Top Banner
DNA Profiling (DNA fingerprinting) http://www.pbs.org/wgbh/nova/she ppard/cleared.html
14
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: DNA Profiling (DNA fingerprinting)  pard/cleared.html.

DNA Profiling(DNA fingerprinting)

http://www.pbs.org/wgbh/nova/sheppard/cleared.html

Page 2: DNA Profiling (DNA fingerprinting)  pard/cleared.html.

What is DNA Profiling? A technique used by scientists to distinguishbetween individuals of the same species usingonly samples of their DNA. Invented in 1985.

Page 3: DNA Profiling (DNA fingerprinting)  pard/cleared.html.

Stages of DNA Profiling

• Stage 1: Cells are broken down to release DNA (DNA extraction)

If only a small amount of DNA is available it can beamplified using thepolymerase chain reaction(PCR)

Page 4: DNA Profiling (DNA fingerprinting)  pard/cleared.html.

Stages of DNA Profiling • Step 2: The DNA is cut into fragments using different restrictionenzymes.

Each restriction enzyme cuts DNA at a specific base sequence.

The sections of DNA that are cut out are called restriction fragments.

Page 5: DNA Profiling (DNA fingerprinting)  pard/cleared.html.

Stages of DNA Profiling

This yields many restriction fragments of all differentsizes because the base sequences being cut may be farapart (long fragment) or close together (short

fragment).

Restriction enzymes can cut at coding regions(genes which code for proteins) or non-coding regions

About 99.5% of our DNA is the same –at the coding regions (if different= mutation). We differ in our non-coding regions.

Page 6: DNA Profiling (DNA fingerprinting)  pard/cleared.html.

VNTRsIn non-coding regions, variations in variablenumber tandem repeats (VNTRs) may exist.This will produce different # of fragments whenDNA is cut with restrictions enzymes.

Page 7: DNA Profiling (DNA fingerprinting)  pard/cleared.html.
Page 8: DNA Profiling (DNA fingerprinting)  pard/cleared.html.

Imagine DNA cut with restriction enzyme that recognized CC↓GG

Person #1AATATACCGGATATTTTATATTTTATATTTTCCGGTT

Person #2AATATACCGGATATTTTATATTTTCCGGTTACCGGTT

Fragments generated by Person #1 Fragments generated by Person #2

8 bp, 25 bp, 4 bp 8 bp, 18 bp, 7 bp, 4 bp

Page 9: DNA Profiling (DNA fingerprinting)  pard/cleared.html.

Stages of DNA Profiling

Stage 3:• Fragments are

separated on the basis of size using a process called gel electrophoresis.

• DNA fragments are injected into wells and an electric current is applied along the porous gel.

Page 10: DNA Profiling (DNA fingerprinting)  pard/cleared.html.

Stages of DNA ProfilingDNA is negatively charged so it is attractedto the positive end ofthe gel.The shorter DNAfragments move fasterthan the longerfragments. DNA is separated onbasis of size.

Page 11: DNA Profiling (DNA fingerprinting)  pard/cleared.html.

Stages of DNA ProfilingStage 4:The gel is stained with

ethidium bromide which combines with the DNA fragments to produce a fluorescent image.

Stage 5:The stained gel is exposed

to UV light, photographed and the distribution of fragments is analysed.

Page 12: DNA Profiling (DNA fingerprinting)  pard/cleared.html.

In this example, a family consists of a mom and dad, two daughters and two sons. The parents have one daughter and one son together, one daughter is from the mother’s previous marriage, and one son is adopted, sharing no genetic material with either parent. After amplifying the VNTR DNA from each member of the family, it is cut with a restriction enzyme and run on an agarose gel. Here are the results:

Page 13: DNA Profiling (DNA fingerprinting)  pard/cleared.html.

Uses of DNA ProfilingDNA profiling is used to

solve crimes, test paternity, identification (immigration, unknown bacteria, virus)

In crime applications, the chances of two people having exactly the same DNA profile is 30,000 million to 1 (except for identical twins).

Page 14: DNA Profiling (DNA fingerprinting)  pard/cleared.html.

Who should the police arrest, suspect #1 or #2?

Caution: D

NA fingerprintin

g provides stro

ng evidence

that a su

spect

was at th

e crim

e scene. I

t does n

ot

prove th

e susp

ect co

mmitted th

e crim

e.