Basmati Rice Collaborative Trial Dr Hez Hird Fera, YO41 1LZrandd.defra.gov.uk/Document.aspx?Document=11347... · Basmati rice is defined by a UK code of practice [1] which has been

Basmati Rice Collaborative Trial

Dr Hez Hird Fera,

Sand Hutton, York,

YO41 1LZ

14th

January 2013

2

Executive Summary

Basmati rice is grown exclusively in the Himalayan foothill regions of India and Pakistan, specifically the northern part of West Punjab, Haryana State and Western Uttar Pradesh. It‟s unique cooking qualities means that it can command a premium price on the world market. Its genetic make-up also makes it difficult to grow elsewhere to the same quality. The sale of Basmati rice is, therefore, open to fraudulent substitution with rice of a lesser quality.

Basmati rice is defined by a UK code of practice [1] which has been agreed between the rice industry and retailers and the enforcement authorities. It lists the varieties of rice which can be labelled as Basmati in the UK and defines the acceptable level of adventitious contamination with non-Basmati rice at 7%.

The current gold standard methodology for authentication and quantification is based on microsatellite analysis. There are two methods available which both use capillary electrophoresis, with either a multi-capillary array, as in the 3130xl where the PCR products are labeled with fluorescent dyes to aid analysis, or by using the lab-on-a-chip format of the Agilent BioAnalyser. These methods have now been in use for a number of years and are used for both commercial samples and surveillance exercises.

Collaborative trials are a way of formally assessing the reliability of a method. The data they provide outline the performance characteristics of the method and give an indication of the variability around a quantitative value.

The aim of this project was to conduct a collaborative trial of microsatellite based methods for quantifying non-Basmati rice in a Basmati rice sample to assess their performance.

The collaborative trial was successfully completed and 10 participants returned a full set of results for either the methodology using the BioAnalyser or the 3130 or equivalent. The results suggest that, in future, the BioAnalyser methodology could be used as a screening tool, to identify samples which could contain greater than the permitted amount of non-basmati rice in basmati rice, which could then be accurately quantified using the methodology on the 3130 or equivalent apparatus.

3

Contents

1.0 Introduction 3 2.0 Materials and methods 4 2.1 Preparation of the samples for the collaborative trial. 4 2.2 Production of the collaborative trial protocols. 4 2.3 Sourcing calibrant samples 5 2.4 Distribution of the samples and protocol, together with

calibrants 5

3.0 Results and discussion 5 4.0 Conclusions 6 5.0 Acknowledgements 6 6.0 References 6 Appendices 7 Appendix 1 Collaborative trial protocol for the quantitative analysis of

super basmati rice with sherbati, using the Agilent 2100 Bionanalyser and RM201

7

Appendix 2 Collaborative trial protocol for the quantitative analysis of super basmati rice with sherbati, using a capllary sequencer and RM201

19

1.0 Introduction

Basmati rice is grown exclusively in the Himalayan foothill regions of India and Pakistan, specifically the northern part of West Punjab, Haryana State and Western Uttar Pradesh. It‟s unique cooking qualities means that it can command a premium price on the world market. Its genetic make-up also makes it difficult to grow elsewhere to the same quality. The sale of Basmati rice is, therefore, open to fraudulent substitution with rice of a lesser quality. Basmati rice is defined by a UK code of practice [1] which has been agreed between the rice industry and retailers and the enforcement authorities. It lists the varieties of rice which can be labelled as Basmati in the UK and defines the acceptable level of adventitious contamination with non-Basmati rice at 7%. However, rice varieties are closely related, posing a particular problem for varietal identification and quantification of adulterants. The current gold standard methodology for authentication and quantification is based on microsatellite analysis. Microsatellites are areas of short sequence repeats of DNA, with 1000s identified in the rice genome. Individual microsatellites vary in size between different rice varieties giving a fingerprint for each variety of rice. This methodology uses capillary electrophoresis, with either a multi-capillary array, as in the 3130xl where the PCR products are labeled with fluorescent dyes to aid analysis, or by using the lab-on-a-chip format of the Agilent BioAnalyser. These methods have now been in use for a number of years and are used for both commercial samples and surveillance exercises.

4

Collaborative trials are a way of formally assessing the reliability of a method. The data they provide outline the performance characteristics of the method and give an indication of the variability around a quantitative value. They are seen important for any quantitative analytical method and obligatory before a methodology can be adopted as a CEN or ISO standard.

The methods trialled during this study were both developed by the Food Standards Agency, commissioned under the Agency‟s Food Authenticity Programme, to be used to check retail samples of Basmati rice in the UK market.

The methodology used during this trial relied on the amplification of a microsatellite marker, which would result in amplicons of different sizes for Basmati and non-Basmati rice in a mixture. The amplicons were then to be separated by capillary electrophoresis, using either the Applied Biosystems 3130xl (or equivalent) or the Agilent BioAnalyser. This slightly unusual experimental design was necessary to ensure enough participants in the trial to allow robust statistical analysis, since there were not enough laboratories with either type of capillary electrophoresis apparatus alone.

Nevertheless, the collaborative trial protocols were prepared for each type of capillary apparatus separately. For the trial the participants were sent the samples, anonymised in blind duplicates, standard rice varieties to construct a calibration curve, and where needed some of the reagents to perform the DNA extraction and PCR.

The results were returned by the participants in a timely manner and were subsequently scrutinised for accuracy and compared to each other. This report outlines the work to prepare for the trial and the results thus generated.

2.0 Materials and methods

2.1 Preparation of the samples for the collaborative trial.

The samples had previously been prepared under a different project and some had been used as proficiency test materials by the Proficiency Testing Group at Fera. The samples had been assessed for homogeneity using standard Fera conditions.

2.2 Production of the collaborative trial protocols.

The protocols were written so that they could be followed by laboratories already familiar with the methodology and they encompassed all the necessary steps, from DNA extraction to calculation of results. Of particular note was the design of the trial such that participants were asked to perform two DNA extractions from each sample or calibrant mixture and then to perform two PCR on those extracts resulting in 4 replicate PCR to be analysed by capillary electrophoresis. The protocols are included in Appendices 1 and 2.

5

2.3 Sourcing calibrant samples

Calibrants for this collaborative trial were kindly provided by Dr Nandini Sheshadri, of Tilda Riceland Ltd. It was imperative to source calibrants from a different batch of rice from that which had been used to prepare the samples and therefore, new batches of Super and Sharbati were obtained.

2.4 Distribution of the samples and protocol, together with calibrants

The components of the collaborative trial were shipped to participants in February 2012. All reported that the consignments were received in good order. The participants were asked to return their results by mid March 2012 for timely reporting and completion of the study. Subsequent queries and questions from the participants were dealt with via E-mail and all seemed content to perform the work.

3.0 Results and discussion

The collated results from the ring-trial are outlined in Table 1. The results clearly fall into 2 groups, divided by the amplicon separation and visualisation technology, the 3130 or equivalent as compared to the Agilent BioAnalyser. Whilst the results returned for the 0% sample are either at or very close to 0% (range 0-0.3% non-Basmati) for the participants using the 3130, the participants who used the BioAnalyser reported significant amounts of non-basmati in these samples (range 2.6-9.2% non-Basmati). This was an unexpected since all the samples were identical and therefore a true non-Basmati peak would have been amplified in both the sets of data. On further analysis of the returned data sets, it can be seen that the

Table 1. Individual participant results for each sample recorded as percentage non-Basmati.

True results % non-Basmati

Individual participant results – BioAnalyser, % non-Basmati

Individual participant results – 3130 or equivalent, % non-Basmati

1 2 3 4 5 6 7 8 9 10

0 9.2 6.5 7.6 2.6 4.9 0 0.3 0 0.2 0

0 8.9 6.4 7.8 3.5 4.4 0 0.3 0 0.1 0

7 10.7 8.0 8.3 4.4 5.1 4.8 2.6 7.2 7.1 5.6

7 11.4 7.3 8.6 3.7 6.5 5.6 4.2 6.2 7.1 5.1

10 13.5 9.0 9.2 5.3 6.9 11.8 6.1 6.9 10.7 5.0

10 12.5 8.7 9.2 3.9 7.5 7.3 6.8 7.2 10.6 6.0

15 15.3 10.1 10.7 7.0 5.0 11.8 7.8 10.1 13.1 12.8

15 11.9 10.3 11.0 9.2 10.7 15.1 8.7 11.1 13.6 24.7

20 15.1 13.3 12.9 10.6 12.9 17.7 13.6 14.0 18.3 21.8

20 15.4 12.3 12.9 8.7 12.3 17.0 12.8 13.0 18.3 15.9

6

BioAnalyser data has a relatively short range and that whilst the actual samples ranged from 0 to 20%, the results returned by the participants had much shorter ranges, although in general as the true percentage increased, so did the calculated percentage. However, the calibration curves were relatively flat and it appears that the method looses sensitivity at low percentages of non-Basmati as used in this study. On further analysis of the calibration curve (Figure 1.) it can be seen that the calibration curve is infact bi-phasic and contains two different trends. The data for the lowest calibrants form a relatively straight line, whilst the data for the remaining three calibrants form a line, but with a different equation. All data returned by the participants showed this trend. Additionally, this trend is also evident in historical data whenever the Bioanalyser has been used for this type of analysis. It is not therefore appropriate to draw a calibration curve which encompasses all calibrants, as in Figure 1. However, analysis of the data, using two separate calibration curves returned results much closer to the true gravimetric values of the samples when compared with the results obtained when the full calibration curve was used. This method therefore can be used to give an indication of the level of adulteration in the sample.

Figure 1. An exemplar of a calibration curve constructed from data derived from the Agilent Bioanalyser

Standards

% Non-basmati

Basmati Peak

Area

Non-Basmati

Peak Area

Response Ratio

(RR) Standard Ratio (SR)

0 41.2 4.0 0.097 0.000

0 44.1 4.6 0.104 0.000

5 39.8 6.4 0.161 0.053

5 35.8 5.5 0.154 0.053

10 39.7 8.4 0.212 0.111

10 43.5 7.4 0.170 0.111

15 39.8 10.0 0.251 0.176

15 37.2 8.7 0.234 0.176

20 16.0 3.7 0.231 0.250

20 5.4 1.8 0.333 0.250

30 28.0 20.8 0.743 0.429

30 20.7 23.5 1.135 0.429

40 14.2 15.8 1.113 0.667

40 15.0 22.1 1.473 0.667

50 11.3 21.7 1.920 1.000

50 14.6 27.0 1.849 1.000

Samples Intercept 0.0001

Gradient 1.8953

Sample No.

Basmati Peak

Area

Non-Basmati

Peak Area Response Ratio

Calculated Standard

Ratio

Calculated % Non-

Basmati

Mean % Non-

Basmati SD SE Mean-2*SE %CV

2861 46.9 5.7 0.122 0.064 6.02

2861 46.5 6.1 0.131 0.069 6.47

2861 37.9 8.9 0.235 0.124 11.02 7.84 2.766 1.60 4.64 35.29

3021 21.7 14.8 0.682 0.360 26.46

3021 23.5 14.8 0.630 0.332 24.94

3021 23.1 15.7 0.680 0.359 26.39 25.93 0.860 0.50 24.94 3.31

3028 48.2 4.6 0.095 0.050 4.79

3028 38.6 4.3 0.111 0.059 5.55

3028 48.6 5.5 0.113 0.060 5.63 5.32 0.463 0.27 4.79 8.70

3101 26.0 10.7 0.412 0.217 17.84

3101 23.8 10.8 0.454 0.239 19.31

3101 29.0 12.2 0.421 0.222 18.16 18.44 0.777 0.45 17.54 4.21

y = 1.8953x + 0.0001R² = 0.952

0.0

0.5

1.0

1.5

2.0

2.5

0.0 0.2 0.4 0.6 0.8 1.0 1.2

Rep

on

se R

ati

o (

RR

)

Standard Ratio (SR)

In contrast, the results returned by the participants who used the 3130 or equivalent are much closer to the true values of the samples. From the results presented in Table 1, it would appear, therefore, that using the BioAnalyser to quantify the amount of non-Basmati in a sample which contained very low levels of non-Basmati, at least using RM201, would give results which would, on the whole, suggest a level of non-Basmati which was greater than that actually present, when the whole calibration set was used as in the data in Table 1. In contrast, the 3130 or equivalent data either indicated that there was no, or negligible non-basmati in the 0% sample and was close to the true value for the majority of the samples, particularly when measurement uncertainty is taken into consideration. This was also found in the ring-trial of the methodology using the 3130 or equivalent, organised by the Food Standards Agency in 2006 [2]. That study found that the mean values for the results

7

for each of the test materials was within 1% of the true value (7.8, 17.8 & 34.3 for the 8, 18 and 35% samples respectively) however, that ring-trial used the same bulk rice for both the samples and calibrants and therefore, these results were fully expected. From the results of this ring-trial it should be recommended that a 3130 or equivalent should be used for quantification of non-basmati rice in Basmati rice and that the use of the BioAnalyser could be used as a screening tool which could identify samples where gross substitution had taken place rather then simple contamination with non-Basmati rice.

4.0 Conclusions

The work to conduct the collaborative trial was successfully completed and 10 participants returned a full set of results for either the methodology using the BioAnalyser or the 3130 or equivalent. The results suggest that, the Bioalyser methodology could be used as a screening tool which could be used to identify samples which would subsequently be further analysed on a 3130 or equivalent apparatus.

5.0 Acknowledgements

This study was funded by the Evidence and Knowledge Base Science Team, Defra

of the United Kingdom. The authors wish to thank Dr Nandini Sheshadri, of Tilda

Riceland, for supplying samples of rice, without which this project could not have

been conducted.

6.0 References

1. Code of Practice on Basmati Rice – Rice Association, British Retail Consortium,

British Rice Millers Association. July 2005.

2. Report on the ring trial of the quantitative determination of non-basmati rice

varieties in a mixture with Basmati rice varieties. Food Standards Agency report,

Woolfe, M. 2006.

Appendix 1

COLLABORATIVE TRIAL PROTOCOL FOR THE QUANTITATIVE ANALYSIS OF SUPER BASMATI RICE WITH SHERBATI, USING THE AGILENT 2100

BIONANALYSER AND RM201 Prepared by Hez Hird, Date 25th January 2012

1. SCOPE This document specifies a method for the quantification of non-permitted varieties of rice (including sherbati, mugad sugandha, pak 386 or superfine) in rice grain samples using RM201, a microsatellite PCR marker. The limit of quantification of the method has been demonstrated to be 5%. The test can not be used to quantify the following non-permitted varieties: Yamini, Pusa 1121, Basmati 2000, Shaheen Basmati, Pusa Sugandha and Supra. 2. NORMATIVE REFERENCES This document incorporates by dated or undated reference and provisions from other publications. These normative references are cited at the appropriate places in the text and the publications are listed hereafter. For dated references, subsequent amendments to or revisions of any of these publications apply to this document only when incorporated in it by amendment or revision. For undated references the latest edition of the publication referred to applies.

3. PRINCIPLE OF THE METHOD

PCR primers amplify DNA fragments of different lengths due to differences in the number of repeats in a simple sequence repeat (SSR) sequence. These fragments are detected using the Agilent 2100 Bioanalyser and the relative concentration for each fragment is given as the area under the peak. Where non-permitted varieties are present, the relative proportion of the adulterant is estimated by comparing the ratio of areas under the peaks for the fragments corresponding to the permitted and non-permitted variety.

WARNING Protective clothing, safety glasses and gloves to be worn at all times. Extreme care should be taken when preparing the PCR mix to avoid contamination: the master mix should be prepared in a designated area, preferably a flowcabinet, gloves should be changed frequently, barrier tips should be used for all pipetting steps and only small aliquots of reagents should be used where ever possible. Any contamination of the work area with sample should be treated with decontamination solution before progressing any further with the sample. Chloroform should always be used in a fume cupboard. Chloroform and isopropanol should be disposed of according to applicable environmental rules and regulations. 4. Reagents Unless otherwise specified, use only reagents of molecular biology grade

4.1. Water 4.2. TE buffer

Appendix 1

9

Stock solution of 1 M TE buffer prepared by mixing 200 mM TRIS-HCl (pH 8) and 20 mM EDTA. 1x TE buffer prepared by diluting 1M TE buffer 1:9 with molecular biology grade water. 4.3. Chloroform An aliquot of 100 ml should be stored at -20 °C for use during the procedure. 4.4. Propan-2-ol (Isopropyl alcohol) An aliquot of 100 ml should be stored at -20 °C for use during the procedure. 4.5. Ethanol 4.5.1 70% (v/v) Ethanol Add 30 ml de-ionised water to 70 ml absolute ethanol. 4.6. RM201 oligonucleotide primers RM201 Forward: CTCGTTTATTACCTACAGTACC RM201 Reverse: CTACCTCCTTTCTAGACCGATA 4.7. Rice flour calibrants Milled rice standards will be supplied as pure samples. Calibrants should be prepared by gravimetrically mixing super and sharbati at 0, 5, 10, 25, 35 and 45% of sharbati in Super Basmati and then extract DNA from these mixtures using the methodology outlined below. 4.8. Nucleon Genomic DNA Extraction Kit Phytopure (SL 8511 Tepnel

BioSystems, Manchester, UK).

4.9. AmpliTaq Gold and PCR Master Mix (N8080-244, Applied Biosystems).

4.10. dNTP (10mM of each)

4.11. Agilent DNA series II LabChip kit (5067-1504).

5. Apparatus Normal laboratory glassware and apparatus should be used and in particular, the following: 5.1. Plasticware Detalis of plasticware are given in Table 1. All plasticware should be DNAse free and

sterilised before use.

Table 1. Plasticware Specifications

Item Detail Example supplier

Product code

1 1.5 and 2 ml microcentrifuge tubes

Flat cap style Starlab S1605-0000

2 200 μl PCR tubes Single, strip or 96-well

Starlab B1402

3 Pipette tips with filters

10, 20 and 200 μl Starlab S1111

4 15 ml tubes For centrifugation Starlab E1415-0200

6.1. Equipment Detalis of equipment are given in Table 2.

Appendix 1

10

Table 2. Equipment Specifications

Item Detail E.g. supplier Product code

1 Precision pipettes delivery of 1-200 μl Starlab G8900

2 PCR thermocycler to hold 200 μl tubes MJ Research PTC-200

3 Benchtop vortex Labnet VX-100

4 Micro centrifuge to hold 1.5 μl tubes Eppendorf 5452-0000

5 Thermal mixer OR

Incubator/water bath

to hold 1.5 μl tubes

up to 70°C

6 CE genetic analyser 2100 Bioanlyser Agilent

7 Laminar flow hood PCR II Workstation Gelman

7. PROCEDURES It is ESSENTIAL to wear disposable gloves during all procedures and to use pipette

tips that are sterile and fitted with filters.

7.1. Sample Preparation Rice samples must be completely mixed before sub-samples of 1 g are taken for

DNA extraction.

7.2. Quality Assurance The test‟s reliability relies on replication. TWO replicate DNA extractions must be

made for each unknown test sample, and TWO PCRs must be carried out for each

extract. In total, four reactions must be carried out for each unknown test sample

and 14 additional PCR reactions carried out for controls and calibrants (composed of

two negative (blank) control reactions included in each set of reactions: a water

control and a blank extraction control and two sets of six quantitative standards (0, 5,

10, 25, 35 and 45%) of adulterant in approved Basmati variety) must be included in

each run. As well as acting as controls these standards are necessary for preparing

a calibration curve from which quantification estimations are made.

7.3. DNA Extraction Procedure The samples and standards will be provided as ground powder. Use the Nucleon

Phytopure DNA extraction method. Extract the standards and samples separately.

Include one extraction negative (no rice sample) with each batch of extractions

performed.

7.3.1. Nucleon Phytopure method for DNA extraction

1. For each sample weigh out 1 g ( 0.05 g) of ground rice into a sterile 15 ml centrifuge tube and label the tube.

2. Add 4.0 ml of Reagent 1 from the Nucleon Phytopure Plant DNA Extraction kit to each tube.

Appendix 1

11

3. Add 1.4 ml of Reagent 2 from the Nucleon Phytopure Plant DNA Extraction kit to each tube.

4. Replace caps and invert tubes to mix. Then vortex tubes thoroughly for 15 seconds.

5. Incubate the tubes at 65 °C in a controlled-temperature water-bath or heat block for 10 minutes, gently shaking the tubes every two minutes.

6. Cool all tubes on ice for 20 minutes. 7. A clear liquid will form as the top layer. Transfer 1.8 ml of this liquid into a clean

2 ml tube and centrifuge this tube at 13,000 g for 15 minutes. 8. Transfer 0.5 ml of the supernatant fluid to a fresh 1.5 ml microcentrifuge tube

and place on ice for 20 minutes. 9. Add 0.5 ml of chloroform (-20°C) to each tube. 10. Add 0.1 ml of resuspended Nucleon Phytopure DNA extraction resin. The resin

should be fully resuspended immediately prior to use and regularly agitated during pipetting.

11. Vortex each tube for 15 seconds. 12. Place each tube on a rotating platform shaker for 10 minutes at room

temperature. 13. Centrifuge at 16,000 g for 15 minutes. 14. Transfer 0.5 ml of the upper phase (containing DNA) to a fresh 1.5 ml

microcentrifuge tube, taking care not to disturb the resin (brown) layer. 15. Add 0.5 ml of cold (-20°C) propan-2-ol and gently invert tube 10 times to mix. 16. Centrifuge at 16,000 g for 15 minutes to pellet the DNA. 17. Decant or aspirate the supernatant fluid and discard, add 0.5 ml 70 % (v/v)

ethanol. 18. Centrifuge at 16,000 g for 5 minutes at room temperature to pellet the DNA. 19. Decant or aspirate the supernatant and air dry the pellet for 10 minutes. 20. Resuspend the DNA in 0.5 ml 1xTE buffer, allow to rehydrate for 1 hour and then

vortex gently to dissolve the pellet. 21. Store the DNA at 4 °C (for up to 1 month) or at -20 °C (for more than one

month).

7.4. Preparation of oligonucleotide primers

Reconstitute lyophilised forward and reverse primers using the following formula to

calculate the amount of water to be added to prepare stock solutions at 20 M:

g x 50 = vol (mL) of

water

Mw

g = the weight of primer in the tube (provided by the supplier)

MW = the molecular weight of the primer (provided by the supplier)

Appendix 1

12

Centrifuge the tubes prior to opening to prevent loss of pelleted oligonucleotide. Add

the appropriate volume of deionised water to each primer and allow to rehydrate at

37oC for 30 min in the heating block. Mix by inversion and centrifuge on pulse for 20

sec. Aliquot into 0.5 mL microcentrifuge tubes, label each microcentrifuge tube with a

permanent marker and store at -20oC until required. Once thawed do not refreeze

aliquots.

7.5. PCR Amplification

1. Turn on the laminar flow hood fifteen minutes before you start to set up the PCR

reactions.

2. Remove primer stocks from the freezer and allow them to completely thaw to

room temperature (20 -25 °C). Once thawed, vortex each tube for 20 seconds

and recover solution from inside the lid by centrifugation.

3. Prepare the bulk PCR mix. Work out the total number of DNA extracts (including

blanks and quantitative standards) you need to run. Multiply this by two to give

the total number of PCR reactions to carry out. Add approx 10% extra to this

value and then use this number to multiply each component in the table below, to

give the total volume required in the bulk PCR mix. For example, if you are

testing 12 unknown samples (ie 24 duplicate DNA extractions) you will need to set

up 64 reactions (16 controls + (2 x 24 test samples), therefore multiply the

volumes by 70. This will give a small excess of bulk PCR mix left to allow for

pipetting error (see Table 1).

Table 1 Volumes for preparation of bulk PCR mix. Multiply column 1 with

the total number required to give the total volume to pipette for

bulk mix.

COMPONENT Volume for one reaction (µl)

Example volume for 64 reactions (µl) (multiply by 70)

Forward primer (20 M) 0.2 14

Reverse primer (20 M) 0.2 14

10x PCR buffer 1.2 84 Amplitaq Gold 0.1 7

dNTP 0.24 16.8

Water 9.06 634.2

TOTAL 11 770

Appendix 1

13

Label a sterile 1.5 ml tube “Bulk Mix” and add the components to the tube. Vortex

each tube for 20 seconds and recover solution from inside the lid by centrifuging

at 16,000 g for 20 seconds. Make up the bulk PCR mix immediately before

setting up PCR reactions because primer-dimers can form if mixed for long

periods of time.

4. Label the PCR tubes, one for each reaction. You must include reactions for all six

standard mixtures (0, 5, 10, 25, 35, and 45% of adulterant, e.g. Sherbati, in Super)

as well as two blank control samples.

5. Pipette 11 µl of the bulk PCR mix into each reaction tube.

6. Pipette 1 µl of sample DNA into each tube, making sure the correct samples are

added to the correspondingly labelled tubes. This gives a total PCR volume of 12

µl in each tube.

7. Place the PCR tubes in the PCR machine/thermocycler. Set the PCR programme

as shown in table 2 and leave until all cycles have finished (approx. 3 hours).

Table 2 PCR amplification conditions

Step Temperature/time Cycles

1 94°C for 15 minutes 1

2 94°C for 1 min 40

55°C for 1 min

72°C for 1 min

3 72°C for 5 mins 1

8. Following the PCR, remove the tubes from the thermocycler and store at 4 °C for

a maximum of one week.

7.6. Quantitative analysis on the Agilent 2100 Bioanalyser software.

The Agilent 2100 Bioanalyser is a capillary electrophoretic system used to separate

DNA fragments, estimate their size and quantify their concentration. For this

collaborative trial, Agilent DNA series II LabChip should be used.

1. Remove tubes containing prepared gel matrix, DNA size ladder (yellow cap) and

upper and lower size markers (green cap) from the fridge and leave to warm to

20°C for 1 hour.

2. Load PCR products into an Agilent DNA series II LabChip following the Agilent

2100 Bioanalyser Instructions. A maximum of twelve reactions can be run on

one chip in the Bioanalyser. You will always need two or more chips to include

all controls and 4 replicates of each test sample. It is recommended that at least

one control is run on every chip used for test samples (the 5 or 45% standard

are good choices).

Appendix 1

14

3. Place the chip inside the Bioanalyser and start the run according to the

Bioanalyser instructions. It will take approximately 25 minutes to complete the

fragment separation.

4. View the results. If the negative controls show recognisable bands (fragments),

either the extraction or the PCR should be repeated using fresh reagents. As an

added precaution against carry-over between samples, decontaminate pipettes

by removing the barrel and soaking it in bleach or Decon solution for 12 hours,

then clean and dry before re-assembling.

8. CALCULATIONS AND DATA ANALYSIS 8.1. Quantitative Analysis Example

1. Export data from Agilent 2100 Bioanalyser analysis software to MS Excel

Open the file containing the samples you have run and view samples using the “Gel Tab”.

Figure 1 Screen shot showing how height threshold reduced to 2.

To show the set point explorer, on the Gel tab, click the vertical bar on the right edge of the application window. When the set point explorer appears choose the Global tab. Then reduce the Height Threshold (FU) value from the default setting 20 to 2. You do not need to save anything.

Before shutting the window, click on “File” from the top menu and choose “Export”. Select the result file and save it with the extension *.csv.

Gel tabGel tab

Click on this

bar to get set

point explorer

Global tab

Gel tabGel tabGel tab

Click on this

bar to get set

point explorer

Global tab

Appendix 1

15

Open Microsoft Excel and select the *.csv result file. The results for each sample will be shown as in a table (Figure 2).

Sample Name 3021_RM201

Peak Table

Size [bp] Conc. [ng/µl]Molarity [nmol/l]Observations Area Aligned Migration Time [s]Peak HeightPeak Width% of Total Time corrected area

15 4.2 424.2 Lower Marker 31.9 43 47.5 3 0 90.8

24 1.33 84.8 6.4 45.15 8.6 1.8 11 17.4

155 2.55 25 21.7 61.72 35.9 2.1 37 43.1

169 1.67 14.9 14.8 63.44 18.5 1.6 25.2 28.6

181 0.19 1.6 1.8 64.86 3.1 0.8 3 3.4

192 0.3 2.3 2.8 66.15 3 1.5 4.8 5.2

208 0.12 0.9 1.2 67.93 2.2 0.8 2.1 2.2

220 0.38 2.6 3.8 69.35 5.4 1.3 6.5 6.8

240 0.58 3.6 6.1 71.75 5.8 2.2 10.4 10.4

1,500 2.1 2.1 Upper Marker 38.7 113 59.7 2 0 42.1

Overall Results:

Number of peaks found: 8

Figure 2 Example results for one sample as saved in the *.csv file exported

from the Agilent 2100 Bioanalyser software and opened in Excel. Yellow

highlight shows the area values that are required to calculate the ratio between

Basmati (155) and Non-Basmati (169) peaks.

Open the Excel workbook provided find the sheet which has the headings outlined below:

In a separate row for each sample tested, copy the two values given for “Area” and paste them into the „Basmati Peak Area‟ and „Non-Basmati Peak Area‟ columns. The size given for „Basmati Peak Area‟ will be in the range 151-156 bp. The size given for the „Non-Basmati Peak Area‟ will be in the range 166 to 170 bp. Use the first column to give the percentage non-basmati (for standards).

You should end up with a table containing 16 rows for standards (6 x 2 replicate PCRs) and 4 rows for each unknown test sample (2 extracts x 2 PCRs). There should be a value for „Basmati Peak Area‟ given for every sample, but not all samples will give a „Non-Basmati Peak Area‟ value.

8.2. Calculate the Ratio of Area for Non-Basmati Peaks to Basmati Peaks

In the same Excel spreadsheet, check that the formula in the fourth (empty) column is:

=C4/B4

%Non-

Basmati

Basmati Peak

Area

Non-Basmati Peak

Area

Appendix 1

16

This will calculate the „Response ratio‟ (RR) for each PCR product. This is the area of the non-Basmati peak divided by the area of the Basmati peak (see Excel file shown in Appendix 1).

For example, for Standard 5% (rep1) the calculation is: 6.4 / 39.8 = 0.161

8.3. Calculate the Ratio of Standards for Non-Basmati percentage to Basmati

percentage

In the same Excel spreadsheet, check that the formula in the fifth (empty) column is:

=A4/(100-A4)

This will calculate the „Standard ratio‟ (SR) for each PCR product. This is the percentage of non-Basmati in the standard divided by the percentage of Basmati in the standard (see Excel file shown in Appendix 1).

For example, for a Standard of 5% the calculation is: 5 / (100-5) = 0.053

8.4. Check that the calibration curve has been plotted correctly, please note:

Use only the results from the sets of standards to plot the standard curve (not the unknowns).

Using the chart (scatter plot) function in Excel, plot the „Standard ratio‟ (x-axis) against the „Response ratio‟ (y-axis).

To fit a regression line, right mouse click on one of the points and choose „add trendline‟. Select linear regression and under options tick display equation on chart and display R2.

The R2 value indicates the quality of the standard curve, if it is < 0.80 you must repeat the analysis.

8.5. Calculating the unknowns (see Excel file shown in Appendix 1)

The regression equation should be shown on the plot: RR = a*SR + b

where RR is the „Response ratio‟, SR is the „Standard ratio‟, a is the estimated

slope and b is the estimated intercept.

Using the Excel formulae calculate the estimate of the intercept (b): =INTERCEPT(cell range for RR, cell range for SR)

Using the Excel formulae calculate the estimate of the slope (a): =SLOPE(cell range for RR, cell range for SR)

Use the regression equation to calculate the „Standard ratio‟ (SR) for the unknown samples as follows:

SR = (RR - b) / a

Then calculate the % non-Basmati using the following equation: % non-Basmati = 100 * SR / (1+SR)

Use Excel formulae to calculate the mean for % non-Basmati of all successful replicates:

=AVERAGE(cell range)

Appendix 1

17

Use Excel formulae to calculate the standard deviation (SD) for % non-Basmati of all successful replicates:

=STDEV(cell range)

Use Excel formulae to calculate the standard error (SE) for % non-Basmati of all successful replicates:

=SD/SQRT(n)

where n is the number of successful replicates for which you have data.

If one of the replicates is missing you must adjust the calculations accordingly.

If more than three values are missing for the same sample you need to repeat

the test.

Use Excel formulae to calculate the percentage coefficient of variation (%CV) for all successful replicates:

=100*SD/Mean

10. Reporting results Please send the completed Excel workbook, with all data and calculations to Hez Hird via E-mail at [email protected]

Appendix 1

18

9. APPENDICES

APPENDIX 1. Example of Excel file

Standards

% Non-basmati

Basmati Peak

Area

Non-Basmati

Peak Area

Response Ratio

(RR) Standard Ratio (SR)

0 41.2 4.0 0.097 0.000

0 44.1 4.6 0.104 0.000

5 39.8 6.4 0.161 0.053

5 35.8 5.5 0.154 0.053

10 39.7 8.4 0.212 0.111

10 43.5 7.4 0.170 0.111

15 39.8 10.0 0.251 0.176

15 37.2 8.7 0.234 0.176

20 16.0 3.7 0.231 0.250

20 5.4 1.8 0.333 0.250

30 28.0 20.8 0.743 0.429

30 20.7 23.5 1.135 0.429

40 14.2 15.8 1.113 0.667

40 15.0 22.1 1.473 0.667

50 11.3 21.7 1.920 1.000

50 14.6 27.0 1.849 1.000

Samples Intercept 0.0001

Gradient 1.8953

Sample No.

Basmati Peak

Area

Non-Basmati

Peak Area Response Ratio

Calculated Standard

Ratio

Calculated % Non-

Basmati

Mean % Non-

Basmati SD SE Mean-2*SE %CV

2861 46.9 5.7 0.122 0.064 6.02

2861 46.5 6.1 0.131 0.069 6.47

2861 37.9 8.9 0.235 0.124 11.02 7.84 2.766 1.60 4.64 35.29

3021 21.7 14.8 0.682 0.360 26.46

3021 23.5 14.8 0.630 0.332 24.94

3021 23.1 15.7 0.680 0.359 26.39 25.93 0.860 0.50 24.94 3.31

3028 48.2 4.6 0.095 0.050 4.79

3028 38.6 4.3 0.111 0.059 5.55

3028 48.6 5.5 0.113 0.060 5.63 5.32 0.463 0.27 4.79 8.70

3101 26.0 10.7 0.412 0.217 17.84

3101 23.8 10.8 0.454 0.239 19.31

3101 29.0 12.2 0.421 0.222 18.16 18.44 0.777 0.45 17.54 4.21

y = 1.8953x + 0.0001

R2 = 0.952

0.0

0.5

1.0

1.5

2.0

2.5

0.0 0.2 0.4 0.6 0.8 1.0 1.2

Standard Ratio (SR)

Re

po

ns

e R

atio

(R

R)

Appendix 1

19

In the above example, an unknown sample with response ratio (RR) of 0.630 gives a

standard ratio (SR) of:

(0.630 - 0.0001) / 1.8953 = 0.332

And so the % Non-Basmati is given by:

100 * 0.332/ (1+0.332) = 25%

Appendix 2

20

COLLABORATIVE TRIAL PROTOCOL FOR THE QUANTITATIVE ANALYSIS OF SUPER BASMATI RICE WITH SHERBATI, USING A CAPLLARY SEQUENCER

AND RM201 Prepared by Hez Hird, Date 30th January 2012

1. SCOPE This document specifies a method for the quantification of non-permitted varieties of rice (including sherbati, mugad sugandha, pak 386 or superfine) in rice grain samples using RM201, a microsatellite PCR marker. The limit of quantification of the method has been demonstrated to be 5%. The test can not be used to quantify the following non-permitted varieties: Yamini, Pusa 1121, Basmati 2000, Shaheen Basmati, Pusa Sugandha and Supra. 2. NORMATIVE REFERENCES This document incorporates by dated or undated reference and provisions from other publications. These normative references are cited at the appropriate places in the text and the publications are listed hereafter. For dated references, subsequent amendments to or revisions of any of these publications apply to this document only when incorporated in it by amendment or revision. For undated references the latest edition of the publication referred to applies. 3. PRINCIPLE OF THE METHOD PCR primers amplify DNA fragments of different lengths due to differences in the number of repeats in a simple sequence repeat (SSR) sequence. These fragments are detected using a capillary sequencer and the relative concentration for each fragment is given as the area under the peak. Where non-permitted varieties are present, the relative proportion of the adulterant is estimated by comparing the ratio of areas under the peaks for the fragments corresponding to the permitted and non-permitted variety. WARNING Protective clothing, safety glasses and gloves to be worn at all times. Extreme care should be taken when preparing the PCR mix to avoid contamination: the master mix should be prepared in a designated area, preferably a flowcabinet, gloves should be changed frequently, barrier tips should be used for all pipetting steps and only small aliquots of reagents should be used where ever possible. Any contamination of the work area with sample should be treated with decontamination solution before progressing any further with the sample. Chloroform should always be used in a fume cupboard. Chloroform and isopropanol should be disposed of according to applicable environmental rules and regulations. 4. Reagents Unless otherwise specified, use only reagents of molecular biology grade

4.1. Water 4.2. TE buffer

Appendix 2

21

Stock solution of 1 M TE buffer prepared by mixing 200 mM TRIS-HCl (pH 8) and 20 mM EDTA. 1x TE buffer prepared by diluting 1M TE buffer 1:9 with molecular biology grade water.

4.3. Chloroform An aliquot of 100 ml should be stored at -20 °C for use during the procedure.

4.4. Propan-2-ol (Isopropyl alcohol) An aliquot of 100 ml should be stored at -20 °C for use during the procedure.

4.5. Ethanol 4.5.1 70% (v/v) Ethanol

Add 30 ml de-ionised water to 70 ml absolute ethanol. 4.6. RM201 oligonucleotide primers

RM201 Forward: CTCGTTTATTACCTACAGTACC, 5‟labelled with FAM RM201 Reverse: CTACCTCCTTTCTAGACCGATA

4.7. Rice flour calibrants

Milled rice standards will be supplied as pure samples. Calibrants should be prepared by gravimetrically mixing super and sharbati at 0, 5, 10, 25, 35 and 45% of sharbati in Super Basmati and then extract DNA from these mixtures using the methodology outlined below.

4.8. Nucleon Genomic DNA Extraction Kit Phytopure (SL 8511 Tepnel BioSystems, Manchester, UK).

4.9. AmpliTaq Gold and PCR Master Mix (N8080-244, Applied Biosystems).

4.10. dNTP (10mM of each)

4.11 Dye GeneScan-350 ROX Size Standard (Applied Biosystems p/n 401735)

4.12 Hi Di Formamide (Applied Biosystems p/n 4311320)

5. Apparatus Normal laboratory glassware and apparatus should be used and in particular, the following:

5.1. Plasticware Detalis of plasticware are given in Table 1. All plasticware should be DNAse free and sterilised before use.

Appendix 2

22

Table 1. Plasticware Specifications

Item Detail Example

supplier

Product code

1 1.5 and 2 ml

microcentrifuge

tubes

Flat cap style Starlab S1605-0000

2 200 μl PCR tubes Single, strip or 96-well Starlab B1402

3 Pipette tips with

filters

10, 20 and 200 μl Starlab S1111

4 15 ml tubes For centrifugation Starlab E1415-0200

5 94 well plate

For running PCR products on

CE genetic analyser

Abgene (ThermoFast 96

Detection Plate

AB - 1100)

6.1. Equipment Details of equipment are given in Table 2.

Table 2. Equipment Specifications

Item Detail E.g. supplier Product code

1 Precision pipettes delivery of 1-200 μl Starlab G8900

2 PCR thermocycler to hold 200 μl tubes MJ Research PTC-200

3 Benchtop vortex Labnet VX-100

4 Micro centrifuge to hold 1.5 μl tubes Eppendorf 5452-0000

5 Thermal mixer OR

Incubator/water bath

to hold 1.5 μl tubes

up to 70°C

6 Centrifuge with plate

rotor

7 CE genetic analyser ABI 3130xl ABI

8 Laminar flow hood PCR II Workstation Gelman

7. PROCEDURES It is ESSENTIAL to wear disposable gloves during all procedures and to use

pipette tips that are sterile and fitted with filters.

7.1. Sample Preparation Rice samples must be completely mixed before sub-samples of 1 g are taken

for DNA extraction.

Appendix 2

23

7.2. Quality Assurance The test‟s reliability relies on replication. TWO replicate DNA extractions must

be made for each unknown test sample, and TWO PCRs must be carried out

for each extract. In total, four reactions must be carried out for each unknown

test sample and 14 additional PCR reactions carried out for controls and

calibrants (composed of two negative (blank) control reactions included in

each set of reactions: a water control and a blank extraction control and two

sets of six quantitative standards (0, 5, 10, 25, 35 and 45%) of adulterant in

approved Basmati variety) must be included in each run. As well as acting as

controls these standards are necessary for preparing a calibration curve from

which quantification estimations are made.

7.3. DNA Extraction Procedure The samples and standards will be provided as ground powder. Use the

Nucleon Phytopure DNA extraction method. Extract the standards and

samples separately. Include one extraction negative (no rice sample) with

each batch of extractions performed.

7.3.1. Nucleon Phytopure method for DNA extraction

7.3.1.1. For each sample weigh out 1 g ( 0.05 g) of ground rice into a sterile 15 ml centrifuge tube and label the tube.

7.3.1.2. Add 4.0 ml of Reagent 1 from the Nucleon Phytopure Plant DNA Extraction kit to each tube.

7.3.1.3. Add 1.4 ml of Reagent 2 from the Nucleon Phytopure Plant DNA Extraction kit to each tube.

7.3.1.4. Replace caps and invert tubes to mix. Then vortex tubes thoroughly for 15 seconds.

7.3.1.5. Incubate the tubes at 65 °C in a controlled-temperature water-bath or heat block for 10 minutes, gently shaking the tubes every two minutes.

7.3.1.6. Cool all tubes on ice for 20 minutes. 7.3.1.7. A clear liquid will form as the top layer. Transfer 1.8 ml of this liquid into a

clean 2 ml tube and centrifuge this tube at 13,000 g for 15 minutes. 7.3.1.8. Transfer 0.5 ml of the supernatant fluid to a fresh 1.5 ml microcentrifuge

tube and place on ice for 20 minutes. 7.3.1.9. Add 0.5 ml of chloroform (-20°C) to each tube. 7.3.1.10. Add 0.1 ml of resuspended Nucleon Phytopure DNA extraction resin. The

resin should be fully resuspended immediately prior to use and regularly agitated during pipetting.

7.3.1.11. Vortex each tube for 15 seconds. 7.3.1.12. Place each tube on a rotating platform shaker for 10 minutes at room

temperature. 7.3.1.13. Centrifuge at 16,000 g for 15 minutes. 7.3.1.14. Transfer 0.5 ml of the upper phase (containing DNA) to a fresh 1.5 ml

microcentrifuge tube, taking care not to disturb the resin (brown) layer.

Appendix 2

24

7.3.1.15. Add 0.5 ml of cold (-20°C) propan-2-ol and gently invert tube 10 times to mix.

7.3.1.16. Centrifuge at 16,000 g for 15 minutes to pellet the DNA. 7.3.1.17. Decant or aspirate the supernatant fluid and discard, add 0.5 ml 70 % (v/v)

ethanol. 7.3.1.18. Centrifuge at 16,000 g for 5 minutes at room temperature to pellet the DNA. 7.3.1.19. Decant or aspirate the supernatant and air dry the pellet for 10 minutes. 7.3.1.20. Resuspend the DNA in 0.5 ml 1x TE buffer, allow to rehydrate for 1 hour

and then vortex gently to dissolve the pellet. 7.3.1.21. Store the DNA at 4 °C (for up to 1 month) or at -20 °C (for more than one

month).

7.4. Preparation of oligonucleotide primers

Reconstitute lyophilised forward and reverse primers using the following formula to

calculate the amount of water to be added to prepare stock solutions at 20 M:

g x 50 = vol (mL) of

water

Mw

g = the weight of primer in the tube (provided by the supplier)

MW = the molecular weight of the primer (provided by the supplier)

Centrifuge the tubes prior to opening to prevent loss of pelleted oligonucleotide. Add

the appropriate volume of deionised water to each primer and allow to rehydrate at

37oC for 30 min in the heating block. Mix by inversion and centrifuge on pulse for 20

sec. Aliquot into 0.5 mL microcentrifuge tubes, label each microcentrifuge tube with a

permanent marker and store at -20oC until required. Once thawed do not refreeze

aliquots.

7.5. PCR Amplification

7.5.1. Turn on the laminar flow hood fifteen minutes before you start to set up

the PCR reactions.

7.5.2. Remove primer stocks from the freezer and allow them to completely thaw

to room temperature (20 -25 °C). Once thawed, vortex each tube for 20

seconds and recover solution from inside the lid by centrifuging the tubes

briefly.

Appendix 2

25

7.5.3. Prepare the bulk PCR mix. Work out the total number of DNA extracts

(including blanks and quantitative standards) you need to run. Multiply

this by two to give the total number of PCR reactions to carry out. Add

approx 10% extra to this value and then use this number to multiply each

component in the table below, to give the total volume required in the bulk

PCR mix. For example, if you are testing 12 unknown samples (ie 24

duplicate DNA extractions) you will need to set up 64 reactions (16

controls + (2 x 24 test samples), therefore multiply the volumes by 70.

This will give a small excess of bulk PCR mix left to allow for pipetting

error (see Table 1).

Table 1 Volumes for preparation of bulk PCR mix. Multiply column 1 with

the total number required to give the total volume to pipette for

bulk mix.

COMPONENT Volume for one

reaction (µl)

Example volume for 64

reactions (µl)

(multiply by 70)

Forward primer (20 M) 0.2 14

Reverse primer (20 M) 0.2 14

10x PCR buffer 1.2 84

Amplitaq Gold 0.1 7

dNTP 0.24 16.8

Water 9.06 634.2

TOTAL 11 770

Label a sterile 1.5 ml tube “Bulk Mix” and add the components to the tube.

Vortex each tube for 20 seconds and recover solution from inside the lid by

centrifuging at 16,000 g for 20 seconds. Make up the bulk PCR mix

immediately before setting up PCR reactions.

7.5.4. Label the PCR tubes, one for each reaction. You must include reactions for

all six standard mixtures (0, 5, 10, 25, 35, and 45% of adulterant, e.g.

Sherbati, in Super) as well as two blank control samples.

7.5.5. Pipette 11 µl of the bulk PCR mix into each reaction tube.

7.5.6. Pipette 1 µl of sample DNA into each tube, making sure the correct

samples are added to the correspondingly labelled tubes. This gives a total

PCR volume of 12 µl in each tube.

7.5.7. Place the PCR tubes in the PCR machine/thermocycler. Set the PCR

programme as shown in table 2 and leave until all cycles have finished

(approx. 3 hours).

Appendix 2

26

Table 2 PCR amplification conditions

Step Temperature/time Cycles

1 94°C for 15 minutes 1

2 94°C for 1 min 40

55°C for 1 min

72°C for 1 min

3 72°C for 5 mins 1

7.5.8. Following the PCR, remove the tubes from the thermocycler and store at 4

°C for a maximum of one week.

7.6. Quantitative analysis using CE. The capillary electrophoresis system separates DNA fragments, which then

makes it easy to estimate their size and quantify their concentration. For

this trial the ABI 3130 should be used, however equivalent machines may

also be appropriate.

7.6.1. Prepare denaturing solution according to the table below, given for 1, and

multiply this by the total number of PCR reactions to be analysed. Add

beween 2 and 4 to this value and then use this number to multiply each

component in the table below, to give the total volume required. For

example, if you have 64 PCRs to analyse on the CE analyser you will need

to prepare enough denaturing solution for 66 wells (see Table 3).

Table 3 Volumes for preparation of denaturing solution. Multiply column 1

with the total number required to give the total volume to pipette for the bulk

denaturing solution.

COMPONENT Volume for one reaction (µl)

Example volume for a 64 reactions (µl) (multiply by 66)

Dye ROX 350 (or 500) 0.2 13.2

Hi Di Formamide 8.8 580.8

TOTAL 9 594

Appendix 2

27

7.6.2 Add 9µl of the denaturing solution to each well in a 96 well plate and then

transfer 1µl from each of the appropriate samples, standards or control

PCR tubes.

7.6.3 If there are fewer samples to complete a full run, the remaining wells must

be filled with 10µl of Hi Di Formamide and the plate record filled in with

„empty‟ to make up a complete run.

7.6.4 Place a clean, dry, grey septa cover over plate and spin down.

7.6.5. Complete the plate assembly and load the plate into the autosampler on

the 3130.

7.6.6 Fragments should be separated using denaturing conditions through a

capillary of at least 36cm.

7.6.7. Fragment peaks are scored by the software and confirmed by eye. „Stutter

peaks‟, a characteristic of microsatellite amplification, are included in the

quantitative analysis.

7.6.8 If the blanks give recognisable peaks the extraction or the PCR should be

repeated using fresh reagents and thoroughly decontaminated pipettes and

consumables.

8. DATA ANALYSIS AND CALCULATIONS

Data from RM201 is collected and transferred to an excel spreadsheet to calculate the level of adulteration. Go to „sample‟ tab and highlight the wells containing RM201. Click on the „Display plots‟ icon. The data are collected by highlighting the 2 RM201 peaks. Take out all other dyes by going to „View, Dye‟ then click on each dye to „untick‟ them. The peaks needed range from the Basmati (135-145 bp) to the non-Basmati (152 to 162 bp) peaks. Hold down „Ctrl‟ throughout while highlighting the samples and controls.

Go to View/Tables/Sizing tables. Then back to View/Table filter/show selected rows. Only those rows highlighted will appear in the table. Go to File/export Table, save the file to a memory stick. Files should be exported as Tab – delimited text (.txt) files and pasted into an excel file.

Open the Excel workbook provided find the sheet which has the headings outlined below:

In a separate row for each sample tested, copy the two values given for “Area” and paste them into the „Basmati Peak Area‟ and „Non-Basmati Peak Area‟ columns. Use the first column to give the percentage non-basmati (for standards).

% Non-

Basmati

Basmati Peak

Area

Non-Basmati Peak

Area

Appendix 2

28

You should end up with a table containing 16 rows for standards (6 x 2 replicate PCRs) and 4 rows for each unknown test sample (2 extracts x 2 PCRs). There should be a value for „Basmati Peak Area‟ given for every sample, but not all samples will give a „Non-Basmati Peak Area‟ value.

8.2. Calculate the Ratio of Area for Non-Basmati Peaks to Basmati Peaks

In the same Excel spreadsheet, check that the formula in the fourth (empty) column is:

=C4/B4

This will calculate the „Response ratio‟ (RR) for each PCR product. This is the area of the non-Basmati peak divided by the area of the Basmati peak (see Excel file shown in Appendix 1).

For example, for Standard 5% (rep1) the calculation is: 6.4 / 39.8 = 0.161

8.3. Calculate the Ratio of Standards for Non-Basmati percentage to Basmati percentage

In the same Excel spreadsheet, check that the formula in the fifth (empty) column is:

=A4/(100-A4) This will calculate the „Standard ratio‟ (SR) for each PCR product. This is the

percentage of non-Basmati in the standard divided by the percentage of Basmati in the standard (see Excel file shown in Appendix 1).

For example, for a Standard of 5% the calculation is: 5 / (100-5) = 0.053

8.4. Check that the calibration curve has been plotted correctly, please note: Use only the results from the sets of standards to plot the standard curve (not

the unknowns). Using the chart (scatter plot) function in Excel, plot the „Standard ratio‟ (x-axis)

against the „Response ratio‟ (y-axis). To fit a regression line, right mouse click on one of the points and choose „add

trendline‟. Select linear regression and under options tick display equation on chart and display R2.

The R2 value indicates the quality of the standard curve, if it is < 0.80 you must repeat the analysis.

8.5. Calculating the unknowns (see Excel file shown in Appendix 1)

The regression equation should be shown on the plot: RR = a*SR + b

where RR is the „Response ratio‟, SR is the „Standard ratio‟, a is the estimated slope and b is the estimated intercept.

Using the Excel formulae calculate the estimate of the intercept (b): =INTERCEPT(cell range for RR, cell range for SR)

Using the Excel formulae calculate the estimate of the slope (a): =SLOPE(cell range for RR, cell range for SR)

Appendix 2

29

Use the regression equation to calculate the „Standard ratio‟ (SR) for the unknown samples as follows:

SR = (RR - b) / a Then calculate the % non-Basmati using the following equation:

% non-Basmati = 100 * SR / (1+SR) Use Excel formulae to calculate the mean for % non-Basmati of all successful

replicates: =AVERAGE(cell range) Use Excel formulae to calculate the standard deviation (SD) for % non-

Basmati of all successful replicates: =STDEV(cell range)

Use Excel formulae to calculate the standard error (SE) for % non-Basmati of all successful replicates:

=SD/SQRT(n) where n is the number of successful replicates for which you have data. If one of the replicates is missing you must adjust the calculations accordingly. If more than three values are missing for the same sample you need to repeat the test.

Use Excel formulae to calculate the percentage coefficient of variation (%CV) for all successful replicates:

=100*SD/Mean 10. Reporting results Please send the completed Excel workbook, with all data and calculations to Hez Hird via E-mail at [email protected]

Appendix 2

30

9. APPENDICES APPENDIX 1. Example of Excel file

Standards

% Non-basmati

Basmati Peak

Area

Non-Basmati

Peak Area

Response Ratio

(RR) Standard Ratio (SR)

0 41.2 4.0 0.097 0.000

0 44.1 4.6 0.104 0.000

5 39.8 6.4 0.161 0.053

5 35.8 5.5 0.154 0.053

10 39.7 8.4 0.212 0.111

10 43.5 7.4 0.170 0.111

15 39.8 10.0 0.251 0.176

15 37.2 8.7 0.234 0.176

20 16.0 3.7 0.231 0.250

20 5.4 1.8 0.333 0.250

30 28.0 20.8 0.743 0.429

30 20.7 23.5 1.135 0.429

40 14.2 15.8 1.113 0.667

40 15.0 22.1 1.473 0.667

50 11.3 21.7 1.920 1.000

50 14.6 27.0 1.849 1.000

Samples Intercept 0.0001

Gradient 1.8953

Sample No.

Basmati Peak

Area

Non-Basmati

Peak Area Response Ratio

Calculated Standard

Ratio

Calculated % Non-

Basmati

Mean % Non-

Basmati SD SE Mean-2*SE %CV

2861 46.9 5.7 0.122 0.064 6.02

2861 46.5 6.1 0.131 0.069 6.47

2861 37.9 8.9 0.235 0.124 11.02 7.84 2.766 1.60 4.64 35.29

3021 21.7 14.8 0.682 0.360 26.46

3021 23.5 14.8 0.630 0.332 24.94

3021 23.1 15.7 0.680 0.359 26.39 25.93 0.860 0.50 24.94 3.31

3028 48.2 4.6 0.095 0.050 4.79

3028 38.6 4.3 0.111 0.059 5.55

3028 48.6 5.5 0.113 0.060 5.63 5.32 0.463 0.27 4.79 8.70

3101 26.0 10.7 0.412 0.217 17.84

3101 23.8 10.8 0.454 0.239 19.31

3101 29.0 12.2 0.421 0.222 18.16 18.44 0.777 0.45 17.54 4.21

y = 1.8953x + 0.0001

R2 = 0.952

0.0

0.5

1.0

1.5

2.0

2.5

0.0 0.2 0.4 0.6 0.8 1.0 1.2

Standard Ratio (SR)

Re

po

ns

e R

atio

(R

R)

Appendix 2

31

In the above example, an unknown sample with response ratio (RR) of 0.630 gives a

standard ratio (SR) of:

(0.630 - 0.0001) / 1.8953 = 0.332

And so the % Non-Basmati is given by:

100 * 0.332/ (1+0.332) = 25%

---------- END OF DOCUMENT --------