA and

AABA and the haplotypes A*A*AC and A*A*BC include the long and the short variant of CSN1S2

each, thus they differ from each other by an 1.3 kb deletion along CSN1S2, as described in Chapter

IV. The haplotype AAE1A was private to crossbreed horses. In this population, all haplotypes were

described with the 7 main haplotypes and no further haplotypes with a frequency of 0.1 or lower,

as found in German Warmbloods and Haflinger Horses, were found. This is in line with the

comparatively low genetic variability of the caseins of the dairy crossbreed. In Haflinger Horses,

five main haplotypes were estimated. As in the crossbreed horses, the haplotype AAAA was found

as short variant AABA as well. The haplotype AAE2C was private to Haflinger Horses. As in the

other breeds, the long variant AAAA and the short variant AABA were found in German Warmblood

Horses. With an allele frequency of 0.18, a comparatively high number of haplotypes with a

frequency of 0.1 or lower was found in this breed. Three haplotypes were private to German

Warmblood Horses, notably AAAC, A*AD1A and A*AAK. Nevertheless, for a definitive

assignment of particular casein haplotypes to individual horse breeds, more animals in total and for

each breed are required.

Mare milk for human health

Mare milk is empirically known to exhibit several health effects. In naturopathy, mare milk is used

to cure diseases like high blood pressure, bowel diseases and skin problems. Mare milk is also used

for the improvement of general physical health as mare milk is said to give more energy and to

raise the vitality. Several further indications of mare milk in naturopathy are known. None of these

effects is scientifically proven, although the effectiveness of mare milk was confirmed by long

experience of Russian sanatoria. Various literature from the former USSR is available, summarized

by Lozovich (1995). Recent studies provided first evidence for scientific elucidation of health

effects of mare milk (Chen et al., 2010; Foekel et al., 2009; Schubert et al., 2009). The more detailed

knowledge about structure and variability of equine milk proteins supplied by the present study is

a useful tool for further studies, especially about the release of different bioactive peptides from

mare milk. Mare milk is also discussed as substitute in case of a cow milk protein allergy (CMA)

(Businco et al., 2000; Curadi et al., 2001). Businco et al. (2000) showed that mare milk is tolerated

by 96% of children with CMA. The main allergens in case of a milk protein allergy are ß-

101

lactoglobulin, α-lactalbumin and αs1-casein, although no single protein can be held responsible for

the major part of allergenicity in milk (Lisson, 2014). The absence of IgE binding epitopes in

equine milk, probably due to differences in the amino acid sequence, was discussed as possible

explanation for the better tolerability of mare milk (Curadi et al., 2001; Businco et al., 2000). The

results of the recent study may thus be an important source for further investigations about the

allergenicity of mare milk. Very interesting in this context is the variant CSN1S1*A*, which is a

signal peptide variant of one of the main allergens in case of CMA. The casein haplotype A*AAA,

including this signal peptide variant, was the second most frequent casein haplotype among the

crossbreed horses, Haflinger Horses and German Warmblood Horses. Possibly the signal peptide

variant leads to a lack of this protein in the milk of animals homozygote for the CSN1S1*A*, which

is a proper explanation for a better tolerability of milk from animals with this genotype.

REFERENCES

Boettcher, P. J., Caroli, A., Stella, A., Chessa, S., Budelli, E., Canavesi, F., Ghiroldi, S.,

Pagnacco, G. 2004. Effects of casein haplotypes on milk production traits in Italian Holstein and

Brown Swiss cattle. J Dairy Sci 87(12):4311–4317.

Businco, L., Giampietro, P. G., Lucenti, P., Lucaroni, F., Pini, C., Di Felice, G., Iacovacci, P.,

Curadi, C., Orlandi, M. 2000. Allergenicity of mare’s milk in children with cow’s milk allergy.

Journal of Allergy and Clinical Immunology 105(5):1031–1034.

Caroli, A. M., Chessa, S., Erhardt, G. J. 2009. Invited review: milk protein polymorphisms in

cattle: effect on animal breeding and human nutrition. J. Dairy Sci. 92(11):5335–5352.

Ceriotti, G., Chessa, S., Bolla, P., Budelli, E., Bianchi, L., Duranti, E., Caroli, A. 2004. Single

nucleotide polymorphisms in the ovine casein genes detected by polymerase chain reaction-single

strand conformation polymorphism. J. Dairy Sci. 87(8):2606–2613.

102

Chanat, E., Martin, P., Ollivier-Bousquet, M. 1999. Alpha(S1)-casein is required for the efficient

transport of beta- and kappa-casein from the endoplasmic reticulum to the Golgi apparatus of

mammary epithelial cells. J Cell Sci 112 (Pt 19):3399–3412.

Chen, Y., Wang, Z., Chen, X., Liu, Y., Zhang, H., Sun, T. 2010. Identification of angiotensin I-

converting enzyme inhibitory peptides from koumiss, a traditional fermented mare's milk. J.

Dairy Sci. 93(3):884–892.

Clare, D. A., Swaisgood, H. E. 2000. Bioactive Milk Peptides: A Prospectus. Journal of Dairy

Science 83(6):1187–1195.

Curadi, M. C., P. G. Giampetro, P. Lucenti, and M. Orlandi. 2001. Use of mare milk in pediatric

allergology., Firenze, 12.-15.06.2001.

Egito, A. S., Miclo, L., López, C., Adam, A., Girardet, J. M., Gaillard, J. L. 2002. Separation and

characterization of mares' milk alpha(s1)-, beta-, kappa-caseins, gamma-casein-like, and proteose

peptone component 5-like peptides. J. Dairy Sci. 85(4):697–706.

Feligini, M., Vlaco, S., Curik, V. C., Parma, P., Greppi, G., Enne, G. 2005. A single nucleotide

polymorphism in the sheep kappa-casein coding region. J. Dairy Res. 72(3):317–321.

Foekel, C., Schubert, R., Kaatz, M., Schmidt, I., Bauer, A., Hipler, U.-C., Vogelsang, H., Rabe,

K., Jahreis, G. 2009. Dietetic effects of oral intervention with mare's milk on the Severity Scoring

of Atopic Dermatitis, on faecal microbiota and on immunological parameters in patients with

atopic dermatitis. Int J Food Sci Nutr 60 Suppl 7:41–52.

Fox, P. F., Uniacke, T. 2010. Chemical and physico-chemical properties of equid milk. p. 39. In

Wageningen Academic Publishers (ed.). Book of Abstracts of the 61st Annual Meeting of the

European Association for Animal Production, Heraklion - Crete Island, Greece, 23-27 August

2010.

103

Gallinat, J. L., Qanbari, S., Drögemüller, C., Pimentel, E. C. G., Thaller, G., Tetens, J. 2013.

DNA-based identification of novel bovine casein gene variants. J. Dairy Sci. 96(1):699–709.

Giambra, I., Erhardt, G. 2012. Milk proteins, milk protein variants and the importance for the

sheep breeding – a review. Züchtungskunde (84 (1)):52–73.

Girardet, J.-M., Miclo, L., Florent, S., Mollé, D., Gaillard, J.-L. 2006. Determination of the

phosphorylation level and deamidation susceptibility of equine beta-casein. Proteomics

6(12):3707–3717.

Girardet, J.-M., N’negue, M.-A., Egito, A., Campagna, S., Lagrange, A., Gaillard, J.-L. 2004.

Multiple forms of equine α-lactalbumin: evidence for N-glycosylated and deamidated forms.

International Dairy Journal 14(3):207–217.

Godovac-Zimmermann, J., Shaw, D., Conti, A., McKenzie, H. 1987. Identification and the

primary structure of equine alpha-lactalbumin B and C (Equus caballus, Perissodactyla). Biol.

Chem. Hoppe-Seyler 368(4):427–433.

Hobor, S., Kunej, T., Dovc, P. 2008. Polymorphisms in the kappa casein (CSN3) gene in horse

and comparative analysis of its promoter and coding region. Anim. Genet. 39(5):520–530.

Hobor, S., Kunej, T., Lenasi, T., Dovč, P. 2006. Kappa casein gen (CSN3) in horse: Kapa

kazeinski gen (CSN3) pri konju genetic variability in exon 1 and 4 genetska variabilnost v eksonu

1 in 4. Acta agriculturae Slovenica 88(2):83–89.

Kaminogawa, S., McKenzie, H. A., Shaw, D. C. 1984. The amino acid sequence of equine alpha-

lactalbumin. Biochem. Int. 9(5):539–546.

Koenen, E., Aldridge, L., Philipsson, J. 2004. An overview of breeding objectives for warmblood

sport horses. Livestock Production Science 88(1-2):77–84.

104

Kolb, A. F., Huber, R. C., Lillico, S. G., Carlisle, A., Robinson, C. J., Neil, C., Petrie, L.,

Sorensen, D. B., Olsson, I. A. S., Whitelaw, C. B. A. 2011. Milk lacking α-casein leads to

permanent reduction in body size in mice. PLOS ONE 6(7):e21775.

Kumar, S., Clarke, A. R., Hooper, M. L., Horne, D. S., Law, A. J., Leaver, J., Springbett, A.,

Stevenson, E., Simons, J. P. 1994. Milk composition and lactation of beta-casein-deficient mice.

PNAS 91(13):6138–6142.

Lenasi, T., Kokalj-Vokac, N., Narat, M., Baldi, A., Dovc, P. 2005. Functional study of the equine

beta-casein and kappa-casein gene promoters. J. Dairy Res. 72 Spec No:34–43.

Lenasi, T., Rogelj, I., Dovc, P. 2003. Characterization of equine cDNA sequences for αS1-, β-

and κ-casein. J. Dairy Res. 70(1):29–36.

Lien, S., Gomez-Raya, L., Steine, T., Fimland, E., Rogne, S. 1995. Associations Between Casein

Haplotypes and Milk Yield Traits. Journal of Dairy Science 78(9):2047–2056.

Lisson, M. 2014. Appearance of epitopes in bovine milk protein variants, their allergenicity and

potential use in human nutrition. Zugl.: Gießen, Univ., Diss., 2014. 1. Aufl. Édition scientifique.

VVB Laufersweiler, Gießen.

Lozovich, S. 1995. Medical uses of whole and fermented mare milk in Russia. Cultured Dairy

Products Journal(30):18–21.

Martin, P., Szymanowska, M., Zwierzchowski, L., Leroux, C. 2002. The impact of genetic

polymorphisms on the protein composition of ruminant milks. Reprod. Nutr. Dev. 42(5):433–

459.

Martin, P. D., Miclo, L., Rebours, E., Mateos, A., Miranda, G. 2009. Equus caballus mRNA

encoding CSN1S2 (alphaS2-casein) precursor (GenBank GU196267). Genetique Animale et

105

Biologie Integrative (GAI), INRA, Domaine de Vilvert, Jouy-En-Josas 78350, France.

Unpublished.

Miclo, L., Girardet, J.-M., Egito, A. S., Mollé, D., Martin, P., Gaillard, J.-L. 2007. The primary

structure of a low-Mr multiphosphorylated variant of beta-casein in equine milk. Proteomics

7(8):1327–1335.

Milenkovic, D., Martin, P., Guérin, G., Leroux, C. 2002. A specific pattern of splicing for the

horse αS1-Casein mRNA and partial genomic characterization of the relevant locus. Genet Sel

Evol 34(4):509.

Miranda, G., Mahé, M.-F., Leroux, C., Martin, P. 2004. Proteomic tools to characterize the

protein fraction of Equidae milk. Proteomics 4(8):2496–2509.

Nissen, J. 1997. Enzyklopädie der Pferderassen: Europa. Kosmos, Stuttgart.

Passey, R. J., Mackinlay, A. G. 1995. Characterisation of a second, apparently inactive, copy of

the bovine beta-lactoglobulin gene. Eur. J. Biochem. 233(3):736–743.

Rijnkels, M. 2002. Multispecies comparison of the casein gene loci and evolution of casein gene

family. J Mammary Gland Biol Neoplasia 7(3):327–345.

Schubert, R., Kahle, C., Kauf, E., Hofmann, J., Hobert, I., Gruhn, B., Häfer, R., Vogelsang, H.,

Jahreis, G. 2009. Dietetic efficacy of mare’s milk for patients with chronic inflammatory bowel

diseases – clinical study. Ernährung/Nutrition 33(7-8):314–321.

Selvaggi, M., Laudadio, V., Dario, C., Tufarelli, V. 2014. Major proteins in goat milk: an updated

overview on genetic variability. Mol. Biol. Rep. 41(2):1035–1048.

Selvaggi, M., Pesce Delfino, A. R., Dario, C. 2010. Exon 1 polymorphisms in the equine CSN3

gene: SNPs distribution analysis in Murgese horse breed. Anim. Biotechnol. 21(4):252–256.

106

Shekar, P. C., Goel, S., Rani, S. D. S., Sarathi, D. P., Alex, J. L., Singh, S., Kumar, S. 2006.

kappa-casein-deficient mice fail to lactate. Proc Natl Acad Sci U S A 103(21):8000–8005.

Stacey, A., Schnieke, A., Kerr, M., Scott, A., McKee, C., Cottingham, I., Binas, B., Wilde, C.,

Colman, A. 1995. Lactation is disrupted by alpha-lactalbumin deficiency and can be restored by

human alpha-lactalbumin gene replacement in mice. Proc. Natl. Acad. Sci. U.S.A. 92(7):2835–

2839.

Stephens, M., Donnelly, P. 2003. A comparison of bayesian methods for haplotype

reconstruction from population genotype data. American journal of human genetics 73(5):1162–

1169.

Stephens, M., Smith, N. J., Donnelly, P. 2001. A new statistical method for haplotype

reconstruction from population data. American journal of human genetics 68(4):978–989.

Tetens, J. L. 2014. Genetic variability of bovine and ovine milk protein genes. Dissertation,

Universität Kiel. Schriftenreihe des Instituts für Tierzucht und Tierhaltung der Christian-

Albrechts-Universität zu Kiel; Heft 208

107

GENERAL SUMMARY

In contrast to bovine, ovine or caprine milk, mare milk is a rather uncommon source of nutrition,

not only because the production is quite demanding. Nevertheless, the use of mare milk in human

nutrition is appreciated since decades. Mare milk has a high nutritional value with a high-quality

protein. The protein composition of this milk is similar to the protein composition of human milk.

Furthermore, mare milk can improve human´s health and is thus used in naturopathy to cure several

diseases. First scientific evidence for the effectiveness of this milk in case of chronic-inflammatory

bowel diseases, atopic dermatitis and cardiovascular diseases were provided in the last years,

however, the exact mechanism of action remains unknown until today. Moreover, horse milk is

used as hypoallergenic alternative in case of a cow milk protein allergy (CMA).

This study was conducted within the scope of the competence network Food Chain Plus (FoCus)

which aims to identify health benefitting compounds of milk. Due to the special properties of mare

milk regarding human health and usability as hypoallergenic food source this milk became the

focus of interest of this project. The protein fraction and especially the six main milk proteins αs1-

, ß-, αs2- and κ-casein, as well as α-lactalbumin and ß-lactoglobulin play an important role in the

health effects of mare milk. Milk protein variants, as already described in the typical dairy species,

may have an influence not only on production traits, but also on the health effects of mare milk.

Due to alterations in the amino acid sequence, the release of bioactive peptides during digestion

can be influenced. Furthermore, these alterations can influence IgE binding epitopes, which may

alter the allergenic potential of mare milk.

Therefore, the aim of the current study was to investigate the structure and variability of the six

main protein genes of mare milk. For this approach, the open reading frames of these genes were

resequenced in a total of 253 horses of 14 different breeds.

Chapter I gives an overview of the available literature. After the history of the horse as a dairy

animal is shortly illustrated, the production of mare milk is explained. The composition of mare

milk is described in detail, with special regard to the protein composition. The six main milk

proteins are described and the current knowledge about the variability of these genes is mentioned.

The chapter is completed with details about the utilization of horse milk and the described effects

on human health are pointed out.

108

In Chapter II the results of the sequencing of the equine milk proteins LGB1 and LGB2 are

demonstrated. The two paralogous genes, which are coding for ß-lactoglobulin I and II were

sequenced in in 249 horses of 14 breeds. In LGB1, besides the known variants only one signal

peptide variant was found. In LGB2, 10 genetic variants were detected, 8 of them considered novel.

A provisional nomenclature was established for these variants. The striking differences in

variability of the two genes may lead to the conclusion that LGB1 is the ancestral variant of the

two paralogues genes, which has an important function and thus underlies a high selection pressure.

Chapter III presents the results of the sequencing of the open-reading-frame of the four casein

genes CSN1S2, CSN2, CSN1S2 and CSN3. The analysis of the DNA from 253 horses of 14 different

breeds revealed 21 non-synonymous and 11 synonymous nucleotide exchanges. This results in 31

predicted casein gene variants, 26 of them previously unknown. In case of αs1-casein, a signal

peptide variant was identified with comparatively high allele frequencies up to 0.5. If this variant

is translated into a protein remains to be demonstrated. Because this casein belongs to the main

allergens in case of CMA, this variant is of special interest for the allergenicity of mare milk. A

provisional nomenclature was established for the variants.

Chapter IV comprises the annotation of a 1.3 kb deletion of CSN1S2, the gene coding for αs2-

casein. The deletions spans two coding exons, one of them an equid specific duplication of a known

exon. To confirm the DNA-based results, cDNA was obtained from milk of mares with known

genotype and sequenced afterwards. Moreover, on the protein level with SDS-page and in-gel

digestion with following LC-MS analysis, it was possible to show that both proteins are expressed.

The comparison with published sequences of other equids revealed that the deletion has probably

occurred before the ancestor of present-day asses and zebras diverged from the horse lineage.

So far, the knowledge about the variability of equine milk protein genes was limited. Within the

current study, it was possible to show that there are several variants of the six main milk proteins

in horses. The method of direct sequencing was proven as an excellent instrument to detect the

known and new variants. As mare milk was observed to influence human`s health, the improved

knowledge about the protein fraction may help to understand the mechanism of action of mare

109

milk. Furthermore, milk protein variants may influence the allergenicity of milk considerably.

Therefore, the results of this study are a useful tool for further research on health beneficial effects

and allergenicity of mare milk.

110

111

ALLGEMEINE ZUSAMMENFASSUNG

Im Gegensatz zu Kuh-, Schaf- oder Ziegenmilch stellt Stutenmilch ein eher außergewöhnliches

Nahrungsmittel dar was nicht zuletzt der aufwendigen Produktion geschuldet sein dürfte.

Gleichwohl wird die Verwendung von Stutenmilch seit Jahrhunderten geschätzt. Stutenmilch hat

eine sehr gute nutritive Wertigkeit mit einer hervorragenden Proteinzusammensetzung, welche der

Proteinzusammensetzung menschlicher Milch ähnelt. Weiterhin kann Stutenmilch die Gesundheit

des Menschen positiv beeinflussen und wird daher hauptsächlich in der Naturheilkunde als

Heilmittel für verschiedene Krankheiten eingesetzt. Erste wissenschaftliche Belege für die

Wirksamkeit der Stutenmilch bei chronisch-entzündlichen Darmerkrankungen, Neurodermitis und

kardiovaskulären Erkrankungen konnten in den letzten Jahren erbracht werden, der genaue

Wirkmechanismus ist hingegen bis heute unbekannt. Die Milch von Pferden wird auch als

hypoallergenes Lebensmittel im Falle einer Kuhmilchproteinallergie (CMA) genutzt.

Das Kompetenznetzwerk Food Chain Plus (FoCus), im Rahmen dessen diese Studie angefertigt

wurde, hat es sich zum Ziel gesetzt, gesundheitsfördernde Inhaltstoffe der Milch zu identifizieren.

Durch ihre besonderen Eigenschaften im Hinblick auf die Gesundheit des Menschen und ihre

Nutzbarkeit als hypoallergenes Lebensmittel rückte die Stutenmilch in den Fokus des Interesses

im Rahmen dieses Projektes. Da die Proteinfraktion dieser Milch nicht nur für die Allergenität der

Milch, sondern auch für ihre Gesundheitseffekte von großer Bedeutung scheint, war das Ziel der

vorliegenden Studie, die Struktur und Variabilität der equinen Milchproteingene zu erforschen. Die

sechs Hauptmilchproteine αs1-, ß-, αs2- und κ-Casein, sowie α-Lactalbumin und ß-Lactoglobulin

sind sowohl beim Rind als auch bei Schaf und Ziege dafür bekannt, sehr variabel zu sein. Durch

genetische Variabilität von Milchproteinen kann es zur Beeinflussung von gesundheitlichen

Effekten durch die Freisetzung von bioaktiven Peptiden kommen und auch die Allergenität der

Milch kann beeinflusst werden.

In Kapitel I wird ein Überblick über die vorhandene Literatur gegeben. Nachdem zunächst kurz

auf die Geschichte des Pferdes in der Milchproduktion eingegangen wird, wird die Produktion von

Stutenmilch erläutert. Auf die Zusammensetzung dieser Milch wird ausführlich eingegangen und

die Proteinfraktion findet dabei besondere Berücksichtigung. Die sechs Hauptmilchproteine

werden erläutert und bestehendes Wissen über die Variabilität dieser Gene wird dargelegt.

112

Abgeschlossen wird dies Kapitel mit Fakten über die Nutzung von Stutenmilch, wobei auch die

beschriebenen Effekte auf die Gesundheit des Menschen und die Allergenität berücksichtigt

werden.

Kapitel II widmet sich den equinen Molkenproteingenen LGB1 und LBG2. Die zwei paralogen

Gene, welche für ß-Lactoglobulin I und II codieren, wurden in 249 Pferden aus 14 Rassen re-

sequenziert. Neben den bekannten Varianten konnte nur eine Signalpeptidvariante von LGB1

identifiziert werden. LGB2 dagegen zeigte zehn Genvarianten, acht davon waren vorher unbekannt.

Für diese Varianten wurde eine vorläufige Nomenklatur erstellt. Die unterschiedliche Variabilität

der beiden Gene kann ein Hinweis darauf sein, dass LGB1 die anzestrale Variante der beiden

paralogen Gene ist, die eine essentielle Funktion hat und somit einem hohen Selektiondruck

unterliegt.

In Kapitel III werden die Ergebnisse der Re-Sequenzierung des offenen Leserahmens der vier

Caseingene CSN1S1, CSN2, CSN1S2 und CSN3 vorgestellt. Die Analyse der DNA von 253 Pferden

aus 14 Rassen ergab 21 nicht-synonyme, sowie 11 synonyme Nukleotidaustausche. Dies führte 31

Caseinvarianten von denen 26 bislang noch nicht bekannt waren. Im Fall von αs1-Casein konnte

eine Signalpeptidvariante mit vergleichsweise hohen Allelfrequenzen bis hin zu 0,5 identifiziert

werden. Ob diese Signalpeptidvariante überhaut in ein Protein übersetzt wird, bleibt zu klären. Da

dies Casein zu den Hauptallergenen bei CMA gehört, ist diese Variante bezüglich der Allergenität

der Stutenmilch besonders interessant. Für die Caseinvarianten wurde eine vorläufige Nomenklatur

erstellt.

Kapitel IV beinhaltet die Aufklärung einer 1,3 kb großen Deletion auf CSN1S2, dem Gen, welches

für αs2-Casein codiert. Die Deletion beinhaltet zwei codierende Exons, von denen eins eine für

Equiden typische Duplikation eines bekannten Exons darstellt. Um die DNA-basierten Ergebnisse

zu bestätigen, wurde aus der Milch von Stuten mit bekanntem Genotyp cDNA gewonnen und

sequenziert. Ferner konnte auf Proteinebene mit SDS-page und In-Gel-Verdau mit nachfolgender

LC-MS Analyse nachgewiesen werden, dass beide Proteine expressiert werden. Durch den

Vergleich mit bekannten Sequenzen von anderen Equiden konnte gezeigt werden, dass die Deletion

113

vermutlich bereits vorhanden war, bevor die Vorfahren der heutigen Esel und Zebras sich von den

Pferden abspalteten.

Bislang war wenig über die Variabilität der Milchproteine aus Stutenmilch bekannt. Mit der

vorliegenden Studie konnte gezeigt werden, dass auch beim Pferd verschiedene Varianten der

sechs Hauptmilchproteine zu finden sind. Die Methode der direkten Sequenzierung war ein

hervorragendes Instrument um die bekannten und bisher unbekannte Varianten zu entdecken.

Kenntnisse über die Milchproteinvarianten des Pferdes können einen Beitrag leisten zur

Aufklärung des Wirkmechanismus der Stutenmilch im menschlichen Körper. Weiterhin können

Milchproteinvarianten die Allergenität der Milch erheblich beeinflussen. Die Ergebnisse der

vorliegenden Studie sind somit eine ausgezeichnete Grundlage für weitere Analysen zur

Stutenmilch und ihrer Wirksamkeit.

114

115

SUPPLEMENTAL TABLES

Supplemental Table 1. Individual genome coverage for whole-genome sequences incorporated in the study.

Sample ID sex breed coverage

HF10 f Haflinger 10.4

FM2001 m Franches-Montagnes 8.8

RAO310 m Swiss Warmblood 12.7

RAO441 m Swiss Warmblood 5.6

FM1178 m Franches-Montagnes 5.3

FM1785 m Franches-Montagnes 17.7

FM1190 m Franches-Montagnes 19.2

FM1951 m Franches-Montagnes 22.6

FM1176 m Franches-Montagnes 16.1

FM1435 m Franches-Montagnes 15.1

FM0431 m Franches-Montagnes 14.4

FM0467 m Franches-Montagnes 18.0

FM0474 m Franches-Montagnes 18.8

FM1041 m Franches-Montagnes 9.4

FM1030 m Franches-Montagnes 19.7

P1 m German Warmblood 16.4

FM0001 f Franches-Montagnes 25.3

FM0570 m Franches-Montagnes 16.2

FM0673 f Franches-Montagnes 20.2

FM0664 f Franches-Montagnes 7.5

FM0238 m Franches-Montagnes 9.7

FM2218 m Franches-Montagnes 13.7

FM0334 m Franches-Montagnes 10.7

FM1798 m Franches-Montagnes 16.3

FM1932 m Franches-Montagnes 12.3

FM1948 m Franches-Montagnes 9.9

FM0450 m Franches-Montagnes 18.4

FM0512 m Franches-Montagnes 15.9

FM1048 f Franches-Montagnes 10.7

FM1215 f Franches-Montagnes 13.2

FM1339 f Franches-Montagnes 17.1

FM1369 f Franches-Montagnes 16.1

FM1459 f Franches-Montagnes 16.6

FM1625 m Franches-Montagnes 16.3

UKH3 f UK Warmblood 19.1

BW01 m German Warmblood 17.9

BY01 m German Warmblood 18.2

HAN01 m German Warmblood 14.0

HOL01 m German Warmblood 20.7

HOL02 m German Warmblood 13.1

OLD01 m German Warmblood 20.5

116

Sample ID sex breed coverage

OLD02 m German Warmblood 17.4

TRA01 m German Warmblood 14.8

TRA02 m German Warmblood 23.8

WF01 m German Warmblood 22.2

WF02 m German Warmblood 17.2

UKH4 f UK Warmblood 20.1

SW024 NA Swiss Warmblood 12.4

KWPN1 NA Dutch Warmblood 12.4

IS074 m Icelandic 11.1

AKT001 m Akhal-Teke 33.0

Supplemental Table 2. Primer sequences for the resequencing of equine ß-lactoglobulin genes LGB1 and LGB21

Gene Exon Primer forward (5`-3`) Primer reverse (3`-5`) Product

size

LGB1 2 TCCTATTGTCCCAGTCAAGGAAG GACATGGCTGGAGATGGAAAAAT 793

3 AGAACCGCAACCCAATTCCT ACAATCCTGGGGTTTGAGTCCT 668

4 TCTCTCTGGCTCCATCTGACTTCT AGGGTATGACAGGATGGGTCAA 664

5 TGGAGACCTCATTTCTCAACCAC TGAACAAAGCCTGTTGGATTCAT 667

6 CACTTTTCTTCCTGTGACCATGC CAGTTCCAGCCATTCCCAAA 765

7 TCGATGAGGAGATCATGGAGAAA CCAGAAGTAGTGGTGGGGACATAA 616

LGB2 2 AAGGCTTCCTATTGTCCCAGTTG CAAGCTTCCCACCCTCAAAATAA 507

3 GGGTTGACACAGCAGGGTTATTT TATGTGGTCAGCCTGTTAGTCCA 528

4 GATTTCCTAGCTGTGTCCCTTGA TCCTATGTCAAGCAGGGAGAACA 590

5 TCTGGGGTCCATAACACTTGCT TCATTGAAAATCTCCTTCCGTCA 676

6 GGGCCATTTTCCTACCATAACTG TGGTTGGTACGTTACCCGATGA 686

7 GGGCCATTTTCCTACCATAACTG CAGTTCCAGCCATTCCCAAA 780

1 The annealing temperature was 62°C for all primer pairs

117

Supplemental Table 3. Primer sequences for the resequencing of equine casein genes1

Gene Exon Primer forward (5`-3`) Primer reverse (3`-5`) Product

size

CSN1S1 2 CCGAATCAAACGTTCTGTTTTAGAG

T

TGAAGCATTTCTACAGTTTCAGTGTCA 495

3 TTCCTTTTTGTTCCAAGGGAAAC TTCAACGTGTGAAATGAGACCAA 580

4 TGGAACTTAAGCGATGTGCTGAT CGAACACGCATTTAATGAAAACA 556

5 TAGGCCCGGTAAAGAAGAGATGA GATTTTGCAAAGGAAAGCACAAG 474

6-7 TCAAGTCCCAGGAAAAACATTGA TGTCTGACTGAAAAGTTCAAGGAAA 780

8 TCATCAAGGGTGTTAGATAAAGCA

GT

GGGCCATGTAGACAATAGTGACA 500

9 CTTTTGGTTAGTTCAGGCCAGGT TGGGATGGTAGAGGCAGAGTTTT 499

10 TTCCATCTTGAAACTGGTTGTTG TTTTCCCAGAAACAATTCTGCAAT 681

11-12 GAAAGCGGTGAGAAGAGAAAAGG GATCCCCAAGGAGACTGTGAAAT 598

13 AAGTAAAATTGCCCAAATGCTCA TGCAACATCAGGGAGGCTATAAA 622

14 TCCACTGGAATTCATCATTACCG CACATTCATTTTGCAGTGTACCAA 623

15 TCCTGGAGAACTGGTAGGCTATT TCCCATCCAAAGAATAGTGGTCA 498

16 GCTAGGCCAATTCCATACGAATC TCACAGCATGAATAGCCAGTAGGA 569

17 TATTTCCTCCCCAAACTCCCATA ACTTTCAGAAGGGGGCCTTTTAG 1131

18 CTAAAAGGCCCCCTTCTGAAAGT GCTCACACGTTCCTGATTAATGG 561

19 TTCAACTTTATCCTCCTGGCACTT TTGGGTTCACCAGAGTCTCAAAG 677

CSN2 2 TGAGATGAAACAGAGTGAGGTAGG

G

GGTTGCACATGAATGCAACTGT 663

3-4 TCAAAAACTGTTCTTCATGCAGGT TGAATGAGGTCAGTGCAGAGAGA 699

5-6 AAACAAGGTGTCTGCATTAACACA

T

TGTTTATTGAAAACAGGCATACCA 812

7 AGTAGCCTTCACATGACCCAAAA CTTCCCAATGCTCAGTTTCCTCT 971

8 TGGGCTTGAAATAAGGAAGGTTT TCAGGTCAGTAAATAACAGCCAACTG 695

CSN1S2 2 CAGTCTTCATGCTTCTTTCCCAAC TCCTGTCTAAACATCACGGATTCA 644

3 AAAAACTGAGAACACAACCACTTC

C

GATGTCTTTGGGCACCTGTTATG 664

4-5 TCTGTGGATGATATTTGGGGAAA GGGGAAGACAAGTAAAGTGATGGA 674

6 GGAAAAGATTTGTGAGCCATTTG TCTGGGAATTGATTCATGCAAAA 463

7 CAATGACAATAAATACCACTGGTT

GC

TGACTAAAGGGGACAGGGAAAAA 664

8 TTTTTCCCTGTCCCCTTTAGTCA GTGACCAGAAGAAATCCTCAGCA 568

9 ACACAGAATGAGGGCTCTGATGA AAGTTGAGTGGGCGTTAACATGA 661

10 TGTTCTGGAGGCTTCAATTAATCA GAAAGAACTTGGAAGTCGTGTGA 781

11 GCTAGAGACAAAATGCCCAACAA TTTCTGTTCTGCCATCCACAAAT 635

12 TTGGTTCCCTGATGAGCTATGTC CATGACTTTTCTGGGAACACCTG 627

13-14 TTGCATGTGCCTATACTCCACAA AACTGGGGAATAATGGTTTGGTG 670

15 CTTGCCTTCTGACACATCCTTTC AACAAACACTTGAGAAATTTAAGTCCA 660

16 AAATAAGTCACTCCATTTCTCAGCA CACATGGATGCAAATTACACAGG 682

CSN3 2 GTGGCATTTTCCACTTTCTTTCC TCCTAGGAACTAAAAGCATATCCAGA 664

3 TGAATTTTTCTGCCTAGGTGGTG TGACTGGTTGCTAAAGTGATGTTTTT 685

4 GTTGCTGGGTTCACTACTTCCAA TGTCTTTGTGTGTGTGTAGCATTGA 943 1 The annealing temperature was 62°C for all primer pairs

118

Supplemental Table 4. Primer sequences for the resequencing of equine LALBA1

Gene Exon Primer forward (5`-3`) Primer reverse (3`-5`) Product

size

LALBA 2 CTGATTGCCTCGTTCATGTTACC AGGGTCAAATAATGGCAGAAAGG 685

3 TATAAAGGCGTCACTTTGCCTGA GGGCTTCTCCAGAGGAATTATCA 813

4 TGATCAACAAATCCGCAGAGAGT TTCAAGTCCAAGTGAAGGGAGGT 654

5 CCCTATGGCCCATTTATCCATTA ATAACCTATGGCGTCAGTGTCCA 604

1 The annealing temperature was 62°C for all primer pairs

Supplemental Table 5: Animals used in the sequencing of equine LALBA

Breed n

CB Crossbreed for Dairy Production 21

CR Criollo Horse 25

FJ Fjord Horse 3

HF Haflinger 37

IC Icelandic Horse 23

QH Quarter Horse 19

RU Russian Heavy Draft 24

WBD German Warmblood 31

119

SUPPLEMENTAL FIGURES

Supplemental Figure 1. Closure of a gap in the genomic data of CSN1S1.

Unknown region on chromosome 3, region 64657164 – 64957836, locus of CSN1S1, GenBank accession number

NC_009146.2

Figure: Open bars represent introns, black bars represent known regions, red bars represent the unknown region, the

box represents exon 16, Sequence: italic letters represent known regions, bold letters the unknown region, capital

italic letters exon 16, numbers given on the top and on the left are only for orientation and do not correspond to the

positions on the chromosome

120

121

DANKSAGUNG

An dieser Stelle bedanke ich mich bei allen Personen, die mich während meiner Promotionszeit

begleitet haben und zum Gelingen dieser Arbeit beigetragen haben.

Meinem Doktorvater Herrn Prof. Dr. Thaller danke ich sehr für die Überlassung des Themas, die

wissenschaftliche Betreuung und die Chance, meine Ergebnisse auf Tagungen zu präsentieren.

Mein besonderer Dank gilt Herrn Dr. habil. Jens Tetens für die überaus kompetente, dabei stets

freundliche und gut gelaunte Betreuung bei der Durchführung meiner wissenschaftlichen Arbeit.

Für die finanzielle Unterstützung im Rahmen des Kompetenznetzwerkes Food Chain Plus (FoCus)

danke ich dem Bundesministerium für Bildung und Forschung.

Herzlich danke ich auch Gabriele Ottzen-Schirakow, die mir im Labor immer mit Rat und Tat zur

Seite stand und stets eine Lösung für jedes Problem parat hatte. Außerdem danke ich allen jetzigen

und ehemaligen Bewohnern des Labortraktes für das schöne Arbeitsklima und die netten

Gespräche.

Allen beteiligten Stutenmilchproduzenten sei mein herzlicher Dank ausgesprochen dafür, dass ich

die Milchstuten beproben durfte, aber auch dafür, dass ich einen Einblick in die Betriebsabläufe

bekommen konnte und viele Informationen zur Stutenmilchproduktion in Deutschland erhalten

habe. Besonders danken möchte ich Familie Seraphin für immerwährende Hilfsbereitschaft und

die Bereitstellung von Milchproben.

Vielen Dank an alle Mitarbeiter des Instituts für Tierzucht für eine schöne Zeit zusammen.

Besonders danken möchte ich Kristina, Imke, Nina, Lukas, Jule und Marvin für nette

Mittagessenrunden, Bastelaktionen, den gemeinsamen Einsatz beim Hoffest, das ein oder andere

Eis mit Erdbeeren und die vielen netten Gespräche zwischendurch.

122

Ein großes Dankeschön gilt Dr. Julia Tetens. Es war eine wundervolle Zeit in unserem Büro, auf

gemeinsamen Deutschlandtrip und bei all unseren Klönschnacks. Aus einer Kollegin ist eine

wunderbare Freundin geworden und viele Zusammenkünfte, Ausritte und „Mutti-Runden“ sollen

noch folgen!

Ein ganz besonderer Dank gilt meiner Mutter und meinem Bruder. Vielen Dank dafür, dass ihr

stets hinter mir steht und mir immer mit Rat und Tat zur Seite seid.

Der allergrößte Dank geht an meinen Mann und meine Tochter. Ohne Euch wäre diese Arbeit nicht

möglich gewesen!

123

LEBENSLAUF

ALLGEMEINE INFORMATIONEN

Name Julia Elena Margot Elisabeth Brinkmann

Geboren 17. Dezember 1983 in Kiel

Staatsangehörigkeit Deutsch

AUSBILDUNG

2009-2011 Studium der Agrarwissenschaften an der

Christian-Albrechts-Universität zu Kiel;

Abschluss Master of Science

2007-2009 Studium der Agrarwissenschaften an der

Christian-Albrechts-Universität zu Kiel;

Abschluss Bachelor of Science

2003-2007 Ausbildung zur Pferdewirtin, Schwerpunkt

Reitausbildung

2003 Abitur Christian-Dietrich Grabbe Gymnasium

Detmold

BERUFLICHE TÄTIGKEIT

2012-2015 Wissenschaftliche Mitarbeiterin am Institut für

Tierzucht der Christian-Albrechts-Universität

zu Kiel