Top Banner
¿Cuántas horas dedica a probar y seleccionar los consumibles adecuados para sus aplicaciones? Con Saphira puede ahorrarse ese tiempo. Todos los consumibles Saphira han sido cuidadosamente seleccionados por nuestros expertos, para una total compa- tibilidad con sus sistemas de producción, ofreciendo un resultado final perfecto y la mejor relación precio/prestaciones. Benefíciese de nuestra experiencia para asegurar su éxito. Llámenos, o visite www.hartmannshop.es Descubra Saphira Consumibles de confianza Alabrent Revista informativa del papel y las Artes Gráficas 309 Diciembre 2010
68

Alabrent 309

Mar 13, 2016

Download

Documents

Revista informativa de Papel y Artes Gráficas
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: Alabrent 309

¿Cuántas horas dedica a probar y seleccionar los consumibles adecuados para sus

aplicaciones? Con Saphira puede ahorrarse ese tiempo. Todos los consumibles Saphira

han sido cuidadosamente seleccionados por nuestros expertos, para una total compa-

tibilidad con sus sistemas de producción, ofreciendo un resultado final perfecto y la

mejor relación precio/prestaciones. Benefíciese de nuestra experiencia para asegurar

su éxito. Llámenos, o visite www.hartmannshop.es

Descubra SaphiraConsumibles de confianza

AlabrentRevista informativa del papel y las Artes Gráfi cas

309Diciembre 2010

Page 2: Alabrent 309

www.torraspapel.com

Fieles a nuestro compromiso medioambiental, ofrecemos un producto natural y reciclable,

elaborado responsablemente a partir de materias primas renovables.

Las certificaciones PEFC y FSC de Cadena de Custodia garantizan que utilizamos madera

procedente de bosques sostenibles, y las certificaciones ISO 14001 y EMAS de gestión

ambiental acreditan nuestra apuesta por la excelencia y la protección del Medio Ambiente.

Un papel responsable con la naturaleza, con nuestros clientes y con la sociedad: un

compromiso de principio a fin.

Un papel comprometido de principio a fin

FSC® C011032

Page 3: Alabrent 309

SUMARIO

TECNOLOGÍA

TENDENCIAS Avances hacia un entorno cross-media· · · · · · · · · · · · · · · · · · · · · · · · · 4

e-books y e-publishing, creciendo en interés · · · · · · · · · · · · · · · · · · · · · · 10

PAPEL

ACTUAL Top Applications Award 2010: sexta edición del premio Fedrigoni· · · · · · · · · · · 14

Antalis: las novedades de Conqueror · · · · · · · · · · · · · · · · · · · · · · · · · · 16

Convención Anual de Unión Papelera· · · · · · · · · · · · · · · · · · · · · · · · · · 18

Una explosión de color inunda Unión Papelera · · · · · · · · · · · · · · · · · · · · · 19

Todos los días con la nueva agenda Munken· · · · · · · · · · · · · · · · · · · · · · 20

El Grupo Torraspapel innova para dar mejor servicio · · · · · · · · · · · · · · · · · 21

IMPRESIÓN

REPORTAJE Gráficas Im-Tro, a la vanguardia en nuevas tecnologías · · · · · · · · · · · · · · · · 22

Nueva sede y nuevo nombre, pixartprinting · · · · · · · · · · · · · · · · · · · · · · 26

ACTUAL Consultores Asociados S.L. integra Gestion21 · · · · · · · · · · · · · · · · · · · · · 32

Entrevista a Sergio Egea, delegado de ventas de Hartmann · · · · · · · · · · · · · · 34

Nuevas funcionalidades Enfocus Crossroads· · · · · · · · · · · · · · · · · · · · · · 38

Primer sistema de Europa de guía de registro automatizado· · · · · · · · · · · · · · 40

Acuerdo entre Palmart y Datafont· · · · · · · · · · · · · · · · · · · · · · · · · · · · 42

IMPRESIÓN DIGITAL

REPORTAJE Primera HP T300 instalada en Europa · · · · · · · · · · · · · · · · · · · · · · · · · 44

ACTUAL Servex se prepara para revolucionar el mercado transpromo · · · · · · · · · · · · · 48

Oce_ lanza sus servicios Managed Print Services en Iberia · · · · · · · · · · · · · · 50

Nextel Engineering e InfoGroup presentan sus soluciones de Outprinting · · · · · · · 52

Canon presenta un escáner de tamaño A3 compacto · · · · · · · · · · · · · · · · · 53

ACABADOS

ACTUAL Nueva plegadora B30 de MBO para MEDIAPRINT · · · · · · · · · · · · · · · · · · · 54

ACTIVIDAD INSTITUCIONAL

REPORTAJE La 18ª Semana de las Artes Gráficas se centra en el futuro del sector· · · · · · · · · 56

ACTUAL “Graphispag dará las claves para reinventar la actividad gráfica y afrontar el futuro” · 60

Page 4: Alabrent 309
Page 5: Alabrent 309

EDITORIAL

Racionalidaddddd

La racionalidad d d d d d dd esesessese uuuu uuuuuunanananana cc ccccapapapapapapapapaa acacacacacccaccididiididadadaddddd h h huumumu anana a ququueee ppermrmititititee ee pepepeepensnssssnsarararararaaaaa , , , , eveveeveveveveeee aaalaluauauauaaaaaaaarrr rrr y y y yyyy acaaaaaaa tuar de acuerdo a

ciertos princiiiiiiiiciipipiososooo d ddddddde e oopopppptittititititititit mimimmmmmimmiddadadaaaddd dddd d dd d dd yy yyyy cccococococcoc nsnsnssnsnsnnsnsnsnnsn isissisistetetetetet ncncccciaiaaaaiaaiaaa,,, , ,,, , papapapappapappparararaararaarara ssssss s ssss ttatataaaaaaaa isisisfafaaaff ceccecececececececer r r r rr aaala gúgúgúgúúgúgúún nnn obobboboboo jjejejjejj tivo o finalidad.

Usando la raaaaaaaaaaaazózózóózóz n,, e eeeell ll seseseseseseseerr r r huhhuhuhuhuhhuuumamammamamamammmmmm nonoo i i iintntntntn enenentata eeleegggiig r r pppaap raa cccoonnnsesesesegugugugug irir ll ll loooososososooooso mmmmm mm mmmayayayayayayayaaaa oororororro eseseseses bbbeeenenennnnnefe icios, de forma

"económicaaaaaaa",",,, d ddddeeeeeeseseeee dededededdededde lllllaaaasaasassaa vvvv v vv vvvaaaarariaaai dddadaasss s ss s s s lililililililililimimmimimimmm tatatataaataciciccccionnoo eeess, yyyy laaas sssss liliimimimimimmimimitatatatatatatattaciciciccccccicc oononnesse dddddddddd dddeeee eeee acacacacacccccacccciciciciicic óónónónónóó ss ss sobobooobre el entorno.

El buen uso dedeeeededddedddd l la a rararraraaaaaaazózózóózóóózón lelleeeleeeeee dd dddd a a aaa aaaalaalaalal h h h hhhhhhhhhoomomomommomommmombbbbbrbrbrbreee llaaa vvvvololuuunntttaadd d deeeeeeeded a aa a a a aaaavavavavavaanznznznznzznznznn aarararara , , pepepepeepepepeppep rdddddrdieiiiieieeiendndnnndndndndnndo o éééééséséséséééé tatataaatataattt en el momento

que no encuuueuueu ntntrararara r r razazazazzzonoonnonooo esesesess qqqueuee l lllllllee e ee e ee sasassasasaasatitititittt sfsfsfsfss aggagaaa annaaa y y aaaaaalililiiviviviviieneneenn eeeee eeel llllll mmmmmamaammm ll mmmoooomemmemementntntntntnn o o oo acacacaacaaaa tutualalllall. Por ese motivo

no todas nueueeeeeeststraras s eexxxxxpepepepepectctctcttctcctatatatatatatataa iiiivvvvvaaassasasasasassaas resesesessspopopopopondndnddndeennn aa llasasss ee e e ixixixixigegeeggg ncnccccncccccciaiaiaiaassss s s s ss dedededdeeede ll a aa aa rrrarar ciciononaaliiiidi ad, ni tampoco

nuestras intennnnnnnciononesesess a a aaaa l la a hohoohohorararararara dddd ddee e acacacacacacaccaccactttutuaar, ,, , nininininii l la aa a a foformrmmmmma a a a aaaaaaa cocococomommomoomo l l o o hahaaacececececeeeec mmmmoom s.s. L LLLLLLaaaa aa racionalidad es,

desde este punnnnnnntoooo d deee e viviviviviiv stststststs aa, uuuuunananananananannaaaa a a a a aaaspspspirrriririrrirracacacacaacaacacióióióóióióióióióiónnn n huuuumamamm nanaaanannaa, mámámámámámámám ss ququququququuuq eeeeeeeee eee uuununununu a a rerererereaaalaaalalallidddddidadaddd. PPPPoPPPP r esta razón, con

los cambios connnnsnsnnn tatataaaaantntntntntntntteeeeesesesesese en n elelelel ss ssececccccctotottt r grrgrrrgrrrg áfáfáfáfááfáfáfáfá iciciccco,oo,o,o,o,o,o, l l l a a a aaaa rararararrrraciccc ononnnalaaaaa ididdadadadadaad e enn laalaal s sssssss ss emememememeeemprprprprrprrresas y usuarios, no

tiene que ser una asasaaaaaa pipiraacicciónó dddde e unununuu aa a a aa aa sosososolaaala ppp p peeerrererereeeee sososooooosooonanananananna sss sinnnnoooo ooooo ununnunu a a realiddddaddaaa ccononnnnnnnssstststs ante de un colectivo,

donde la prensa eeeeesesee pepepeeeeecicicicicicc alalizizzadadadaddadadadadadddaaaaaaaaa a pooopoopopop nenenemmooomm sssss nnnnnununnnnunnuuueseseseesesesesesesesttrtrtrtttrt ooo ggrgraaannanannnnitititititoooooooooooo o dededdededdedededddde a arereeeeeeeennananannnnn ppaaaaraaaa a ser un sector más

racional.

EDITAAlabrent Ediciones, S.L.

Rambla Josep Tarradellas, 1 – 1º 4ª

08402 Granollers (Barcelona)

Tel.: 93 860 31 62

Fax: 93 113 69 33

DIRECCIÓNAnna Ventura Berti

PUBLICIDAD

Glòria Arnella

[email protected]

REDACTOR JEFE

José Luis Mezquita

[email protected]

PRODUCCIÓNJorge Martínez

WEBhttp://www.alabrent.com

http://www.innovaciongrafica.es

http://www.serviciosgraficos.com

http://www.egraficas.com

REDACCIÓN, ADMINISTRACIÓNY PUBLICIDADRambla Josep Tarradellas, 1 – 1º 4ª

08402 Granollers (Barcelona)

Tel.: 93 860 31 62

Fax: 93 113 69 33

PAPEL INTERIOR

CreatorStar de 115 gr/m2 de TORRASPAPEL

DEPÓSITO LEGALB28 162/1984

Alabrent no se identifica necesariamente con las opiniones de sus colaboradores y entrevistados

© Alabrent 2010 para todas las fotos y textos elaborados por la redacción de la revista

Page 6: Alabrent 309

1. La industria gráfica está en pleno cambio

La industria gráfica se encuentra

de lleno metida en un enorme cambio

donde existen nuevas formas de pre-

parar pruebas, de hacer planchas o de

imprimir. No obstante, la industria grá-

fica se ha ido dando cuenta de que

todo ese cambio sustancial es algo

bueno y que permite augurar nuevas

actividades a vender en el mercado.

Los Cross-Media son, no obstante,

una nueva forma de entender la apli-

cabilidad del mundo de las tecnolo-

gías de la información en el sector y

en la forma de vincularse con el mer-

cado. En el fondo, si lo observamos,

los grandes cambios sufridos hasta

ahora en esa transición son cambios

de tipo “interno”, es decir, que ayudan

o renuevan la forma de producción

pero, en realidad, estamos todavía

entregando el mismo producto al

cliente.

Los Cross-Media van mucho más

allá en el sentido de que, aprovechan-

do todo lo que se prepara a nivel de

diseño y de preimpresión (en realidad

pre-media) hemos de ir descubriendo

las muchas formas con que se puede

establecer una comunicación de tipo

gráfico (o no solamente gráfico) por

nuestra parte y por parte de nuestros

clientes. Una forma incipiente de este

intento es la edición conjunta de libros

y sus compañeros los CDs multimedia

o, simplemente, CDs o DVDs con el

mismo contenido que el libro.

Pero se puede entender también

los cross media como una salida des-

de preimpresión hacia cualquier pro-

ceso de producción sea offset, digital,

huecograbado, flexografía, serigrafía,

etc. En definitiva, actividades que ayu-

dan a entender más la industria gráfica

como orientada a productos que lle-

gan al cliente que orientada, como lo

está ahora, a procesos de impresión.

Todo esto significa ampliar conoci-

mientos, tener un punto de vista más

amplio y, sobre todo, saber observar

el mercado con la intención de encon-

trar nuevas aplicaciones y nuevas

posibilidades de extender la propia

facturación.

4 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

TECNOLOGÍA

TEN

DEN

CIA

S

Avances hacia un entorno cross-media

Enero: La adecuación de los papeles a la impresión digital.

Febrero: La automatización, el pdf y el jdf en la producción.

Marzo: Control del color en el impreso: tipos de equipos y sus funciones.

Abril: Aún se puede avanzar más en automatización de la impresión.

Mayo: Avances en la impresión inkjet en gran formato.

Junio: Mejoras en la versatilidad de los acabados.

Julio/Agosto: ¿Operaciones de producción en línea o fuera de línea?.

Septiembre: Mantillas y rodillos en offset: optimización y mantenimiento.

Octubre: Comparación de costes de producción entre los procesos convencionales de impresión.

Noviembre: Diversificando hacia servicios de valor añadido.

Diciembre: Avances hacia un entorno cross-media.

por Ricard Casals

2010

Page 7: Alabrent 309

Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

Y todo ello supone cambiar sus-

tancialmente las actividades de diseño

y preimpresión de forma que haya una

manera mucho más amplia de captar

información tanto de imágenes como

de animación o de audio como cual-

quier otro origen susceptible de ser

tratado y combinado con los demás

elementos. Después, de acuerdo con

los tipos de orígenes, se tendrá que

poder tratar todos esos contenidos

captados pensando en el producto o

productos finales que se van a obte-

ner.

Esto significa, lógicamente, poder

combinar los diversos “canales”, de

forma que el producto pueda después

llegar al cliente en forma no solamente

óptica sino, también, auditiva, táctil,

etc.

Finalmente, se deberá poder refor-

zar la forma de salida hacia cada uno

de los medios, no solamente una

prueba, una plancha, una hoja impre-

sa sino, también, hacia DVD, Internet,

cine o televisión, teléfonos móviles,

etc.

2. La estandarización, condición imprescindible

Nunca se llega a implantar total-

mente la estandarización. Si bien

nuestro sector ya empezaba a recoger

los resultados de la implantación de la

estandarización de formatos de fiche-

ros, de gestión del color y de mejoras

en el control del proceso de impresión

que permitía trasladar en forma exacta

los deseos del cliente hacia la máqui-

na de imprimir en una serie de condi-

ciones diferentes de impresión, nos

llegan las presiones de los clientes

pidiéndonos que ampliemos el con-

cepto de estandarización hacia el

mundo de las publicaciones o de la

publicidad.

Esto es consecuencia de haber

podido observar las ventajas de la

estandarización, tanto en revistas

como en periódicos, de los conteni-

dos gráficos y ahora quisieran que

todo esto se aplicara también a las

páginas web, a los spots de televisión

y a otros medios. Y no pasará mucho

hasta que nos reclamen también la

estandarización en las películas, en

los videos o en los teléfonos móviles.

Y lo cierto es que la industria gráfi-

ca se encuentra en una situación ade-

cuada para intentar actuar en otros

medios. Desgraciadamente, esto es

más fácil de decir que de hacer. Antes

se ha de responder a unas preguntas

clave:

¿Qué es lo que estamos intentan-

do de estandarizar?

¿A qué nos referimos con la expre-

sión “otro medio”?

¿Cómo cumplimos actualmente

con los estándares existentes a la vez

que desarrollamos flujos de trabajo

que benefician a los usuarios finales

en cuanto a velocidad, costos y cali-

dad?

¿Cómo nos aseguramos de que

existe un esfuerzo de colaboración y

no todo un conjunto desordenado de

esfuerzos que van apareciendo?

¿Cómo hemos ido a parar a este

conjunto de despropósitos? Todo

empezó al intentar estudiar las posi-

bles revisiones a la norma ISO 12647

que es el proceso de control interna-

cional para la impresión. Su parte pri-

mera define todos los tipos de impre-

sión en cuanto a los elementos de

control del proceso tradicional (densi-

dad, color, ganancia de punto, etc.)

que históricamente han sido esencia-

les en el control del proceso de impre-

sión offset.

Los problemas empezaron cuando

TECNOLOGÍA

TEN

DEN

CIA

S

Alabrent | 5

Page 8: Alabrent 309

intentamos introducir una parte 7 para

la impresión digital y nos dimos cuen-

ta de que no tenía sentido controlar

un proceso diferente utilizando pará-

metros que se pretendían para la

simulación pero que no eran inheren-

tes de su propio proceso. Después

cambiamos la parte 7 para dedicarla a

las pruebas y, mientras estábamos

obteniendo el estándar, su aplicación

fue dudosa y no aportó una ayuda que

fuera clara.

Al mismo tiempo y en Estados

Unidos, apareció la técnica de control

basada en el equilibrio de grises (G7)

que ofreció un método diferente, pres-

cindiendo de los clásicos parámetros

del offset y, con todo ello, nos dimos

cuenta que debíamos empezar a defi-

nir nuevamente la forma de controlar

el proceso de forma que fuera, preci-

samente, independiente del proceso

y, por tanto, sin hacer referencia a ese

proceso específico.

3. Se intenta coordinar esfuerzos

Realmente, aquellos empresarios

de la industria gráfica que desean

avanzar hacia los flujos de trabajo de

edición Cross-Media solicitan a las

instituciones especializadas que se

desarrolle un conjunto de buenas

prácticas para este paso.

En el fondo, es algo que debería

asumir ISO ya que, al fin y al cabo, se

trata de reproducir imágenes en color

pero, hacia salidas diferentes.

Pero como sea que las normativas

de ISO prohíben a los comités de tra-

bajo que prueben o ensayen sus pro-

pios estándares, lo lógico es que se

establezca un grupo de apoyo diferen-

te para realizar todo lo que haga falta

y avanzar hacia este objetivo.

Un comité Cross-Media de este

tipo debería establecer las siguientes

bases:

- Aún reconociendo que las comu-

nicaciones gráficas impresas se han

convertido en una de las muchas

opciones de salida de imágenes en un

entorno cada vez más complejo, toda

la experiencia obtenida en este entor-

no debería ser utilizada y aplicada en

un conjunto más amplio de activida-

des en el entorno de Cross-Media.

- Un comité Cross-Media, por tan-

to, debería trabajar partiendo de todos

los estándares o acuerdos y buenas

prácticas existentes en el mercado

para que, en cada una de las entida-

des correspondientes, se avance

hacia el desarrollo de buenas prácti-

cas con sus estándares resultantes

para la optimización de imágenes y la

implantación de flujos de trabajo reco-

mendados en un proceso de salida

Cross-Media o, quizás mejor, inde-

pendiente de cualquier tipo de salida.

- Se ha de desarrollar buenas

prácticas, estándares y flujos de tra-

bajo consecuentes para la optimiza-

ción de las imágenes en Cross-Media

y para una reproducción distribuida en

base a la experiencia desarrollada

durante los últimos años en adaptar

imágenes para cambiar las necesida-

des de los tipos de salida en la indus-

tria gráfica.

- Es necesario que sean los clien-

tes los que participen en este desarro-

llo y que, a la vez, se haga sin tener en

cuenta el proceso de salida (lo que se

llama en inglés “process agnostic”),

centrando el esfuerzo en definir los

aspectos de calidad de las imágenes

que pueden tener significado e impor-

tancia en los diversos medios en el

futuro.

TECNOLOGÍATEN

DEN

CIA

S

Alabrent | 6 Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

Page 9: Alabrent 309

Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

- Por parte del comité que se

constituya para ello, deberá determi-

nar qué es lo que se puede adaptar de

lo que se ha desarrollado hasta ahora,

especialmente en lo que se refiere a la

gestión y distribución de datos, al

desarrollo de documentos y a los flu-

jos correspondientes a todo este

movimiento. Creemos que el esfuerzo

no debería intentar concretarlo todo

en esta fase para poder tener, cuanto

antes, algunas líneas que permitan

una implantación de los Cross-Media

lo antes posible.

- Por otra parte, el contenido de

los Cross-Media, que depende sobre

todo de los diseñadores y creativos,

deberían partir de una clasificación, lo

más clara posible, de todos los aspec-

tos visuales y de cualquier posible

opción de salida sin condicionar este

tema a las propias imágenes, las defi-

niciones de los documentos o incluso

los protocolos de transferencia de

ficheros en un formato de salida espe-

cífico.

- Y esto debe referirse a cualquier

campaña de Cross-Media que se

piense establecer a partir de actuacio-

nes actuales centradas en el impreso

para evitar que se tenga que rehacer

cualquier documento o cualquiera de

sus partes para el nuevo entorno.

4. Es preciso avanzar hacia una mentalidad más abierta

Es necesario empezar a plantear

estas cuestiones sin estar condiciona-

dos en lo que se ha hecho hasta aho-

ra. En cualquier caso, no se trata de

resolver los problemas actuales sino

que hemos de intentar planificar y dis-

poner de un procedimiento uniforme

para lo que se tenga que hacer maña-

na.

Teniendo en cuenta esto, un grupo

de expertos ha intentado desarrollar

toda una serie de recomendaciones o

intenciones de lo que debe constituir

este proceso. Y el primer tema clave,

a la vez que controvertido, es plan-

tearse qué medios en concreto deben

encontrarse dentro de este proyecto

Cross-Media.

Entre las opciones obvias están

los diferentes tipos y procesos de

impresión, la web y todo ello, quizás,

segmentado según todas las posibles

opciones tales como impresión

comercial, impresión de revistas,

impresión de periódicos, envase y

embalaje, impresión digital, señaliza-

ción, fotografía, pantallas de ordena-

dor, teléfonos, dispositivos persona-

les, CD, DVD, radio, etc.

Sobre todo, hemos de evitar que

estemos totalmente condicionados

por el offset por el hecho de ser el

proceso mayoritario. Si fuera así, ten-

dríamos que evitar el hecho de empe-

zar cualquier proyecto con un modelo

de maquetación de página y evitar

que el video y el sonido sean elemen-

tos tan sólo complementarios.

Pero, por otra parte, la industria

gráfica está siendo el único segmento

que realmente está intentando pasar

hacia una plataforma Cross-Media de

forma que la metodología y el modelo

de inicio es lógico que tengan ese

punto de partida.

En cualquier caso, dejamos el

tema en el aire y, sobre todo, hace-

mos hincapié en que lo importante es

partir con una posición mental abierta

a todos los sistemas de salida actua-

les y, también a otros posibles del

futuro.

En este último aspecto, no sabe-

mos lo que habrá, a pesar de seguir

de cerca las investigaciones que se

están haciendo. Por ejemplo, las

empresas que están desarrollando

sistemas, formatos y lenguajes para

una preimpresión más universal están

ya ayudando en este sentido. Pero

todavía nos falta saber qué es lo que

se está desarrollando o se pretende

desarrollar en otros medios paralelos.

5. Bases para la viabilidad de los Cross-Media

En base a todo lo dicho hasta aho-

ra y con la intención de disponer de

una base que recoja los estándares y

las buenas prácticas que hasta ahora

se han desarrollado, con el debido

complemento de aquello que todavía

se precisa incluir en el proyecto,

damos seguidamente, en forma de

tabla, lo que debería ser, realmente, la

TECNOLOGÍA

TEN

DEN

CIA

S

Alabrent | 7

Page 10: Alabrent 309

plataforma base para que sea viable,

cuanto menos, un entorno Cross-

Media fiable. (Base en buena parte

desarrollada por un grupo de expertos

norteamericanos y conjuntada por

Larry C. Walter).

1. Creación del fichero.

1.1 Lista de comprobación en el

proceso de verificación de ficheros.

1.1.1 Observación correcta del

color en los pupitres de visualización

(ISO 3664).

1.1.2 Conveniencia del entorno de

las pantallas (ISO 12646).

1.1.3 Calibración adecuada de los

instrumentos de medición ( ISO

13655).

1.1.4 Certificación de los sistemas

de pruebas (ISO 12647-7/8).

1.1.5 Formación adecuada de los

operarios.

1.1.6 Caracterización adecuada de

los juegos de datos que se utilizan

para cada aplicación prevista.

1.2 Determinar los condicionantes de

cada uno de los medios de salida

sobre el documento en cuestión.

1.2.1 Requisitos de cada uno de

los medios de salida con respecto a

las fuentes de texto y a su reproduc-

ción adecuada (Buenas prácticas).

1.2.2 Lenguaje (Buenas prácticas).

1.2.3 Contenido visual con la des-

cripción de entrada y de salida, inclu-

yendo video y audio.

1.2.4 Colores especiales y cómo

han de definirse en base a parámetros

1.2.5 Acabado superficial, textura

y brillo.

1.2.6 Información sobre las limita-

ciones en cuanto a la colocación final

del producto impreso (Interior, exte-

rior, pantalla, etc.) (Buenas prácticas).

1.2.7 Color del soporte y su punto

blanco o transparencia y cómo condi-

ciona a las imágenes a reproducir.

1.2.8 Resolución de la imagen.

1.2.9 Influencia del tamaño de sali-

da en la resolución de imagen.

1.2.10 Nitidez.

1.2.11 Tamaño de salida del docu-

mento, con o sin limitación.

1.2.12 Tipo de reproducción digital

(pantalla) y su tamaño. (Buenas prácti-

cas).

1.2.13 Condicionantes del soporte

de salida (Buenas prácticas).

1.2.14 Otros condicionantes.

1.3 Gestión de contenidos

1.3.1 Generación, obtención o

captación de imágenes, teniendo en

cuenta todos sus componentes y su

estructura dimensional.

1.3.2 Tratamiento de las imágenes,

teniendo en cuenta las adaptaciones

que se precisan para los diferentes

espacios de salida y cualquier influen-

cia en este aspecto de los estándares

internacionales.

1.4 Previsión de la compatibilidad de

los flujos de trabajo (Formatos, aplica-

ciones, metadatos, etc.)

1.4.1 Formatos de transferencias

de ficheros para que sean apropiados

al conjunto de los flujos de trabajo.

(Buenas prácticas)

1.4.2 Formatos específicos de

fabricante y sus aplicaciones de forma

que queden bien especificadas e iden-

tificadas por todos los participantes

en los flujos de trabajo.

1.4.3 Los metadatos deben ser lo

más completos posibles para que se

pueda generar adecuadamente los

flujos de trabajo de las diferentes apli-

caciones.

2. Transferencia de fichero.

2.1 Formatos de fichero.

2.2 Condicionantes de las diversas

opciones de salida que se vayan a

aplicar en lo que respecta a los acti-

vos digitales, sus datos y sus metada-

tos.

3. Utilización de ficheros.

3.1 Lista de comprobación de fiche-

ros para el control del proceso.

3.1.1 Observación correcta del

color en los pupitres de visualización

(ISO 3664).

3.1.2 Conveniencia del entorno de

las pantallas (ISO 12646).

3.1.3 Calibración adecuada de los

instrumentos de medición ( ISO

13655).

3.1.4 Certificación de los sistemas

de pruebas (ISO 12647-7/8).

3.1.5 Formación adecuada de los

operarios.

3.1.6 Caracterización adecuada de

los juegos de datos que se utilizan

para cada aplicación prevista.

3.2 Establecer una jerarquía ade-

cuada en el contenido con los ficheros

para que haya una fácil recuperación

cuando se tengan que procesar.

3.3 Implantar el control adecuado

de los procesos para cada uno de los

medios de salida.

3.3.1 Tener en cuenta las seccio-

nes correspondientes del ISO 12647.

3.3.2 Cumplir con ISO 12646 res-

pecto a los condicionantes de las pan-

tallas.

3.3.3 Etc.

6. Conclusiones

Obviamente el listado que hemos

dado es, como hemos dicho, un pri-

mer intento que toma como base

muchos de los estándares que ya

existen. No obstante, se ha de reco-

nocer que todavía existen más pre-

guntas que respuestas y se ha de

avanzar todavía mucho a partir de

esta base.

Confiamos en que la industria grá-

fica y las otras industrias paralelas de

comunicación encargadas de otros

medios, se vayan dando cuenta lo

antes posible de la importancia de

todo este entorno que constituimos en

conjunto. Se necesita ayuda de todos

los participantes para establecer prio-

ridades y opciones que suponen ele-

mentos limitadores.

A partir de ahora será conveniente

establecer unos cuestionarios adapta-

dos a cada medio de salida para que

se puedan llenar los huecos que toda-

vía existen para poder establecer unos

estándares universales que cumplan

con el concepto de Cross-Media.

Y en este sentido, se hace una lla-

mada abierta y general a todos los

participantes en las comunicaciones

para que ayuden a definir todo lo

necesario para ello. Sólo así será posi-

ble establecer una base adecuada y

evitar un caos que podría tener el mer-

cado en unos pocos años si no se

resuelve este tema.

TECNOLOGÍATEN

DEN

CIA

S

8 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

Page 11: Alabrent 309

¿Cómo puede mejorar las tasas de respuesta para sus clientes y dar un fuerte

empuje a su rentabilidad? Lo que necesita es una solución Kodak. Le ofrecemos

soluciones de impresión con calidad de offset y el sólido flujo de trabajo qu

necesita para ser más eficiente, innovador y rentable. Es el momento de las

soluciones que le conectan a las personas y a sus objetivos empresariales.

Es su momento Y el de Kodak

Conéctese ahora en kodak.com/go/connect

© K

odak

, 20

10. K

odak

es

una

mar

ca.

Es el momento de una mayor productividad Y menos intervención.

Es el momento de las soluciones variables Y una sólida asistencia.

UNA FIABILIDAD INIGUALABLE.

ES EL MOMENTO DE UNA CALIDAD SIN RIVAL

SOLUCIONES DE IMPRESIÓN COMERCIAL DE KODAK

Publicidad y folleto | Catálogo | Correo directo | Comunicaciones de marketing integradas

e

Page 12: Alabrent 309

Introducción

La idea de la edición electrónica

en general, y de los e-books en parti-

cular, ha sido siempre algo que ha

tenido la imagen de ciencia ficción. En

el mundo real, los e-books fueron algo

fantasioso hasta la mitad de la década

de los noventa, cuando empezaron a

aparecer los primeros intentos de tec-

nologías de libros electrónicos.

Todo empezó con la aparición de

los equipos de lectura electrónica,

hardware y software, con sus diversas

opciones de marca y origen, en mayor

parte incompatibles entre ellos. Al

mismo tiempo, mucha gente rechaza-

ba la opción de leer en las pantallas

de los ordenadores, casi por principio.

Cuando empezaron a proliferar los

Palms y los PDA en general, sus

pequeñas pantallas ya empezaron a

resultar más adecuadas para la lectu-

ra de textos electrónicos.

Después, ya hacia 2001, empeza-

ron a salir lo que ya se podía llamar

dispositivos lectores e-books que

tuvieron sus adictos, especialmente

las personas que viajaban mucho y las

que eran amantes de cualquier nueva

tecnología y se convirtieron en un pro-

ducto para usuarios selectivos.

Los dispositivos e-book propia-

mente dichos se empezaron a produ-

cir en 2004. No obstante, faltaba

desarrollar el software para estos dis-

positivos y, sobre todo, títulos debida-

mente configurados para ello.

En 2006 fue cuando realmente

empezó la popularización de estos

dispositivos si bien continuaron sien-

do utilizados únicamente por aquellas

personas más deseosas de que fueran

una realidad.

Simultáneamente, las nuevas

generaciones de teléfonos inteligentes

y los nuevos modelos de Palm se fue-

ron popularizando cada vez más junto

con las aplicaciones correspondien-

tes. Pero, nuevamente, había más

conversaciones sobre el tema que

realidades prácticas.

Más recientemente, el lector e-bo-

ok y la edición de libros en software

para ello, se han convertido en ele-

mentos habituales de las tiendas

especializadas. Pero todavía, los for-

matos y los tipos de dispositivos que

están compitiendo no están bien defi-

nidos y generan una cierta confusión

en el mercado que han frenado el éxi-

to que se esperaba.

Este tema es complejo pero se ha

de tener en cuenta que cuando se

considera cualquier cambio en el con-

sumo de medios electrónicos, cual-

quier nueva tecnología o medio debe

aportar una mejor experiencia y sen-

sación de utilización para el usuario

que aquello a lo que pretende susti-

tuir. ¿Es este el caso de los e-books?

En este artículo describiremos las

ventajas y desventajas de los e-books

y de sus oponentes, los libros impre-

sos, de forma que sea más fácil pre-

decir o determinar el futuro de estos

medios de comunicación.

10 | Alabrent

TECNOLOGÍA

TEN

DEN

CIA

S

e-books y e-publishing, creciendo en interés

PRESENTACIÓN

La PIA (Printing Industries of America) de Estados Unidos prepara a principios de

cada año el documento “2010 Forecast: technology, trends, tactics” conteniendo

una colección de temas "calientes" del sector, así como también la proyección de

su evolución más probable durante el año en curso.

Así pues, durante una serie de números de Alabrent, también en este año, vamos

escogiendo artículos que pueden tener un interés alto para sus lectores.

Estos textos están adaptados y traducidos por Ricard Casals. Si se desea alguna

información complementaria o un ejemplar de todo el estudio en inglés, pueden

dirigirse a RCC Casals Consultants, S.A, e-mail: [email protected]

Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

Page 13: Alabrent 309

Definición de términos

La expresión “e-publishing” o,

incluso, la de “e-book” (o libro electró-

nico) constituye un tópico muy amplio

y a menudo difícil de delimitar. Como

que no existe ninguna definición

estandarizada, el tema o el dispositivo

puede significar aquello que cualquie-

ra quiera que signifique.

El término “electronic publishing”

se ha utilizado en la industria gráfica

como sinónimo de “autoedición” pero

se puede referir también a la distribu-

ción de textos o imágenes por medios

digitales.

El significado que le doy a “e-pu-

blishing” a efectos de este artículo es

aquel contenido creado en forma elec-

trónica y que continúa estando en for-

ma electrónica y portátil incluso des-

pués de la entrega.

Este incluye, aunque no queda

limitado, a elementos tales como:

- Contenido electrónico leído en

un dispositivo e-book especial.

- Contenido electrónico leído en

un ordenador fijo o portátil a través de

un software especial de lectura.

- Un contenido electrónico leído en

un PDA o en un teléfono inteligente

(tal como un iPhone o un Blackberry).

La parte esencial de la definición

de e-publishing es que el contenido

permanece en forma electrónica des-

pués de su utilización.

Quizás conviene comentar tam-

bién el tema de las páginas web. No

hace mucho, uno hubiera dicho que

las páginas web les falta la caracterís-

tica de la portabilidad. Esto en reali-

dad ya no es cierto. En un momento

determinado, ya se podía recoger y

leer un página web en cualquier punto

o situación.

No obstante, gracias a las redes

inalámbricas y a los teléfonos inteli-

gentes conectables a Internet, el con-

tenido de una página web puede con-

siderarse, en cierta forma, como un

“e-book”. Así pues, si vamos a una

web y descargamos de allí un libro y

lo hacemos desde un iPhone, puede

decirse que estoy leyendo un e-book.

Ventajas y desventajas de los e-books

Al igual que en cualquier otro caso,

los e-books tienen sus ventajas y sus

inconvenientes. La ponderación de

estos factores es lo que permite deter-

minar la futura adopción (o no adop-

ción) de la tecnología de los e-books

por parte de los lectores.

Entre las ventajas de los e-books

están:

- Portabilidad

Muchos de los títulos e-book pue-

den guardarse en un único dispositivo,

lo cual es ideal para los viajeros que

tienen la lectura como afición.

- Buscabilidad

El texto electrónico puede ser bus-

cado en forma fácil y rápida, mucho

más que en el caso del texto impreso.

- Enlazabilidad

El texto electrónico puede incluir

enlaces a otros puntos del libro o,

incluso, “fuera del libro” como puede

ser el caso de Internet.

- Posibilidad de destacar y anotar

Los e-books presentan la posibili-

dad de destacar frases o pasajes y

añadir cualquier tipo de notas que

después pueden ser borradas si no se

precisan.

- Ajustabilidad de la tipografía

Según deseos del lector, el pro-

grama contenido presenta la funcio-

nalidad del cambio de tamaño de la

fuente en forma dinámica para encon-

trar la comodidad de lectura indivi-

dual.

- Multimedia

Los documentos electrónicos tie-

nen la posibilidad de incorporar audio,

video, animación y otros tipos de fun-

cionalidades complementarias.

- Bajo costo de los títulos

Los e-books (nos referimos a los

contenidos) para el consumo general

tienden a ser más económicos que las

versiones impresas aparte del hecho

de tener que hacer la inversión en el

equipo de lectura correspondiente.

- Bajo costo de producción

Los libros impresos pueden ser

caros y complejos de imprimir y

encuadernar a diferencia del puro cos-

to del software correspondiente en el

caso de los e-books.

- Bajo costo de distribución

La descarga digital no supone nin-

guna operación productiva y, por tan-

to, el costo de distribución es prácti-

camente nulo.

- Responsabilidad medioambiental

Los materiales impresos precisan

la tala de árboles

Por otra parte, las desventajas de

los e-books incluyen:

- Confusión del formato

Una de las mayores barreras para

que el e-book se popularice ha sido el

hecho de tener que enfrentarse a la

gran cantidad de formatos incompati-

bles y de dispositivos de lectura que

existen.

- Necesidad de energía

Los lectores de los e-books nece-

sitan electricidad. Muchas veces los

lectores han de correr cuando se

encuentran a los finales de un capítulo

o de un libro antes de que quede ago-

tada la batería.

- Necesidades de hardware o soft-

ware

Los e-books necesitan hardware y

software especializados para poder

hacer la lectura y pueden existir

incompatibilidades, errores, etc. Los

e-books nunca darán mensajes de

error.

TECNOLOGÍA

TEN

DEN

CIA

S

Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL Alabrent | 11

Page 14: Alabrent 309

- Fragilidad de los dispositivos lec-

tores

Si se cae al suelo un libro impreso

no es probable que ocurra ningún

desastre serio. Si se deja caer un lec-

tor de e-book muy probablemente se

romperá y quedará inutilizado.

- Fragilidad de los ficheros digita-

les

Los datos digitales pueden borrar-

se, dañarse o limitarse en forma acci-

dental o deliberada y, también, es

posible que algunos formatos o len-

guajes sean transitorios y resulten ile-

gibles en cualquier dispositivo futuro.

- Riesgo de robo

Los dispositivos electrónicos son

más probables de sufrir algún robo

que los libros impresos.

- Baja legibilidad

El contenido electrónico puede

resultar difícil de leer en la pantalla

especialmente si su tamaño es peque-

ño. La iluminación puede afectar a la

legibilidad de un e-book en forma más

notable que en el caso de libro impre-

so.

- Opciones limitadas

No todo libro producido para la

impresión tiene la versión e-book dis-

ponible, con lo que los usuarios se

pueden ver obligados a realizar la bús-

queda correspondiente para encontrar

los títulos que desean.

- Calidad estética más baja

El diseño de un libro es a menudo

un arte mientras que el diseño de las

páginas de los e-book es función de

las limitaciones del propio dispositivo.

Para aquellos que ponen atención y

se sienten complacidos con la estética

de un libro, probablemente el e-book

supondrá un cierto desencanto.

- Dificultad de copia

Los e-books van acompañados

normalmente de unos derechos digi-

tales importantes que pueden limitar

la usabilidad para otros fines que no

sean la pura lectura.

- Facilidad de copia

Por otra parte, los e-books pueden

ser copiados y pasados de una perso-

na a otra que quiera hacerlo a pesar

de la ilegalidad de este acto.

- Pérdida del “tacto de los libros”

Para muchos amantes de los

libros, buena parte de la experiencia

de la lectura va acompañada del pla-

cer táctil del libro impreso y de sus

páginas.

- Responsabilidad medioambiental

Los lectores de los e-book utilizan

baterías que habrán de ser descarga-

das al igual que también tendrán un

final los dispositivos de lectura que

acabarán en vertederos para ser susti-

tuidos por modelos más recientes.

Los dispositivos de lectura de los

e-books que se eliminan, suponen

más daño medioambiental que el

papel descartado de los libros impre-

sos.

El equilibrio de estas ventajas y

desventajas determinará el progreso

futuro de los e-books y de sus dispo-

sitivos. Y esto depende realmente de

cada persona ya que la importancia

de cada ventaja o desventaja difiere

según los criterios personales.

Ventas de e-books

¿Hasta qué punto se están ven-

diendo los e-books? Según las esta-

dísticas, el crecimiento de las ventas

de los e-books (nos referimos a los

libros y no a los dispositivos de lectu-

ra) entre el 2002 y el 2008 en Estados

Unidos tuvieron un crecimiento com-

puesto del 57,8%. Si bien las ventas

empezaron por un nivel bajo, se ha de

reconocer que los e-books han tenido

mucho más crecimiento que los libros

impresos.

Perspectiva futura para los e-books

Al igual que con muchas otras tec-

nologías, quizás las previsiones futu-

ras de ventas se han magnificado

excesivamente y se ha de tener en

cuenta la propia inercia de la mayoría

de las personas hacia aquello que

hasta ahora ha sido práctico.

No obstante, se ha de reconocer

que existe un cierto “boom” en interés

y sobre todo, en novedad. La cuestión

es si, una vez establecidas las ventas

de los más curiosos y amantes de las

novedades, la propia venta de los

contenidos, de los e-books digitales,

seguirán desarrollando al ritmo que en

principio parece ser relativamente

alto.

Quizás es interesante realizar la

analogía con las cámaras digitales. La

primera cámara digital apareció en

1981 y se precisaron veinte años has-

ta que la fotografía digital llegara al

público general. La adopción del

e-book puede seguir un ritmo similar y

esto no debería sorprender. En cual-

quier caso, la experiencia de la lectura

electrónica irá mejorando y la adop-

ción de los dispositivos también cada

vez será mejor.

El futuro de los contenidos será

muy variado, como en el caso del libro

impreso, si bien puede haber una cier-

ta tendencia a un mayor crecimiento

en las temáticas de consulta o de lec-

tura relativamente corta. Queda por

ver hasta qué punto será fácil descar-

garse ficheros electrónicos de libros

hacia el dispositivo portátil, si habrá

existencias de títulos en la web o si

más bien se tratará de compras direc-

tas en forma de soportes con una

serie de títulos más o menos escogi-

bles.

Al fin y al cabo, el contenido es

contenido. Son palabras e ideas que

interesan y, quizás lo de menos, sea la

forma física en la que nos llega.

Siempre y cuando sea una experiencia

de lectura confortable y agradable, el

medio no importa. Siempre se tratará

de un tema de preferencia personal.

TECNOLOGÍATEN

DEN

CIA

S

12 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

Page 15: Alabrent 309
Page 16: Alabrent 309

14 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

En el palco, los primeros 3 clasifica-

dos en cada una de las cuatro catego-

rías en las que estaban subdivididos los

proyectos. Un palco muy concurrido en

más de una ocasión porque el concurso

Fedrigoni premia a todos los protago-

nistas de la cadena que abarca desde

quien propone los papeles (el agente o

el promotor Fedrigoni), hasta la empresa

cliente, pasando naturalmente por quién

elige el material y se ocupa del proyecto

(estudio gráfico o agencia) y quien reali-

za los productos (impresor y transfor-

mador).

La presentación fue dirigida por el

presidente Alessandro Fedrigoni, Clara

Medievo, responsable marketing de

Fedrigoni Cartiere y el consejero dele-

gado, Claudio Alfonsi, que entregó los

reconocimientos.

Contemporáneamente a la presenta-

ción se celebró, también en el Salón de

Honor de la Trienal, la inauguración de

la exposición de los trabajos participan-

tes al Top Applications Award. Trabajos

que, además de las obras premiadas, el

jurado internacional considera dignos

de mención.

Top Applications Award 2010: sexta edición de los premios Fedrigoni

PAPEL

AC

TU

AL

El miércoles 10 de noviembre,

en el Salón de Honor de la

Trienal de Milán, se celebró la

presentación de los ganado-

res de la sexta edición del

prestigioso concurso interna-

c i o n a l F e d r i g o n i To p

Applications Award.

Book Publishing Hardback (dedica-

da a Gianfranco Fedrigoni):

1° L'IMPOSSIBLE PHOTOGRAPHIE.

PRISONS PARISIENNES 1851-2010

Agencia: Paris Musees - Paris

Cliente: Paris Musees - Paris

Impresores: Edizione Rebus - La

Spezia

2° IMPRENTA REAL

Agencia: Sánchez/Lacasta - Madrid

Cliente: AECID - Agencia Española

de Cooperación Internacional para el

Desarrollo - Madrid

Impresores: Brizzolis - Pinto

3° WHAT GOOD IS THE MOON?

The Exhibitions of the Trussardi

Foundation

Agencia: Onlab - Berlin

C l i en te : Fondaz ione N ico la

Trussardi - Milano

Impresores: Hatje Cantz Verlag -

Berlin

Ganadores 2010

Page 17: Alabrent 309

PAPEL

AC

TU

AL

Book Publishing Paperback:

1° BACK COVER / Magazine

Agencia: DeValence - Paris

Cliente: Editions B42 - Paris

Impresores: Le Govic - Treillières

2° COLLANA BAZAR

Agencia: Studio Silvana Amato -

Roma

Cliente: 66TH A2ND - Roma

Impresores: Futura Grafica -

Roma

3° NUOVI ARRIVI / PROPOSTE

2009

Agencia: Elyron - Torino

Cliente: Città di Torino - Torino

Impresores: Mclgraphic - Torino

Corporate Publishing:

1° DE-COLLECTION CATA-

LOGUE T.10

Agencia: Designwork - Udine

Cliente: Tacchini Italia Forniture -

Milano

Impresores: Nava Milano - Milano

2° MISSONI HOME COLLECTION

2010

Agencia: MMG - Varese

Cliente: T&J Vestor - Varese

Impresores: GRAFICHE SIZ -

Verona

3° WEDDING INVITATION

Agencia: Et Corporate - Munchen

Cliente: Elisa Brockop & Anton

Huber - Munchen

Impresores: Et Corporate -

Munchen

3°ex equo - 20th ANNIVERSAY

EXHIBITION, CJ PICTURE BOOK

FESTIVAL

Agencia: Workroom - Seoul

Cliente: Kumho Museum of Art -

Seoul

Impresores: Hyo Sung - Seoul

Packaging:

1° LIGNE ABSOLUTION

Agencia: JAK Just A Kiss - Paris

Cliente: Absolution - Paris

Impresores: Aradeina - Paris

2° ADVENTSKALENDER

Agencia: Clormann - Gilching

Cliente: Clormann - Gilching

Impresores: Hauff Druck Art -

Gilching

3 ° A C Q U A D I P A R M A –

COLLEZIONE BARBIERE

Agencia: Think D-Sign - Milano

Cliente: Acqua di Parma - Milano

Impresores: Cavaliere & Amoretti

- Parma

Los premiados con el 2º premio Book Publishing Hardback, con el trabajo "Imprenta Real". Agencia: Sánchez/Lacasta - Madrid. Cliente: AECID - Agencia Española de Cooperación Internacional para el Desarrollo - Madrid. Impresores: Brizzolis - Pinto.

Page 18: Alabrent 309

16 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

Los eventos tuvieron lugar los dí as

21 y 28 de Octubre y 2 de Noviembre

en los Museos MACBA en Barcelona,

Museu Colecç ã o Berardo en Lisboa y

Museo Thyssen en Madrid.

La esté tica del evento fue inspira-

da en las principales claves de la

renovació n con islas que mostraban la

nueva calidad y tonalidades naturales

de Conqueror Bamboo. Una pared

albergaba un display en el que se

podí a ver y tocar la nueva calidad

Conqueror Print Excellence y la nueva

paleta de colores.

El evento se desarrolló bajo el

lema “it’s not what you say... it’s how

you say it”. El concepto, presente en

toda la campañ a de Conqueror, hace

hincapié en la importancia de la

elecció n del papel en la creació n y

comunicació n del mensaje. Se

presentó en exclusiva un catá logo rea-

lizado por Arjowiggins Creative Papers

y que cuenta con la colaboració n de

Jean Francois Porchez de la

compañ ia Typofonderie, famoso

tipó grafo francé s que ha creado

tipografí as tan importantes como las

de Louis Vuitton o Le Monde.

Porchez ha creado 5 tipografí as

exclusivas para la gama Conqueror,

que se muestran en este catá logo.

Las tipografí as diseñ adas por Porchez

son AW Conqueror Sans, AW

Conqueror Didot, AW Conqueror

Inline, AW Conqueror Slab y AW

Conqueror Carved. Ademá s ha sido

creada una t ipografí a china en

colaboració n con la compañ í a The

Beijing Founder Electronics. Estas

tipografí as ofrecen a los diseñ adores

nuevos caminos frescos e innovado-

Antalis: las novedades de Conqueror

PAPEL

AC

TU

AL

Antalis presentó en el MACBA de Barcelona las novedades de Conqueror.

Antalis presenta a diseñ adores

y clientes la renovació n de la

gama Conqueror en espacios

exclusivos como son los

museos de referencia en las

principales ciudades de

Españ a y Portugal.

Page 19: Alabrent 309

res para hacer destacar sus creacio-

nes.

El acto incluí a una visita guiada y

exclusiva a las exposiciones de estos

importantes museos, contando con

una gran aceptació n por parte del

pú blico invitado.

Con este nuevo lanzamiento

Antalis apuesta una vez má s por la

innovació n, mostrando un fuerte com-

promiso con el medioambiente.

PAPEL

AC

TU

AL

Page 20: Alabrent 309

18 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

La sesión de trabajó se realizó en la

sala de prensa, donde Alejandro

Ramos, director general de Unión

Papelera, hizo un recorrido por el año

cerrado en junio 2010 y resaltó la buena

marcha de la empresa, a la vez que

destacó que “pese a que todavía no se

han alcanzado los volúmenes del 2008,

Unión Papelera está de nuevo experi-

mentando un ligero crecimiento y

hemos marcado unos objetivos ambi-

ciosos, pero totalmente alcanzables”.

De todas formas, Alejandro Ramos

alentó a todo su equipo a seguir traba-

jando como hasta ahora, y comentó los

nuevos proyectos que se van a poner

en marcha, así como la incorporación

de nuevas gamas de papeles, para

completar su portfolio de productos.

La siguiente exposición corrió a car-

go del representante de Mondi, recono-

cido fabricante de papeles digitales,

quien señaló hacia donde se dirige el

mercado, además de las ventajas de

esta gama de papel. Entre los asisten-

tes tuvo muy buena acogida y manifes-

taron cómo sus clientes están deman-

dando papeles de estas características.

Lo mismo ocurrió con la presentación

de la marca Cromático-ca, desarrollada

por Emeric Thibierge, que se puede

describir como una explosión de color

en papeles vegetales, que recuerdan las

tonalidades de los vidrios de Murano.

Se completó la exposición con la entre-

ga de material que demostraba las cua-

lidades para la impresión de estos

papeles.

Finalizó la sesión de presentaciones

con un análisis del negocio de embalaje

UP-PACK, que se lanzó al mercado en

el pasado mes de abril, y donde se

comentó la incorporación de nuevos

artículos que completan la gama, así

como la eliminación de alguno de ellos

y la modificación del tamaño de otros.

Tras ello, los asistentes se traslada-

ron al restaurante dentro del propio

estadio del R.C.D Espanyol donde se

sirvió un estupendo cóctel que destacó

por su variedad y presentación, por su

original combinación de colores y sabo-

res. Después, todos los comensales

tomaron asiento para degustar un sucu-

lento solomillo acompañado de un mil-

hojas de patatas. Posteriormente, pasa-

ron al postre y los cafés, para, a conti-

nuación, proceder a la entrega de pre-

mios a los comerciales que han alcan-

zado los objetivos de venta. Fueron

representantes de las principales fábri-

cas de papel, los encargados de hacer

entrega de los merecidos galardones.

Pero la jornada no acabó aquí, por-

que ¡cómo no disputar un partido de

fútbol! Hubiese sido un “sacrilegio”.

Perfectamente equipados, unos de ver-

de y otros de naranja, los dos equipos

bajaron al campo y allí, como si de dos

alineaciones de Primera se tratase, dis-

putaron un partido que duró alrededor

de sesenta minutos. Mientras, el resto

de asistentes se comportaron como

verdaderas aficiones apoyando a todos

los “deportistas”. Entre las jugadas

más apasionantes, destacó el gol de

rodilla que marcó Antonio Salas, direc-

tor de Marketing estratégico de Unión

Papelera. El resultado quedó 3-1 a favor

del equipo verde (haciendo justicia al

posicionamiento medioambiental de la

empresa).

Según diversas fuentes, no hubo

ningún lesionado, pero lo que no se ha

podido saber es en qué condiciones se

encontraban al día siguiente.

Alejandro Ramos, comentó para

finalizar que “ha sido una jornada muy

provechosa, ya que se han comentado

temas y proyectos nuevos que van a

proporcionarnos grandes ventajas com-

petitivas en el mercado”.

Convención Anual de Unión Papelera

PAPEL

AC

TU

AL

En una mañana otoñal, se

concentró, en el nuevo estadio

del R.C.D. Espanyol, una

importante representación de

todas las delegaciones de la

compañía. Al evento también

asistieron representantes de

los principales fabricantes de

papel y varios colaboradores

de Unión Papelera.

Page 21: Alabrent 309

19 | AlabrentImpreso en CreatorStar de 115 g/m2 de TORRASPAPEL

Unión Papelera en su afán por

seguir innovando y en síntesis con las

necesidades de sus clientes, acaba de

llegar a un acuerdo con Thibierge &

Comar Papetiers, para la distribución

en España de esta gama de papel.

“Este acuerdo nos abre un amplio

campo de actuación y cubrimos las

necesidades de nuestros clientes.

Asimismo, con la gama Cromático,

también nos permite diferenciarnos

dentro de la gama de papeles vegeta-

les”, nos comenta Alejandro Ramos,

director general de Unión Papelera.

CROMÁTICO,-CA es un papel

vegetal que responde a las expectati-

vas de sus clientes, con una serie de

características como son ofrecer

paquetes más económicos de 100

hojas sólo en 100 gramos, frente a los

paquetes de 250 hojas de otras mar-

cas del mercado. También presenta

formatos más ajustados y rentables

como son el 62 x 92 cm, a diferencia

de los formatos tradicionales de 70

x100 de otras marcas, y que se ha

demostrado que desperdician un 19%

más que con el formato de la gama

CROMÁTICO. Destaca su comporta-

miento frente a los diferentes tipos de

impresión, así como resaltar su rápido

tiempo de secado.

Esta gama de vegetales incorpora

los colores más bonitos, frescos, lumi-

nosos e intensos con los más altos

estándares de calidad, que se con-

vierten en los favoritos entre los dise-

ñadores gráficos y las agencias de

publicidad. Además, de la explosión

de color, CROMÁTICO incorpora tres

tipos de blancos: Transwhite, Extra

Blanco y Transparente.

El Cromático Transwhite, es una

novedad en España, se caracteriza

por su alta transparencia y por su

blancura natural, se podría decir que

es el papel más claro del mercado. El

usuario puede además escoger entre

siete gramajes. Y el Cromático Extra-

Blanco se diferencia por su blanco

puro y ligeramente opaco, y se puede

elegir entre cuatro gramajes.

La otra novedad de CROMÁTICO,-

CA es su oferta de sobres que se pue-

den adquirir en paquetes de 50

sobres, lo que permite ajustarse a la

cantidad solicitada por los clientes.

La gama CROMÁTICO, -CA está

obtenida sin tratamiento químico, sólo

mediante el refinado de la pasta; se

basa en la suspensión de fibras de

celulosa para hacer una especie de

jalea, que una vez teñido, escurrido y

secado, da un papel transparente de

seguimiento brillante. Cromático está

fabricado a partir de pasta de madera

de bosques gestionados y que cuen-

tan con el sello FSC. Se trata de un

papel sin cloro, sin metales pesados u

otros aditivos peligrosos.

Una explosión de color inunda Unión Papelera

PAPELA

CTU

AL

Esta gama de vegetales incorpora los colores más bonitos, frescos, luminosos e intensos con los más altos estándares de calidad.

Cuando Emeric Thibierge,

creador de la firma Thibierge

& Comar Papetiers, llegó a

Murano, observó a los sopla-

dores de vidrio y le impresio-

nó la variedad de colores. De

aquí surgió la idea de crear

una gama de papel vegetal de

color. Y para ello escogió

como nombre la palabra

CROMATICO, -CA cuyo signifi-

cado es colores o relativo a

ellos.

Page 22: Alabrent 309

20 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

Este año el mensaje es el medioambiente

En 2010 el mensaje era "Munken

EveryNow” se hizo un llamamiento

para aprovechar al máximo los

muchos momentos fugaces de la vida.

“Forward Look” o “Mira hacia delan-

te”, es el mensaje de la versión 2011,

centrado en la protección del medio

ambiente. Cada mes se acompaña de

una frase con consejos sobre cómo

podemos hacer pequeñas mejoras del

medio ambiente en cada momento de

nuestra vida diaria.

Los valores están en la línea del

perfil de Munken. Estar en armonía

con la naturaleza y en equilibrio con el

medio ambiente son importantes

directrices para toda la fabricación de

los papeles Munken, producidos en

Arctic Paper Munkedals, donde los

bosques profundos, el río Örekil y el

fiordo Gullmars, son los vecinos más

cercanos a la planta.

Imágenes e interactividad

Un nuevo elemento es la imagen

del mes, impresa a color, mostrando

las posibilidades inherentes de los

seis papeles que componen la gama

Munken Design. Las imágenes corres-

ponden a la colección Rough Roads,

una colección única de primeros pla-

nos de superficies de carreteras toma-

das por el fotógrafo sueco, Jens

Andersson.

A su vez, la agenda Munken 2011

se complementará con una medida de

interactividad, cada mes habrá una

referencia en Internet en la que se

podrá participar en concursos para

poder conseguir premios, descargar

imágenes o tener acceso a materiales

y experiencias únicas.

Para las personas que quieran

tener un recordatorio del tiempo más

allá de un año también podrán des-

cargarse un protector de pantalla que

se sincroniza con el reloj del ordena-

dor .

Todos los días con la nueva agenda Munken

PAPEL

AC

TU

AL

En 2011 con la agenda

Munken se echa una mirada

hacia el pasado. La agenda

más conocida de Arctic

Paper tiene un nuevo aspec-

to con el que pretende ofre-

cer un panorama mejor a

los tiempos que vivimos.

Page 23: Alabrent 309

21 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

Durante el mes de Octubre,

Torraspapel, empresa perteneciente al

Grupo Lecta, ha puesto al servicio de

los clientes de su Distribuidora en

Portugal dos novedades importantes,

diseñ adas para anticiparse a sus

necesidades y ofrecerles constantes

mejoras en el servicio y procesos.

A travé s de su nuevo Centro de

Atenció n al Cliente, Torraspapel

Portugal ofrece a los clientes un

moderno e innovador sistema de

atenció n telefó nica, con un servicio

má s á gil, personalizado y exclusivo. A

partir de ahora, podrá n efectuar sus

operaciones habituales - desde hablar

con un gestor comercial hasta realizar

una consulta té cnica o solicitar una

muestra - de manera má s rá pida,

todo a travé s de un ú nico nú mero.

El renovado porta l web de

Torraspapel Portugal nace con el

objetivo de facilitar a los clientes el

acceso a toda la informació n de pro-

ducto, localizar lo que se necesita y

completar el proceso de compra en la

tambié n renovada plataforma de

comercio electró nico, con condiciones

de entrega ó ptimas y la misma

garantí a de servicio al que está habi-

tuado.

Ademá s, está plasmado el com-

promiso del Grupo con la sostenibili-

dad, ofreciendo la bú squeda de pro-

ductos certificados y reciclados así

como la descarga de todas las certifi-

caciones disponibles para cada papel.

E l p royecto entero ha ido

acompañ ado de una ambiciosa

campañ a de comunicació n, bajo el

lema ‘Toda a Torraspapel ú nico

nú mero’, que fue presentado en el

encuentro de la sociació n Portuguesa

de las Industrias Grá ficas (Apigraf) a

principios de este mes de octubre y

que se verá anunciado en los medios

especializados.

Con ello Torraspapel quiere seguir

su trayectoria de innovació n en el sec-

tor, que refleja la apuesta firme de la

compañ í a en la mejora de sus servi-

cios basada en las posibilidades que

ofrecen las nuevas tecnologí as.

Torraspapel está presente en

Portugal desde hace má s de 40 añ os.

Con una amplia gama de productos,

unida a unos reconocidos niveles de

servicio y un firme compromiso con

desarrollo sostenible, Torraspapel es

lí der en la Distribució n de papel en la

Pení nsula Ibé rica.

Para má s informació n:

Centro de Atendimento ao Cliente

- 707 91 99 91

www.torraspapel.pt

El Grupo Torraspapel innova para dar mejor servicio

PAPELA

CTU

AL

Torraspapel reafirma su com-

promiso con la innovació n y la

sat isfacció n del cl iente

mediante un nuevo centro de

atenció n al cliente y un reno-

vado portal web para los

clientes de su Distribuidora

portuguesa.

Page 24: Alabrent 309

Miguel Ángel Gascón Hernández

(42) y Rafael Gascón Hernández (36)

son los máximos responsables de

Gráficas Im-Tro, la empresa que, con

gran esfuerzo y esmero, crearon sus

padres, Miguel Gascón y Hortensia

Hernández en 1974; entonces se lla-

maba Gráficas Rugán, situada en el

barrio de Carabanchel (Madrid). En

1987 nace Gráf icas Im-tro, en

Leganés; a partir de este momento,

esta empresa familiar se convierte en

una de las empresas más competiti-

vas de la comunidad madrileña.

Actualmente, Miguel Gascón y

Hortensia Hernández están jubilados y

sus hijos, Miguel Ángel y Rafael, son

los que siguen el proyecto que ellos

22 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

Gráficas Im-Tro cuenta con una excelente trayectoria empresarial, basada en la reno-

vación continua de equipos y sistemas, en la formación y en la atención al cliente.

Estos factores han convertido a esta firma en un referente en la industria gráfica.

IMPRESIÓN

REP

OR

TA

JE

Frente a la Speedmaster CD 102-5+L, y de izquierda a derecha, Rafael y Miguel Ángel Gascón, gerentes de Gráficas Im-Tro, y Ángel Grützmann y Juan Fernández, comerciales de Hartmann.

Gráficas Im-Tro, a la vanguardia en nuevas tecnologías

Page 25: Alabrent 309

Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

iniciaron; manteniendo los valores que

ellos les han inculcado toda la vida:

honestidad, voluntad y seriedad en

todos los ámbitos personales y profe-

sionales.

Miguel Ángel es responsable de

Administración y cursó estudios de

Artes Gráficas en Tajamar; Rafael es

responsable de producción y está

licenciado en Empresariales. Aportan

una amplia formación técnica y admi-

nistrativa; si bien cada uno tiene deli-

mitado su campo de acción, ambos

se pueden suplir en cualquier momen-

to, ya que están preparados y cono-

cen perfectamente todas las áreas de

la empresa.

El año pasado Rafael Gascón aca-

bó el Máster en Procesos Gráficos, y

Miguel Ángel Gascón, el Máster

Empresarial en Artes Gráficas, impar-

tidos por el ITGT Tajamar. Los herma-

nos Gascón asisten con regularidad a

los diferentes cursos y conferencias

que se organizan en la Asociación de

Empresarios Gráficos de Madrid

(AGM) o en el ITGT Tajamar.

INVERSIONES EN NUEVOS EQUIPOS E INSTALACIONES

En 1990 Gráficas Im-Tro da un sal-

to cualitativo espectacular: inicia un

plan de inversiones basado en la

adquisición de nuevos equipos pro-

ductivos. Un plan de inversiones que

sigue adelante. En el año 2004 accede

al formato 32x52 con la adquisición

de una Speedmaster SM 52-4; en

2005, instala un CtP Topsetter P102

con cargador automático de planchas.

En el año 2006 se traslada a unas

nuevas instalaciones de 2.500 metros

cuadrados, de los cuales 2.000 están

destinados a taller de producción y

almacén y 500 a Preimpresión, recep-

ción y oficinas, en el polígono San

José de Valderas, Leganés. Es una

nave moderna, adaptada a las necesi-

dades de la industria gráfica actual y

con un equipo humano que aporta

grandes conocimientos gráficos. Junto

con la nueva nave, también se adquie-

re una Speedmaster SM 102-4-P, de

cuatro colores con cuerpo inversor.

Este equipamiento les ha facilitado lle-

gar a clientes a los que antes no

tenían acceso.

Esta política de inversiones se

debió a la buena situación económica

por la que atravesaba el país en esos

años y a los requerimientos del mer-

cado. Rafae l Gascón expl ica:

“Teníamos una gran demanda de pro-

IMPRESIÓN

REP

OR

TA

JE

Alabrent | 23

El pupitre de mando Prinect Press Center permite controlar todas las operaciones de la máquina.

El taller de impresión de Gráficas Im-tro cuenta con los equipos tecnológicos más avanzados de Heidelberg.

Page 26: Alabrent 309

ducto impreso y ampliamos conside-

rablemente nuestra cartera de clien-

tes, por los cual, si queríamos dar un

buen servicio, nos veíamos obligados

a invertir. Era la fórmula que nos per-

mitía ser competitivos y cumplir con

las demandas de nuestros clientes.

Además, la tecnología en el sector

gráfico ha cambiado tanto que, si no

se invierte, no se avanza, con lo cual

se pierde competitividad. Es por ello

que nos vemos obligados a invertir

constantemente en nueva tecnolo-

gía”.

SPEEDMASTER CD 102-5+L

La última adquisición de esta firma

ha sido una Speedmaster CD 102-

IMPRESIÓNR

EP

OR

TA

JE

24 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

Rafael y Miguel Ángel Gascón en la salida Preset Plus de la Speedmaster CD 102-5+L.

Vista parcial del departamento de preimpresión, recepción y oficinas de Gráficas Im-Tro.

El amplio equipamiento tecnológico del que dispone Gráficas Im-Tro le permite ser una de las empresas más competitivas de la Comunidad Madrileña.

Page 27: Alabrent 309

Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

5+L: “Ésta ha sido una inversión estratégica”, afirma

Miguel Ángel Gascón, “que nos va a permitir posicionar-

nos en el sector del Packaging, que es el sector, según las

previsiones, que más crecerá en el futuro, y también nos

facilitará el acceso a nuevos clientes relacionados con el

cartón, estuchería, displays, etc. Por otro lado, el barniz

acrílico y también el Drip-off –efectos especiales– los esta-

mos incorporando al mercado comercial, ya que en este

segmento no están muy implantados”.

“El barniz acrílico”, añade Rafael,”lo están aceptando

muy bien nuestros clientes. En el segmento comercial no

se trabaja demasiado con barniz; si bien en el de embala-

je está totalmente introducido, en el comercial todavía no,

y los acabados de revistas, folletos… quedan excepciona-

les”.

La Speedmaster CD 102-5+L con cuerpo de barniz, de

Gráficas Im-Tro, dispone del sistema convencional de

racleta de cámara para conseguir unos resultados impeca-

bles en los acabados de alto brillo y el barnizado con

reservas. El registro del cuerpo barnizador se puede corre-

gir dentro de un margen de +/- 1mm desde el Prinect

Press Center. Este grado de precisión es decisivo para

conseguir una alta calidad, especialmente en el barnizado

con reservas.

Gracias a su alta flexibilidad, la CD 102+L resulta idó-

nea para casi todos los segmentos de la impresión indus-

trial. Permite imprimir hasta 15.000 pliegos/hora sin mer-

mas de calidad. La separación de los pliegos, las excelen-

tes condiciones de registro, y la conducción exacta y cui-

dadosa de los pliegos proporcionan unos resultados ópti-

mos.

PRINECT PRESS CENTER

El pupitre de mando Prinect Press Center permite con-

trolar todas las operaciones de la máquina, desde la pre-

paración del pedido y el ajuste de la máquina hasta la eva-

luación del pliego impreso. Tomando como base el

Sheetfed Control, la plataforma de control descentralizada,

el Prinect Press Center integra el mando de la máquina y

el control de la tinta y el registro en un mismo pupitre de

mando. Asimismo, los datos de producción están disponi-

bles para su consulta de forma centralizada y en tiempo

real.

La apuesta tecnológica y la gestión empresarial llevada

a cabo en Gráficas Im-Tro, en toda su trayectoria, se basa

en el trabajo diario, la constancia, la formación y la aten-

ción al cliente. “El estar en un mercado tan competitivo

hace que no podamos parar; tenemos que estar prepara-

dos para conseguir la perfección y estar a la vanguardia

de las nuevas tecnologías para ofrecer el mejor producto a

nuestros clientes”, comenta Rafael, y Miguel Ángel añade:

“Para conseguir estos objetivos, no queda más que invertir

en última tecnología y en formación, lo cual que nos per-

mitirá una mayor productividad, rentabilidad y eficiencia,

en beneficio de nuestros clientes y nuestra empresa”.www.exaprint.es

Tel. : 902 109 334offset & digital

24 horas/día 7 días/semana

ENVÍOGRATUITOPOR TNT

Riera de vallvidrera, 17 Pol. Ind. Riera de Molí / 08750 Molins de Rei

Envío 4 días

Catálogo/tarifas + Catálogo Productos verdes + Guía de preimpresión + Muestras

La IMPRENTA EXPRESS exclusivamente reservada a los profesionales

100% profesionalesde las Artes Gráficas

EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnvvvvvvvvvvvvvvvvínnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn íovvíííooooooooooooooooooooooooooooooooooooooooooooooooo 444444444444444444444 4444444444444444444444444444444444 díííííííííííías44444444444444444444444444444444444444444444444444444444444444 dddddddddddddíííííííííííííííííííííííííííííííaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaassssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssss

RESS

Pida su Kit Profesional Pida su Kit Profesional en www.exaprint.es/kiten www.exaprint.es/kit

ENVÍO29€

CALENDARIO DE BOLSILLO8,5x5,4 cm 350 g.

7DÍAS

1000 ej.€35

ENVÍO3,25€

CALENDARIO 12 PÁGINAS10,5x29,7 cm 200g. - CUAT. 1 CARA

a partir de sus archivos de preimpresión

7DÍAS

1000 ej.PRECIO UNITARIO

ENVÍO0,32€

CALENDARIO TRÍPTICO10x21 cm 350g. - CUATRICROMIA 1 CARAa partir de sus archivos de preimpresión

5DÍAS

2000 ej.PRECIO UNITARIO

Page 28: Alabrent 309

La fórmula del web to print que en

estos años ha constituido el éxito de

pixart ha permitido a la empresa trans-

formar un flujo de trabajo artesanal en

un proceso totalmente industrial. En la

nueva sede pixartprinting realiza los tra-

bajos de impresión destinados al merca-

do europeo, salvo los productos de

pequeño formato solicitados por la clien-

tela inglesa, que se imprimirán directa-

mente en la nueva sociedad pixartprin-

ting.co.uk con sede en Londres.

El software: la columna vertebral de la empresa

El punto fuerte del proceso producti-

vo es el software de gestión, que consti-

tuye, a todos los efectos, la columna

26 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

Con un gran evento dirigido a la prensa internacional, pixart inauguró oficialmente, el

pasado noviembre, su nueva sede en Quarto D’Altino, en las proximidades de Venecia,

anunciando la primicia de la nueva denominación de la empresa, pixartprinting, con la

que operará desde ahora en toda Europa. La nueva casa matriz ocupa un edificio de

10.000 m2 destinados a la producción y 2.000 m2 de oficinas. Es el primer paso de una

estrategia de internacionalización que apunta a la conquista del mercado europeo.

IMPRESIÓN

REP

OR

TA

JE Nueva sede y nuevo nombre, pixartprinting

Glòria Arnella, enviada especial a Venecia

Page 29: Alabrent 309

Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

vertebral de la empresa ya que canali-

za toda la información que permite

monitorizar cada paso de la elabora-

ción en tiempo real. El nuevo sistema,

realizado a medida internamente por

el equipo de seis ingenieros informáti-

cos de la empresa, se basa en un

software open-source y multiplatafor-

ma que abarca presupuestos, pedi-

dos, flujo de trabajo y administración.

"Esta elección ha llevado 15 meses de

trabajo a plena dedicación y una inver-

sión de unos 400.000 euros. El resul-

tado es, a nuestro parecer, sorpren-

dente: el software asegura nuevas

ventajas a los clientes en términos de

servicio y precio. Además, gestiona

automáticamente todo el flujo produc-

tivo, ofreciendo un número casi infinito

de datos estadísticos, fundamentales

para el análisis puntual de las tenden-

cias", comenta Alessandro Tenderini,

Director General. El software dirige los

pedidos a las máquinas automática-

mente, asignándolos a un operador,

con una visión preliminar del archivo,

y luego monitoriza todas las etapas

del proceso. El sistema dispone de

alertas que señalizan eventuales

sobrecargas del flujo de trabajo y de

esta manera permite optimizar la orga-

nización interviniendo en la asignación

de los recursos. Asimismo, el progra-

ma determina de manera automática

la tecnología de impresión económi-

camente más eficiente para cada pro-

yecto.

El futuro próximo de pixartprinting

se presenta rico en proyectos muy

ambiciosos. Más allá de las nuevas

líneas estratégicas, habrá una gran

novedad a nivel productivo / gestión.

Desde hace poco más de un año, al

amplio parque de máquinas digitales

se han añadido sistemas de impresión

offset. La elección parecería ir en con-

tra de las tendencias. Sin embargo, la

dirección ha hecho hincapié en la

capacidad productiva de los sistemas

offset de última generación. "Lo que le

interesa al cliente es la calidad, la pun-

IMPRESIÓN

REP

OR

TA

JE

Alabrent | 27

Mateo Rigamonti, CEO y fundador de pixart,...

...Alessandro Tenderini, Director General,...

... y Marcello Libralato, Jefe de Servicio al Cliente, explicaron las d i ferentes ideas, f i losof ía y proyectos de la empresa.

Sala de control de pedidos, que mediante el potente software que utilizan, gestiona el flujo de trabajo agrupando los pedidos por tipo de soporte y plazos de entrega.

Page 30: Alabrent 309

tualidad y el precio, no la tecnología

con la que imprimimos. En pixart la

integración entre offset y digital es

gestionada por el software propietario,

que clasifica los trabajos de modo

totalmente automático entre las dos

tecnologías de acuerdo con toda una

serie de consideraciones, como la car-

ga general de trabajo, la optimización

de las cubiertas, los plazos de entre-

ga... La elección de invertir en offset

se debe a que, si bien la tirada ha dis-

minuido considerablemente en los

últimos años, aún no es tan baja como

para que la impresión digital convenga

indefectiblemente. Además, estamos

descubriendo que el umbral de renta-

bilidad respecto de la tecnología digi-

tal ya no es de 700 copias A3 (o 350

anverso y reverso) sino que, con una

serie de implementaciones de soft-

ware que estamos desarrollando,

podría llegar a 200/250 copias. En

IMPRESIÓNR

EP

OR

TA

JE

28 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

pixart fue fundada en 1994 y desde 2000 trabaja como empresa web to print. A lo largo de los años ha conquistado en Italia un liderazgo indiscu-tible, y desde el comienzo el plan de negocios de la empresa ha incluido la expansión internacional. "Creo que los factores del éxito en Internet son tres: la preparación de una estrategia de marketing sólida y de largo alcance, el apoyo de herramientas de software adecuadas y la elección de equipos y proveedores con un altísimo nivel de organización", afirma Matteo Rigamonti, CEO y fundador de pixart. Conceptos sobre los cuales la empresa ha desarrollado su modelo de negocios y ha obtenido el éxito esperado, hasta el punto de adjudicarse en el pasado mes de octubre, por "Méritos Especiales", el prestigioso premio "La Vedovella", principal reconocimiento italiano en el ámbito de las artes gráficas. Hoy la empre-sa cuenta con unos 120 empleados, que trabajan en tres turnos para garantizar el servicio los 7 días de la semana, y posee una cartera de 65.000 clientes, el 60% de los cuales se encuentra en Italia. La clientela está constituida en un 90% por operadores del sector, principalmente empresas de impresión.

pixartprinting cuenta con dos sistemas offset Komori, uno de 4 colores y el otro de 10 (en la imagen).

Page 31: Alabrent 309

Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

nuestra opinión, comienza una nueva

juventud del offset", afirma Tenderini.

Para optimizar aún más las potenciali-

dades de esta tecnología, se está

poniendo a punto “Uragano”, un nue-

vo software hecho a medida, proyec-

tado ad hoc internamente, que gestio-

nará el flujo de trabajo agrupando los

pedidos por tipo de soporte y plazos

de entrega. El software será operativo

desde enero de 2011 y permitirá redu-

cir aún más los costes de producción.

Ventaja que pixartprinting destinará a

la clientela europea, ofreciendo pre-

cios realmente incomparables. Esto

constituirá indudablemente otro recur-

so para obtener los resultados espera-

dos de la nueva estrategia orientada a

la conquista del mercado europeo.

El hardware: los cimientos de la empresa

El área productiva en la nueva

sede se presenta como un único e

inmenso espacio abierto dividido vir-

tualmente en dos líneas productivas:

la primera para el pequeño formato y

la segunda para el gran formato. El

departamento de envíos se encuentra

exactamente en el centro del edificio,

donde desembocan ambas cadenas

productivas. El área de pequeño for-

mato comprende un almacén de

papel, el área de impresión propia-

mente dicha, el acabado y el transpor-

te hasta el punto de envío. El área de

gran formato comprende un almacén

de soportes rígidos y en bobina, siste-

mas de impresión flatbed y roll to roll,

IMPRESIÓN

REP

OR

TA

JE

Alabrent | 29

Parte de las instalaciones donde se imprimen los trabajos de pequeño formato.

Imagen del área de gran formato, que comprende sistemas de impresión plano y en bobina.

Page 32: Alabrent 309

y las áreas de acabado y de envío.

La maquinaria de impresión del

departamento productivo pixartprin-

ting incluye los mejores sistemas tec-

nológicamente avanzados disponibles

en la actualidad. Las instalaciones son

indudablemente dignas de ser desta-

cadas en el panorama europeo.

Los números de pixartprinting

Software y hardware dan vida a

una estructura que garantiza una

capacidad productiva extraordinaria,

ya ampliamente puesta a prueba por

el ritmo de crecimiento exponencial

de la empresa.

Hoy se registran en el sitio unos

7.000 presupuestos por día, 2.000 de

los cuales se traducen en pedidos

efectivos, con sus respectivos envíos,

destinados a toda Europa, y con una

cartera de aproximadamente 65.000

clientes. La empresa cuenta con unos

120 empleados que trabajan en tres

turnos, para garantizar el servicio los 7

días de la semana, y consume 200

toneladas de papel por mes para

pequeño formato y 60.000 m2 de

materiales rígidos para gran formato.

"Si bien, a nuestro parecer, la nue-

va sede es algo realmente extraordi-

nario, que hace unos años podíamos

apenas imaginar, con ocasión de la

inauguración oficial podemos dar otra

gran primicia. Hemos firmado un con-

trato de compra de un terreno de

66.000 m2 donde construiremos una

nueva sede de 33.000 m2 cubiertos,

que estará lista en 2013. Este proyec-

to responde de lleno a un plan de

negocios que apunta a la conquista

del mercado europeo", comenta con

orgullo Matteo Rigamonti, CEO de

pixartprinting.

La estrategia de internacionalización

Sobre la base de las evaluaciones

realizadas, hoy la dirección de la

empresa puede anunciar una nueva

estrategia que apunta a posicionar a

pixartprinting en el panorama europeo

como protagonista de referencia den-

tro del sector web to print, gracias a la

capacidad productiva de la nueva

sede. La primera premisa de la que

deriva la nueva estrategia es la nece-

sidad de superar la italianidad que

caracteriza hoy a la empresa. Si bien

en numerosos sectores mercadotécni-

cos, desde la moda hasta los alimen-

tos, la industria italiana es universal-

mente reconocida como sinónimo de

calidad, refinamiento y exclusividad, el

distintivo "Made in Italy" no parece

tener el mismo atractivo en el ámbito

de la impresión. De hecho, la expe-

riencia práctica ha demostrado que

existe cierta desconfianza hacia un

proveedor de servicios de impresión

cuyo nombre, "pixart.it", alude clara-

mente a la nacionalidad italiana. Sin

embargo, hay países en los que la

"receta pixart" tiene un gran éxito. Es

el caso de Francia, por ejemplo, don-

de tenemos varios miles de clientes

activos. En cambio, no es el caso en

el Reino Unido, donde a pesar de una

intensa actividad de marketing duran-

te los últimos dos años, y en ausencia

de competidores locales, los clientes

suman sólo unos pocos centenares.

La primera novedad de la estrate-

gia de internacionalización es la deno-

minación con la que la empresa traba-

jará desde finales de noviembre en el

mercado europeo: PIXARTPRINTING.

Un nombre que enriquece a la actual

"PIXART", que por supuesto no renie-

ga de su pasado pero que añade

valor, explicando la actividad central

de la empresa con la palabra

"PRINTING". "Este cambio no ha sido

una decisión fácil", comenta Matteo

Rigamonti, CEO y fundador de pixart.

"Tras largas reflexiones hemos llegado

a esta conclusión que, a nuestro pare-

cer, consigue los dos objetivos que

perseguimos. Consolidar la relación

con los clientes actuales, que igual-

mente pueden reconocernos en la

nueva denominación, y presentarnos

a posibles clientes que, no conocien-

IMPRESIÓNR

EP

OR

TA

JE

30 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

Maquinaria de impresión del departamento productivo pixartprinting

Para el pequeño formato actualmente se utilizan:

6 HP Indigo2 sistemas offset Komori, uno de 4 colores y uno de 10 coloresequipos de acabado Horizon, Duplo y Polar5 plotters de corte Zund para el acabado2 líneas de soldadura y dos ojaladoras Flexa.

Para el gran formato la empresa ha implementado:

3 Durst Rho 700 HS PAC y una Rho 700 PAC, para expositores e impre-sión sobre soporte rígido 2 roll-to-roll Durst Rho 3204 HP Latex de 2,5m que imprimen aproximadamente 8.000 m2 cada una por mes, por un total de 32.000 m2

El nuevo sistema HP Latex 3,2m, actualmente en evaluación. Si las prue-bas responden a las expectativas, se implementarán en breve otros 5 sistemas HP Latex 3,2m4 plotters Mutoh con tintas sublimables para la impresión de banderas6 plotters Roland para la impresión de vinilo adhesivo cuando se requie-ren cambios rápidos del material2 sistemas KIP Color para la realización de pósteres y carteles

Para el acabado del gran formato se emplea una fresa Cielle, un

plotter de corte Zund de última generación y un sistema para el

empaquetado de paneles Panotec, que permite crear cajas con

flujo de trabajo automatizado.

Page 33: Alabrent 309

Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

do pixart, podrán entender de forma

inmediata el servicio que ofrecemos."

El segundo objetivo de la nueva

estrategia es ofrecerse al mercado

europeo como empresa multinacional,

capaz de "hablar el idioma" de cada

país, tanto literal como metafórica-

mente. Por este motivo, la empresa

ha creado "tiendas virtuales" para

cada país considerado en este

momento comercialmente interesante,

con flujos de trabajo personalizados.

Cada uno tendrá un dominio local, de

modo que los clientes podrán acceder

a la oferta y a los servicios visitando

su "tienda de vecindario": pixartprin-

ting.es; pixartprinting.fr, etc.

Hasta ahora se han adquirido

dominios para 20 países europeos y

10 no europeos. Los escaparates de

pixartprinting en Europa hablarán el

idioma de la clientela y se activará un

servicio de atención al cliente con

número telefónico nacional por país.

En la actualidad la tienda funciona en

Italia, Francia y España. Pronto tam-

bién Portugal tendrá su escaparate y

su servicio al cliente. Sólo en el Reino

Unido se ha desarrollado una estrate-

gia diferente, firmando un acuerdo de

colaboración con una empresa de

impresión local, dando vida a una

nueva sociedad independiente deno-

minada PIXARTPRINTING.CO.UK. La

colaboración iniciada en el Reino

Unido es un proyecto piloto. Los

resultados constituirán la herramienta

con la que este modelo de negocio se

replicará a través de colaboraciones

comerciales y productivas en otros

países europeos. En todos los otros

países donde pixartprinting piensa

desarrollarse se lanzará una fase

demo con sitio en inglés y, según la

reacción de la clientela, se irán desa-

rrollando puntos de venta locales vir-

tuales con el respectivo servicio de

asistencia al cliente.

IMPRESIÓN

REP

OR

TA

JE

Alabrent | 31

Venecia y su entorno fue el lugar perfecto para que más de 50 periodistas europeos asistieran a la presentación del nuevo proyecto de pixartprinting.

Page 34: Alabrent 309

32 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

El sector de las artes gráficas se

ha convertido de un tiempo a esta

parte en un sector terriblemente com-

petitivo, en el que además, como con-

secuencia de la crisis actual, se hace

necesario reducir los plazos de entre-

ga, Stocks de materia prima, reducir

los plazos de fabricación, evitar para-

das, etc.

En palabras de Mario Temprano,

Director General de Consultores

Asociados, S.L. “ La decisión de inte-

grar dentro de nuestra herramienta un

planificador de nivel mundial, viene

como consecuencia de la necesidad

de dar respuesta a una problemática

muy concreta dentro del sector gráfi-

co, como es el de los plazos de entre-

ga, y todo lo que ello conlleva, que si

bien nosotros ya la teníamos cubierta

con nuestro planning, el cual cubre

estas necesidades y está implantado

con éxito en muchas empresas gráfi-

cas, nos dábamos cuenta que para un

determinado número de empresas,

esta labor requería de un Scheduling

de talla internacional”.

Para Carlos Bayona, Presidente de

Planning Group, “ Consultores

Asociados han demostrado con cre-

ces durante mas de 20 años, ser los

que mas saben del Sector Artes gráfi-

cas, esto es fundamental para conse-

guir el mayor rendimiento de la

implantación de ASPROVA en este

sector, por ello es una garantía de éxi-

to que sean ellos quienes se encar-

guen de ASPROVA en el sector

Gráfico. Por otro lado los módulos de

Presupuestacion y control de produc-

ción de Gestion21 parecen estar

hecho a medida para complementar

ASPROVA en estas áreas, dando una

solución única hasta ahora inexistente

en el mercado, tanto en el sector grá-

fico como en otros donde nosotros

estamos presentes”.

Con el objeto de facilitar la adqui-

sición del producto, se permitirá elegir

entre que se aprovechen de las ayu-

das otorgadas por el Ministerio de

Industria a través del Proyecto

AVISPA, dirigido a mejorar la competi-

tividad y productividad de la PYME, o

bien se adhieran a la fórmula

ASPROVA PYME pago por uso, desde

500 Euros/mes.

Consultores Asociados S.L. integra Gestion21

IMPRESIÓN

AC

TU

AL

Consultores Asociados S.L. en

su empeño de ofrecer el mejor

sistema de gestión avanzada

del mercado, ha decidido inte-

grar en su sistema, Gestion21,

el Planificador de Producción

ASPROVA, perteneciente a la

empresa Planning Group, uno

de los Schedulings más

potentes y conocidos a nivel

internacional, y que tras 16

años en el mercado, está

implantado con éxito en mas

de 1.500 empresas.

Page 35: Alabrent 309
Page 36: Alabrent 309

34 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

- Entraste en Hartmann a finales de 2003 como especialista de Postimpresión. Con anterioridad ¿ya habías trabajado en la industria gráfica o era un sector nuevo para ti?

Nunca había tenido contacto con

la industria gráfica; el decidirme por

este sector industrial se debe a una

caída importante de la automoción en

lo que a proyectos de ingeniería se

refiere, por lo que decidí cambiar y el

sector gráfico me atrajo por su gran

dosis de creatividad y cambio cons-

tante.

Desde 1994 hasta mi ingreso en

Hartmann formé parte de diferentes

empresas ubicadas en diversos secto-

res, como son: automoción, servicios

e impresión digital. Eran empresas

pioneras, en las que adquirí conoci-

mientos sobre distintas áreas de ges-

tión: la administración, gestión de

clientes, control de calidad, gestión

comercial y relación con los provee-

dores.

- Dispones de un importante bagaje profesional de todo el ámbi-to empresarial, si bien, por lo que cuentas, no estás relacionado directamente con la industria gráfi-ca, ¿cómo conseguiste hacerte

especialista en acabados y encua-dernación?

El perfil que se solicitaba para este

puesto era el de una persona a la que

le gustasen los retos constantes, dia-

rios, dar soluciones a los diferentes

trabajos planteados por los clientes.

La posición de especialista en acaba-

dos creo que está directamente rela-

cionada con personas a las que les

guste enfrentarse a configuraciones

de máquina cambiantes, incluso a

combinaciones a veces un poco inve-

rosímiles. Como es sabido, esto es

algo que hacemos los ingenieros habi-

tualmente.

Entrevista a Sergio Egea, delegado de ventas de Hartmann

IMPRESIÓN

AC

TU

AL

Sergio Egea a principios de 2010 fue nombrado Delegado de Ventas de las zonas de Cataluña, Aragón, Navarra, La Rioja, Baleares y Canarias.

Sergio Egea (Sabadell, 1975).

Está diplomado en Ingeniería

Técnica Electrónica (UPC) y

Program for Management

Development (PMD) en ESADE.

Posee un amplio conocimien-

to del sector gráfico y del área

comercial. A principios de

2010 fue nombrado Delegado

de Ventas de las zonas de

Cataluña, Aragón, Navarra, La

Rioja, Baleares y Canarias,

sucediendo a Leo Lukacs, que

durante años estuvo al cargo

de esta Delegación.

Page 37: Alabrent 309

Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

Cada encargo, cada plegado, cada

corte, cada inserción de un producto

en otro requiere un estudio y una

dosis de creatividad que te permita

configurar la máquina precisa para lle-

gar a un resultado. Tengo que ser sin-

cero y decir que este trabajo me ha

proporcionado una ilusión constante

día tras día, me ha renovado y me ha

mantenido al día en el mundo las Artes

Gráficas.

- A mediados de 2009 Hartmann inició una serie de medidas y cam-bios para adaptar la empresa a las nuevas necesidades que demanda el mercado. Uno de los resultados de esos cambios fue tu nombra-miento, en enero de 2010, como Delegado Comercial de las zonas de Cataluña, Aragón, Navarra, La Rioja, Baleares y Canarias. ¿Cómo afrontas el cambio?

Bueno, todos los cambios son

positivos en la vida, o al menos hay

que luchar de manera que se expre-

sen de esta forma. Primeramente me

gustaría decir que afronté este cambio

con mucha ilusión, muchas ganas y

actitud positiva, cosa que en los

momentos que vivimos escasea y es

muy necesaria para impulsar los pro-

yectos que nos encomiendan las

empresas.

Personalmente, los cambios me

gustan, es más, los necesito. Después

de 7 años como especialista en aca-

bados, me apetecía un nuevo reto, y

la verdad es que me colmó de ilusión

que la nueva dirección pensara en mí

como sucesor de Leo Lukacs. Haré

todo lo que esté en mi mano para

estar a la altura y que, conjuntamente

con esta nueva dirección, podamos ir

adaptando la empresa a los tiempos

que nos está tocando vivir. Como

todos sabemos, son tiempos duros,

donde muchas estructuras que creía-

mos inmóviles se cambiarán forzadas

por la situación general del mercado.

Cuando me preguntan qué tal me

va en el nuevo puesto, siempre res-

pondo lo mismo: “la situación es difí-

cil, pero seguro que saldré airoso y

reforzado, con experiencia y bagaje

para afrontar con éxito el futuro”.

La palabra que todos debemos

tener en mente es futuro; éste sólo

nos puede deparar una situación posi-

tiva. Con esa idea debemos construir

hoy los cimientos estratégicos de las

empresas, para que éstas perduren

con el paso del tiempo y superen las

adversidades que se les presenten.

- Hasta ahora has desempeñado tus funciones profesionales en el área de Acabados y Encua-dernación. Como delegado, tienes que conocer la amplia gama de pro-ductos que Hartmann distribuye y que abarca todo el proceso produc-tivo, es decir, Preimpresión, Impre-sión, Postimpresión, Consumibles y Recambios. ¿Con qué recursos cuentas para conocer a fondo todo el porfolio de productos?

En un primer momento y desde mi

entrada en Hartmann, la política del

antiguo delegado Leo Lukacs era que

todo integrante del grupo comercial

asistiera a todos los cursos formativos

de todos los productos. Estos cursos

me han permitido tener una idea gene-

ral de todo el porfolio de Hartmann,

pero ahora me queda lo más duro,

que es formarme en cada una de las

líneas más profundamente. En lo que

a gestión se refiere, acabo de finalizar

un PMD (Program for Management

Development) impartido por ESADE,

donde he podido adquirir los conoci-

mientos necesarios para gestionar

todos los estamentos de la empresa.

Soy un ferviente defensor y fomen-

tador de la formación constante y es

por eso que mi deseo es que la

empresa nos siga permitiendo formar-

nos en todas aquellas facetas que

puedan ser interesantes para la

empresa y, por supuesto, para la evo-

lución profesional de todos nosotros.

- El área geográfica que gestio-nas cuenta con una red de comer-ciales altamente cualificados; son p r o f e s i o n a l e s f o r m a d o s e n Hartmann y en Alemania, principal-mente en Heidelberg y Polar. El departamento de ventas, al igual que otros departamentos de Hartmann, ha tenido que adaptarse a la nueva realidad empresarial. Para ti ¿cuáles son los cambios más importantes acaecidos en tu área?

Dada la situación económica que

estamos atravesando, la estrategia de

Hartmann en lo que a venta se refiere

está potenciando lo que denomina-

mos las 3S’s (Service, Spare parts &

Suppliers), es decir, Servicio Técnico,

Recambios y Consumibles. Es por

este motivo que la estructura comer-

cial también se ha adaptado al enfo-

que marcado por la nueva dirección

de Hartmann.

Nuestra prioridad se centra en dar

una cobertura apropiada a toda nues-

tra red de clientes. El enfoque a clien-

te debe ser nuestra máxima para

poder asesorarle en las necesidades

que se le presenten y mantener o

incluso ampliar las buenas relaciones

que siempre hemos tenido con éste.

- Tu actividad profesional requie-re que visites empresas diariamen-te; son empresas grandes, media-

IMPRESIÓN

AC

TU

AL

Alabrent | 35

Page 38: Alabrent 309

Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

nas y pequeñas, muchas de ellas se encuentran con serios proble-mas de liquidez debido a la crisis que estamos atravesando. Para ti ¿cuáles deberían ser los objetivos prioritarios de estas empresas para superar la crisis y volver a ser com-petitivas?

En estos momentos, todo consejo

o asesoramiento es difícil, porque la

situación es compleja. Lo único que

se puede sugerir es que inviertan un

poco de tiempo en pensar y analizar

hacia dónde va el sector, para poder

tomar decisiones e invertir en aquellos

activos que puedan darles una ventaja

competitiva en el futuro. Lo cierto es

que éste es el momento de invertir,

pero para ello la estrategia de direc-

ción debe estar clara.

En todas las tertulias económicas

siempre salen a la palestra dos con-

signas que creo que son la base para

poder salir de la crisis; la competitivi-

dad y la eficiencia; sólo si somos

capaces de conseguir el máximo

exponente de estos parámetros

podremos tener el control de la situa-

ción.

Los objetivos prioritarios a corto

plazo serían optimizar la estructura,

luchar por la eficiencia e invertir en

maquinaria para poder dar respuesta

al mercado y conseguir la competitivi-

dad.

Una vez la situación económica

remonte, estaremos en disposición de

crecer de manera estable y consolidar

el buen trabajo realizado en los

momentos de dificultad.

- La aparición de las nuevas tec-nologías, Internet, Web-to-print, están cambiando el modelo de negocio y creando un nuevo pano-rama empresarial ¿qué deben hacer las imprentas para que lo que hoy se ve como una amenaza se convierta en una oportunidad de negocio?

Internet ha sido el detonante de

una revolución en lo que a comunica-

ciones se refiere. En la actualidad, el

mundo se circunscribe a una pantalla

de ordenador. Da la sensación de que

lo podemos controlar, y ese potencial

aplicado al sector empresarial ha pro-

vocado la aparición de infinitos pro-

yectos y de ofertas de todo tipo de

productos al alcance de todo el mun-

do. Sólo queda formar parte de este

sistema y jugar según sus reglas.

Oponerse al cambio constante no es

aconsejable, se deben utilizar todas

las herramientas que estén a nuestro

alcance para conseguir sacar nuestros

negocios adelante.

Según Einstein: “No pretendamos

que las cosas cambien si seguimos

haciendo lo mismo. La crisis es la

mejor bendición que puede sucederle

a personas y países, porque la crisis

trae progresos”. En nuestro caso, la

estandarización de los procesos, la

eficiencia, la competitividad y el total

control de la información de los mis-

mos hace que, cada día más la inte-

gración de todos los estamentos de la

empresa con el sistema CIP4 basado

en JDF sea el futuro, en lo que a

comunicaciones y procedimientos se

refiere. Este proceso interno se debe

consolidar y posteriormente se debe

externalizar de manera que los clien-

tes tengan la posibilidad de enviar sus

trabajos a la imprenta y que puedan

hacer un seguimiento del estado de

los mismos.

- Para finalizar, a corto-medio plazo ¿cuáles son las previsiones

de venta de tu delegación y qué estrategias vas a seguir para con-seguir los objetivos fijados?

Para conseguir los objetivos que

tenemos previstos no nos queda más

que trabajar mucho, tener una gran

cobertura de zona -la información es

muy valiosa para poder ayudar a los

clientes en sus quehaceres diarios-,

ser eficientes y resolutivos en las

tareas que se encomienden y luchar

para que la estructura interna de la

empresa sea lo más eficiente posible

pensando que el cliente es nuestro

principal objetivo.

Uno de los objetivos que nos

hemos marcado es crecer en la venta

de consumibles; en esta parcela me

gustaría hacer una buena labor para

consolidarnos en el mercado como

proveedores de consumib les .

Potenciar la venta del resto de las

3S’s para poder asegurar en el futuro

la estructura de Hartmann.

IMPRESIÓNA

CTU

AL

36 | Alabrent

Page 39: Alabrent 309
Page 40: Alabrent 309

38 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

Inaugurada en 2007, Enfocus

Crossroads es una comunidad en

línea alrededor de Enfocus Switch que

reúne a usuarios de Enfocus Switch,

socios de Crossroads y socios inte-

gradores de Crossroads. La comuni-

dad original, 'Crossroads', ha pasado

a llamarse Enfocus Crossroads para

poner de manifiesto su vínculo con

Enfocus y su estrecha relación con los

socios de Crossroads.

“Queríamos que Enfocus y

Crossroads tuviesen una unión más

estrecha y subrayar que Crossroads

cuenta con el apoyo de Enfocus. Por

supuesto, el objetivo sigue siendo

ofrecer una plataforma neutra dedica-

da a la solución de automatización

Enfocus Switch”, señala Fabian

Prudhomme, Vicepresidente de

Enfocus. “Las nuevas funciones del

sitio web responden a nuestra volun-

tad de ampl iar e l a lcance de

Crossroads y de colmar las necesida-

des de nuestra comunidad de usua-

rios".

Recientemente, Enfocus designó

a Angelo Manno para el nuevo puesto

de Director de Cuenta del programa

Crossroads. "Me complace poder tra-

bajar con los distintos socios de

Enfocus Crossroads y contribuir a

ampliar la comunidad presentando

nuevos socios a nuestra creciente car-

tera de usuarios de Enfocus Switch.

Las nuevas incorporaciones al sitio

web Enfocus Crossroads constituyen

un activo muy valioso para todos sus

miembros”, afirma.

Nuevas funciones

Entre las nuevas funciones desta-

can un nuevo sistema de gestión de

contenidos para ofrecer más flexibili-

dad y expansión futura, un nuevo foro

de usuarios y blogs de empresas aso-

ciadas. Tanto los usuarios como los

socios pueden subir sus flujos de

Nuevas funcionalidades Enfocus Crossroads

IMPRESIÓN

AC

TU

AL

Enfocus amplía su comunidad

Enfocus Crossroads con el

lanzamiento del sitio web

www.crossroads-world.com,

completamente rediseñado.

Además de nuevas funcionali-

dades, el portal aporta un

mayor grado de interacción

para todos sus usuarios.

Page 41: Alabrent 309

Switch directamente a Enfocus

Crossroads para compartirlos con los

otros miembros.

Enfocus Crossroads quiere con-

vertirse en el punto de encuentro vir-

tual entre los usuarios y socios de

Enfocus Switch, y el nuevo foro de

usuarios y los blogs de terceros

fomentarán la interacción entre todos

los miembros. Los usuarios de Switch

pueden aprender de otros usuarios y

socios, y aplicar las prácticas más

indicadas a su propia empresa, según

Manno: “Enfocus Crossroads es una

plataforma neutra que aúna a distintos

tipos de socios. Nos parece importan-

te ofrecerles una plataforma de deba-

te separada, distinta del sitio web de

Enfocus".

Los blogs de los socios también

les darán la oportunidad de dirigirse

directamente a la comunidad. “La

automatización es un tema candente y

hay mucho que decir y que aprender

sobre ello. La gente quiere escuchar

distintas opiniones. A través del blog,

damos a los socios de Crossroads la

oportunidad de hablar directamente

con la comunidad”, añade Manno.

La gama de productos Enfocus

Switch consta de LightSwitch,

FullSwitch y PowerSwitch. Cada una

de ellas ofrece funciones para ayudar

a los usuarios a crear flujos que auto-

matizan secuencias de eventos y pro-

cesos. Una vez creados, dichos flujos

se pueden intercambiar fácilmente

con otros usuarios. Cualquier miem-

bro de la comunidad puede subir su

propio flujo al nuevo sitio web Enfocus

Crossroads. Una vez allí, estará dispo-

nible para que todos los demás miem-

bros puedan descargarlo e importarlo

a su propia versión de Enfocus

Switch.

“El nuevo sistema para subir flujos

lo convierte en una plataforma verda-

deramente interactiva”, subraya

Manno. “Todos los miembros registra-

dos podrán publicar, puntuar y revisar

flujos del portal. También podrán

hacerlo los clientes potenciales que

estén probando cualquiera de las apli-

caciones de Crossroads. Estamos

convencidos de que los usuarios agra-

decerán comprobar que existe toda

una comunidad alrededor de esta

solución de automatización. Además,

pueden acudir al portal Enfocus

Crossroads para solucionar los pro-

blemas de otros usuarios, obtener una

solución a sus problemas y encontrar

nuevas ideas”.

Fortalecimiento de la comunidad Crossroads

La gama de productos Switch

acepta un número cada vez mayor de

configuradores. Los configuradores se

utilizan para proporcionar acceso

directo y control a aplicaciones de ter-

ceros desde Switch, y para ayudar a

automatizar todo el flujo de trabajo.

Todos los socios que desarrollen un

configurador de Switch se convierten

automáticamente en socios de

Crossroads.

La versión más reciente de Switch

09 se integra perfectamente con el

sitio web Enfocus Crossroads. Desde

Switch, los usuarios pueden hacer clic

con el botón derecho en un configura-

dor para obtener más información

sobre una aplicación de un socio de

Crossroads. Desde allí son dirigidos

automáticamente al sitio web de

Enfocus Crossroads, donde podrán

encontrar más información acerca del

socio, la aplicación y los flujos dispo-

nibles. A partir de ahora, también

podrán descargar una versión de eva-

luación de las aplicaciones de terce-

ros. “Hemos procurado que fuese muy

sencillo descubrir nuevas aplicaciones

que se integran fácilmente con

Switch”, concluye Manno.

Para obtener más información,

www.crossroads-world.com y www.

enfocus.com

IMPRESIÓN

AC

TU

AL

Page 42: Alabrent 309

40 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

El sistema de QuadTech, con

cámaras de registro MultiCam®, se

instalará en cinco torres de la rotativa

de impresión offset de bobina

GEOMAN de manroland, de 1220 mm

de ancho, en la planta de Schwarzach.

Se espera que la inversión incremente

la productividad de una rotativa que

produce más de cinco millones de

periódicos y folletos por semana desde

que comenzó a funcionar en 1994. En

el proceso, se imprimen diversos

periódicos regionales de Austria, inclu-

so su propio diario más representativo,

Vorarlberger Nachrichten, que tiene

más de 200.000 lectores en el estado

más occidental del país.

La guía de registro y el control de

deformación del papel automatizados

intensificarán la consistencia de la cali-

dad, que hasta ahora había represen-

tado un desafío para el impresor debi-

do a que el grosor del papel varía,

habitualmente, entre 45 g/m² y 60g/m².

Con sus diferentes características

de estiramiento, que varía de un rollo a

otro, el control de deformación del

papel compensa automáticamente el

error de registro aplicando presión en

la bobina mediante rodillos. Esto per-

mite que el equipo de producción de la

planta de Schwarzach ahorre el tiempo

que debía gastar en hacer correccio-

nes manuales por deformación del

papel, una operación que exigía que

mucho personal tomara medidas

correctivas de forma continua en toda

la tirada de producción.

Debido a que los controles de

QuadTech se basan en la plataforma

integrada de ICON™, VMG se benefi-

cia con una estación de control central,

Primer sistema de Europa de guía de registro automatizado

IMPRESIÓN

AC

TU

AL

De izquierda a derecha: Stephan Doppelhammer (gerente regional de ventas de QuadTech), Wilfried Übelher (jefe de impresión de Vorarlberger Medienhaus Group), Raimund Meusburger (gerente del taller de impresión de Vorarlberger Medienhaus Group), Frans Boelens (gerente general de QuadTech en Europa) y Vince Balistrieri (gerente general de QuadTech, SBU de impresión comercial y de periódicos).

Vorarlberger Medienhaus

Group, una compañía inter-

nacional de medios de

Schwarzach, Austria, se ha

convertido en el primer

cliente de Europa en instalar

el Sistema de guía de regis-

tro con control de deforma-

ción del papel recientemente

perfeccionado de QuadTech.

Page 43: Alabrent 309

Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

desde la cual el personal

puede recuperar y aplicar

datos de preparación de tra-

bajos guardados para todos

los controles de rotativas en

red, y supervisar cada rotati-

va desde un sólo sitio. En

consecuencia, un supervisor

de rotativa puede controlar

con regularidad la exactitud

del registro y así reducir al

mínimo los desperdicios. Las

cámaras con registro de

color MultiCam de cada torre

identifican marcas de hasta

0,36 mm (0,014 pulgadas), a

velocidades de hasta 17,6

m/s (3500 pies/min), y reali-

zan hasta 30 búsquedas por

segundo. Esto hace posible

la detección inmediata de

problemas de tensión del

papel y permite que la rotati-

va alcance exigentes toleran-

cias de registro más rápida-

mente, por encima de reco-

nocidos estándares de la

industria. De este modo, se

reduce el desperdicio de

materiales, especialmente

durante la fase de puesta en

marcha de la tirada de pro-

ducción.

Vorarlberger Medienhaus

Group ha sido reconocida en

la industria de los periódicos

por su compromiso con la

excelencia de producción y

ha obtenido reconocidos

premios, como Newspaper

of the Year (Periódico del

año) del Congreso Mundial

de Periódicos en 2006 y dife-

rentes e innovadores portales

en línea. Con objeto de ubi-

carse como proveedor de

servicios totales, la compañía

ha ampliado su cartera de

servicios para incluir activi-

dades de comercialización

cruzada, un hecho que per-

mitió que la compañía de

medios obtuviese el premio

Cross Media en la presenta-

ción IFRA Expo este mes en

Hamburgo. El grupo se ha

ampliado para incluir radio,

clasificados en línea y teleco-

municaciones, y ha entrado

en los mercados de Europa

Oriental, con intereses referi-

dos a los medios de comuni-

cación en Hungría, Rumania

y Ucrania.

E l s e ñ o r R a i m u n d

Meusburger, gerente del

ta l le r de impres ión de

Vorarlberger Medienhaus

Group en la p lanta de

Schwarzach, comentó: “Esta

inversión intensifica nuestra

capacidad de cumplir con las

expectativas del cliente en

cuanto a mantener una cali-

dad elevada, en términos de

precisión del registro y repre-

sentación del color, y de

reducir aún más los niveles

de desperdicios. Además,

como impresores con fijación

en frío (coldset), podemos

competir más eficazmente

por tiradas más prolongadas,

que tradicionalmente han

sido el dominio de los pro-

veedores de secado por

calor (heatset). Con la insta-

lación del nuevo sistema,

podemos estar seguros de

que cada copia tenga el

estándar más elevado”.

Page 44: Alabrent 309

42 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

Dicho acuerdo va a permitir la inte-

gración de la solución web2print

Pressero en el sistema de gestión para

Artes Gráficas Palmart dotándole de

todas las prestaciones y servicios de

la imprenta virtual basada en web. La

presentación oficial tendrá lugar en la

próxima edición de Graphispag pre-

vista para marzo de 2011 pero en

pocas semanas estará en marcha su

comercialización.

Las utilidades del web2print abar-

can una gama muy amplia y variada:

desde el cálculo instantáneo de pre-

cios, aprobación de flujos de trabajo,

tiendas on-line de comercio electróni-

co, FTP integrado, tiendas para clien-

tes, webs personalizadas, sistema de

pago y envío, dato variable, proveedo-

res...

Acuerdo entre Palmart y Datafont

IMPRESIÓN

AC

TU

AL

Francisco Pérez y José Vicente Salas, directores de Palmart y Datafont.

A mediados del pasado mes

de octubre se firmó el acuer-

do de colaboración técnico

comercial entre Palmart, mar-

ca de referencia de software

de gestión para el sector grá-

fico, y Datafont, distribuidor

exclusivo para el mercado

español y latinoamericano de

la apl icación web2print

Pressero.

Page 45: Alabrent 309

Polígono, 34, s/nTel.: 943 69 60 64 • Fax: 943 69 60 02 • e-mail: [email protected] 20150 BILLABONA (Gipuzkoa)

Corte y manipulación de papel y cartón

La tecnología más avanzada del mercado

Page 46: Alabrent 309

Para Rotolito Lombarda SpA, una

empresa italiana sita en Pioltello, Milán,

la inversión en la primera prensa HP

T300 instalada en Europa fue un paso

importante hacia una nueva tecnología

que permite imprimir libros de gran

calidad, rentables y con tiradas cortas

gracias al uso de la tecnología de

inyección. Desde su creación, en 1976,

como una pequeña empresa especiali-

zada en la producción de cómics,

Rotolito Lombarda se ha convertido en

una empresa líder dedicada a la impre-

sión de publicaciones y cuenta con

cuatro establecimientos en Milán y una

superficie que asciende a 100.000 m2.

Las capacidades de producción de

Rotolito Lombarda abarcan las pren-

sas de alimentación de hojas y las

prensas web litográficas offset, las

prensas de gravado, las prensas espe-

cializadas en la impresión de libros,

una prensa digital HP Indigo y la pren-

sa web HP T300 Color Inkjet .

Asimismo, Rotolito Lombarda emplea

uno de los sistemas de encuaderna-

ción más avanzados de Europa, que

ofrece una encuadernación de tapa

dura perfecta y de cosido a caballete,

así como encuadernación de estilo

holandés para las ediciones especia-

les. La HP T300 utiliza un sistema de

acabado en línea de Muller Martini

que, en conjunto, forman una unidad

de producción esencialmente indepen-

diente. Gracias a su prensa HP Indigo,

Rotolito Lombarda puede imprimir por-

tadas a todo color para tiradas cortas

de libros en diferentes sustratos.

44 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

El pasado noviembre HP presentó en los locales de Rotolito Lombarda, cerca de Milán

la primera instalación europea de una impresora digital HP T300, con la que esta

empresa ha iniciado la producción de libros en formato digital.

“Éramos conscientes de que nos faltaba flexibilidad para responder a las demandas de

tiradas cortas con los equipos con los que contábamos, Por tanto, tuvimos que pasar-

nos a la tecnología digital y, cuando probamos la prensa web HP T300 Color Inkjet,

descubrimos que era la solución que habíamos estado esperando”. Explicó Emanuele

Bandecchi, desarrollador de tecnología digital en Rotolito Lombarda SpA

IMPRESIÓN DIGITAL

REP

OR

TA

JE Primera HP T300 instalada en Europa

José Luis Mezquita,Enviado especial a Milán.

Page 47: Alabrent 309

Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

La automatización y la aplicación

de las tecnologías más avanzadas

constituyen un elemento clave de las

ventajas competitivas de Rotolito

Lombarda. Sus cuatro establecimien-

tos están conectados a través de una

intranet que permite al personal reali-

zar un seguimiento del progreso de

cada uno de los trabajos, así como

controlar el suministro de papel pro-

cedente del almacén “Cubo de papel”,

exclusivo de la empresa. Esta instala-

ción automatizada, que garantiza que

las prensas estén siempre provistas

del papel adecuado, tiene una capaci-

dad para 25.000 toneladas de papel y

mueve hasta 50 rollos por hora.

Producción de tiradas cortas de libros con una alta calidad

Rotolito Lombarda, que posee una

base de clientes que comprende edi-

toriales de revistas y libros nacionales

e internacionales, así como las más

prestigiosas marcas de moda y mino-

ristas en general, que le encargan la

producción de sus catálogos, está al

tanto de las necesidades de los clien-

tes y de los avances tecnológicos. La

demanda de tiradas más cortas y pla-

zos de entrega más ajustados es cada

vez más frecuente debido al cambio

de tendencia en los ámbitos de la dis-

tribución y el marketing, y Rotolito

Lombarda ha reconocido la creciente

necesidad de contar con competen-

cias para satisfacer estas necesidades

de forma rentable.

“Hemos realizado un seguimiento

de la evolución de la impresión digital

desde que irrumpió en el mercado",

comenta Emanuele Bandecchi, encar-

gado del negocio digital de Rotolito

Lombarda. “Siempre hemos pensado

que la impresión digital representaba

una solución estratégica para el futu-

ro, pero teníamos que encontrar un

IMPRESIÓN DIGITAL

REP

OR

TA

JE

Alabrent | 45

La prensa web HP T300 Color Inkjet de Rotolito Lombarda fue la primera en instalarse en Europa, una decisión adoptada en el verano de 2009, en medio de las incertidumbres de la crisis financiera.

“Siempre hemos pensado que la impresión digital representaba una solución estratégica para el futuro, pero teníamos que encontrar un sistema que pudiera cubrir las necesidades específicas de la producción de libros. Tras haber sometido a pruebas exhaustivas a la prensa web HP T300 Color Inkjet, nos dimos cuenta de que habíamos elegido bien al instalarla”. Comenta Emanuele Bandecchi, encargado del negocio digital de Rotolito Lombarda.

Page 48: Alabrent 309

sistema que pudiera cubrir las necesi-

dades específicas de la producción de

libros. Tras haber sometido a pruebas

exhaustivas a la prensa web HP T300

Color Inkjet, nos dimos cuenta de que

habíamos elegido bien al instalarla”.

La prensa web HP T300 Color Inkjet

de Rotolito Lombarda fue la primera en

instalarse en Europa, una decisión

adoptada en el verano de 2009, en

medio de las incertidumbres de la crisis

financiera. “Siempre hemos logrado

destacar por nuestro compromiso con

la tecnología”, añade Bandecchi.

“Invertir en las „soluciones del futuro�

forma parte de nuestra visión y, ade-

más, nos ha servido para que Rotolito

Lombarda se posicione entre las princi-

pales empresas en los mercados euro-

peo e italiano de impresión de libros.

Por tanto, no dudamos a la hora de

adquirir la HP T300, que consideramos

la solución ideal para cubrir nuestras

deficiencias productivas”.

Beneficios operativos

La prensa web de inyección de tinta

de Rotolito Lombarda permite a la

empresa imprimir tiradas de libros de

500 a 3.000 copias para sus clientes de

una forma rentable y asequible. La

empresa considera 3.000 copias como

el punto de convergencia para la mayo-

ría de los proyectos de impresión de

libros, aunque las variables como el

número de páginas de un libro pueden

alterar este punto con una diferencia de

varios cientos de copias. “Presentamos

a nuestros clientes las oportunidades

que ahora tenían en aplicaciones tales

como la personalización y la impresión

de datos variables, que ellos considera-

ron como servicios de valor añadido",

añade Bandecchi. “Sin duda, se trata

de un nuevo mercado en el que nos

estamos abriendo paso, en el que ya

hay varios clientes que demandan estas

aplicaciones”.

Las ventajas que ofrece a los clien-

tes la producción digital van más allá

de las tiradas cortas y rentables. “Las

editoriales están intentando reducir

costes en términos de existencias y

almacenamiento”, explica Bandecchi.

“Realizan pedidos de menor volumen,

pero más frecuentes. Gracias a la nue-

va prensa HP T300, hemos podido

IMPRESIÓN DIGITALR

EP

OR

TA

JE

46 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

La HP T300 utiliza un sistema de acabado en línea de Muller Martini que, en conjunto, forman una unidad de producción esencialmente independiente.

Durante la jornada se realizaron presentaciones por HP y sus clientes.

Paolo Bandecchi fundador de Rotolito Lombarda y un gran activo de esta empresa a la que ya se han incorporado sus hijos.

Page 49: Alabrent 309

Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

satisfacer estas necesidades, redu-

ciendo el tiempo de producción, pero

ofreciendo siempre los resultados que

los clientes esperan. Asimismo, con

esta prensa web de inyección de tinta,

en la mayoría de los casos la calidad

es la misma que con la tecnología

convencional, algunas veces incluso

mejor, pues la impresión digital puede

garantizar estabilidad y continuidad en

los resultados. “El actual volumen de

las tiradas, los tamaños de los libros y

las existencias de papel se adaptan

perfectamente a la producción de la

HP T300”, comenta Bandecchi. “El

otro factor importante es que la pren-

sa web HP T300 Color Inkjet imprime

libros con la calidad que esperan los

principales clientes internacionales, lo

que no siempre se puede decir de la

tecnología offset". Entre los clientes

que utilizan la prensa web HP T300

Color Inkjet, destaca Gruppo Sole

24Ore, una de las principales editoria-

les italianas del sector financiero.

Rotolito Lombarda imprime libros jurí-

dicos y financieros para Gruppo Sole

24Ore (compuestos de texto principal-

mente) en tiradas que oscilan entre las

900 y 2.500 copias, con una encua-

dernación perfecta utilizando portadas

impresas en la prensa HP Indigo.

Otros beneficios que ha observado

Rotolito Lombarda son los relaciona-

dos con el medio ambiente en cuanto

a un menor desperdicio de papel, el

uso de tintas con base acuosa y el

programa de reciclaje de materiales

para reciclar los cabezales de impre-

sión. Estas características son de inte-

rés particular para algunos de sus

clientes que piden que sus impresio-

nes se realicen de forma que se reduz-

ca el impacto en el medio ambiente.

“La HP T300 nos ha permitido satisfa-

cer las demandas de tiradas cortas,

incluida la personalización y la pro-

ducción de datos variables”, concluye

Bandecchi. “Pretendemos centrarnos

en estos ámbitos, pues hemos obser-

vado grandes oportunidades en este

sector".

Tras su primera instalación comer-

cial en diciembre de 2008, la prensa

web HP T300 Color Inkjet ha ayudado

a la evolución de la impresión digital

desde aplicaciones exclusivas para

determinados nichos de mercado a

aplicaciones de impresión de mayor

alcance gracias a que permite ofrecer

una producción digital en color renta-

ble y de gran volumen. La prensa

imprime un rollo de 762 mm de anchu-

ra con impresiones a cuatro colores

de 1.200 x 600 puntos por pulgada a

una velocidad de hasta 122 m por

minuto.

Alabrent | 47

Durante el evento, también estuvo pre-

sente Giovanni Antonuzzo, Director ejecuti-

vo de Rotomail Italia SpA, una empresa sita

en Cologno Monzese (Milán) que ha instala-

do la prensa HP T300 para cubrir la deman-

da versátil de datos variables.

Rotomail Italia se fundó en 1998 como

una compañía especializada en la impresión

según demanda basada en datos digitales.

Desde entonces, la compañía ha crecido

con rapidez. En 1999 pasó a dedicarse a la

impresión digital en color y, actualmente, es

uno de los proveedores de impresión digital

en color más importantes de Europa, con

una plantilla de 101 empleados. En 2010,

su negocio ha experimentado un crecimien-

to del 20 por ciento, con una producción

anual estimada de 700 millones de páginas

en color al año. “Necesitábamos mayor

capacidad de impresión y, por ello, instala-

mos la prensa web HP T300 Color Inkjet en

nuestra empresa asociada, Rotol ito

Lombarda”, comentó Giovanni Antonuzzo,

Director ejecutivo de Rotomail Italia. “Me di

cuenta de que la prensa T300 era el único

sistema de su categoría que se encuentra

disponible actualmente en el mercado apro-

piado para nuestra actividad. Ante el rápido

y constante aumento de los volúmenes de

impresión, era importante que pudiéramos

contar con un sistema de impresión digital

que ya se hubiese probado, cuya capaci-

dad de producción también se hubiese

corroborado y que también hubiese demos-

trado sus capacidades de fiabilidad y rendi-

miento”. “Además del rendimiento y la fiabi-

lidad de la prensa, también nos atrajo su

gran flexibilidad”, añadió Antonuzzo. “La

prensa T300 podrá imprimir la gama com-

pleta de productos con los que contamos,

desde folletos para agencias de viajes has-

ta efectos y documentos financieros, libros

digitales, carteles y mucho más. Esto signi-

fica que la prensa nos permitirá satisfacer

todas las necesidades del mercado en

cuanto a productos y aplicaciones”.

Aurelio Maruggi, Vicepresidente y direc-

tor general de la división High-speed

Production Solutions de HP comentó.

“Estamos bastante satisfechos con la insta-

lación de la HP T300 en Rotomail Italia, una

de las empresas más destacadas de

Europa en el sector de la impresión digital

en color. Este hecho habla por sí solo acer-

ca de las ventajas reales que HP ofrece hoy

en día gracias a las soluciones líderes en el

sector con las que cuenta para la produc-

ción digital de gran volumen”.

HP T300 para Rotomail ItaliaIMPRESIÓN DIGITAL

REP

OR

TA

JE

Aurelio Maruggi, Vicepresidente y director general de la división High-speed Production Solutions de HP comentó: “Las ventajas reales que HP ofrece hoy en día gracias a las soluciones líderes en el sector con las que cuenta para la producción digital de gran volumen”.

Page 50: Alabrent 309

48 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

Servex cuenta con más de 120

profesionales especializados trabajan-

do durante las 24 horas del día, los 7

días de la semana, que garantizan el

pleno funcionamiento de sus instala-

ciones en las que lleva a cabo trabajos

de outsourcing documental, billing y

marketing directo para grandes

empresas del sector bancario, asegu-

rador y tecnológico, como es el caso

de Caja Madrid, Banco Cetelem,

Mapfre, BNP, Xtra Telecom, Bridge-

stone, por poner algunos ejemplos.

Be´eri Printers ha liderado en los

últimos treinta años el desarrollo de

los servicios de correo y la personali-

zación en el mercado israelí. Su mayor

ventaja es que ofrece soluciones crea-

tivas específicamente pensadas para

satisfacer las necesidades de cada

cliente llevándolas a cabo con la más

sofisticada tecnología de impresión

disponible en la actualidad, garanti-

zando así el mejor coste e inmejora-

bles resultados. Por tanto, no es de

extrañar que siendo líderes en su país

hayan decidido dar el salto y buscar

oportunidades de crecimiento en otras

zonas.

Según explica Harel Yitshaki, Chief

Executive Officer (CEO) en Be'eri

Printers, “España ya estaba en nues-

tro punto de mira desde hace tiempo

y Servex ha supuesto una oportunidad

que ha aparecido en el momento idó-

neo, así que no dudamos en llevar a

cabo la compra, y aunque siempre

supone un riesgo la internacionaliza-

ción de la empresa consideramos que

con Servex ese riesgo es perfecta-

mente asumible, ya que se trata de

una empresa muy bien establecida

con una larga presencia en el merca-

do español”.

Kodak Versamark

La primera medida que Be´eri ha

llevado a cabo en Servex ha sido la

introducción de un nuevo equipo de

Servex se prepara para revolucionar el mercado transpromo

IMPRESIÓN DIGITAL

AC

TU

AL

Si a la experiencia de una

empresa consolidada en el

sector transpromocional en

España como Servex se le

añaden los conocimientos en

transpromo del gigante israelí

Be´eri, que desde hace un año

ha adquirido la empresa espa-

ñola, y los equipos de impre-

sión de Kodak, recientemente

instalados en Madrid, el resul-

tado es una empresa sobra-

damente preparada para revo-

lucionar el mercado con nue-

vos productos transacciona-

les.

Responsables de Servex frente a uno de los nuevos equipos Kodak.

Page 51: Alabrent 309

Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

impresión, explica Alfredo Guardiola,

Gerente de Servex. El equipo instala-

do ha sido una KODAK VERSAMARK

VT3000 que ya está operativa desde

el pasado mes de abril y que en opi-

nión de Guardiola “nos ofrece muy

buenas perspectivas ya que gracias a

este equipo podremos llevar a cabo

una producción diaria superior a los

dos millones y medio de A4”.

Harel Yitshaki explica que la elec-

ción de la Versamark vino dada por

los buenos resultados obtenidos por

este equipo en las instalaciones de

Be´eri en Israel. “Nosotros ya llevamos

muchos años trabajando con Kodak

Versamark en Israel y nos sentimos

muy a gusto con esta tecnología, así

que es lógico que intentemos trasla-

dar todos nuestros conocimientos

acumulados a Servex, y qué mejor

modo de hacerlo que utilizando el

mismo equipo en los dos centros de

producción”.

El Gerente de Servex constata las

ventajas de la instalación.”Con la ins-

talación de la Kodak Versamark vamos

a realizar un salto cualitativo importan-

te porque hasta ahora no podíamos

ofrecer impresión a color. Ahora, ade-

más de color, aumentamos muy signi-

ficativamente nuestra capacidad de

producción, así que esta decisión de

Be´eri nos ha aportado tranquilidad,

estabilidad y posibilidades de innovar,

crecer y entrar ya en el mercado del

transpromo a todo color”.

Gerardo Codeso, Ejecutivo de

cuentas Inkjet Printing Solutions de

Kodak en España, explica que la

KODAK VERSAMARK VT3000 es un

equipo muy testado con una larga tra-

yectoria en el mercado, equipado con

cabezales de 9 pulgadas que tanto

imprime en negro como a todo color,

así que permite diferentes configura-

ciones con velocidades de hasta 150

m/minutos y resoluciones de 300 x

600. Incluso la impresión en bobinas

blancas es posible, cosa que no todas

las empresas son capaces de llevar a

cabo con los tradicionales equipos de

impresión transaccional en continuo.

La unidad de impresión del siste-

ma KODAK VERSAMARK VT3000 se

basa en la tecnología de inyección de

tinta, lo que hace posible la impresión

en cuatricromía a dos caras en una

amplia gama de papeles, tanto preim-

presos como en blanco, con una

anchura máxima imprimible de 455

mm. Al igual que otras tecnologías de

su categoría, el VT3000 admite gra-

majes de los 60 a los 160 g/m2, con

anchuras de bobina de un mínimo de

200 mm hasta un máximo de 520 mm.

En opinión de Codeso “Servex

cuenta ahora con una posición privile-

giada en el mercado porque, además

de disponer de un nuevo equipo de

impresión y de contar con una larga

trayectoria a sus espaldas, dispone

del mejor asesoramiento del mercado

con la gestión de Be´eri. Conviene

recordar que en Israel nos llevan

mucha ventaja en el mercado del

transpromo y ahora Servex es una de

las pocas empresas en España que

cuenta con esta experiencia”.

Crecimiento

Harel Yitshaki comenta que “el

siguiente paso será ofrecer a los clien-

tes actuales y a los potenciales de

Servex una nueva gama de productos

basados en nuestra capacidad de

impresión en color y en nuestros

métodos únicos de acabado. Una vez

implantados en el mercado continua-

remos nuestro plan de inversión en

Servex ampliando nuestra capacidad

de impresión y de ensobrado con la

instalación de nuevos equipos”.

Alfredo Guardiola reafirma las

inquietudes de crecimiento de

Yitshaki: “Aunque este año las cosas

están siendo difíciles, por la crisis y

por el índice de agrupamiento de

documentos que está llevando a cabo

la banca, lo que supone una reduc-

ción importante de ensobrados men-

suales, tenemos buenas perspectivas

de crecimiento gracias a los clientes

con los que estamos trabajando”.

“Además, el ofrecer un servicio

completo desde la impresión a la dis-

tribución, el disponer de certificacio-

nes como la ISO de calidad, y un ser-

vicio de seguridad excepcional y

exclusivo que elimina por completo

cualquier manipulación humana

durante todo el proceso, nos permite

ofrecer unas garantías de seguridad

extremas que el mercado valora muy

positivamente”, concluye Guardiola.

IMPRESIÓN DIGITAL

AC

TU

AL

Alabrent | 49

Page 52: Alabrent 309

50 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

A raí z del exitoso lanzamiento de

su oferta de Servicios de Gestió n de

la Impresió n (Océ Managed Print

Services –MPS-) en paí ses como

Holanda, Reino Unido y EE.UU., Océ

está acelerando su expansió n a otros

mercados europeos entre los que se

incluye Españ a.

Los Servicios de Gestió n de la

Impresió n se caracterizan por permitir

a los clientes el control total de los

costes de sus act iv idades de

impresió n, beneficiá ndose de las

mejores prá cticas en esta á rea y

garantizando un correcto flujo de tra-

bajo relacionado con los procesos

documentales de sus respectivas

organizaciones. Ademá s, al transferir

la responsabilidad –ya sea totalmente

Océ lanza sus servicios Managed Print Services en Iberia

IMPRESIÓN DIGITAL

AC

TU

AL

Océ fue Silver sponsor de

2010 MPS European Confe-

rence que se celebró en

Barcelona del 10 al 12 de

noviembre. Con este motivo

tan especial, Océ se prepara

para lanzar sus nuevos servi-

cios Managed Print Services

que ofrecen a sus clientes una

solució n “llave en mano” a

sus necesidades de hardware,

software y servicios relacio-

nados con los servicios docu-

m e n t a l e s e n c u a l q u i e r

organizació n.

Francisco Calvache, director de la divisió n Océ Document Printing.

Page 53: Alabrent 309

Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

o só lo en parte – de sus procesos de

impresió n a Océ , las empresas pue-

den emplear su tiempo en centrarse

en sus propios objetivos de negocio.

En palabras de Francisco

Calvache, director de la divisió n Océ

Document Printing y má ximo respon-

sable del desarrollo de MPS para

Iberia: “Nuestros clientes y prospectos

por fin cuentan con una herramienta

unificada para beneficiarse de toda la

experiencia de nuestra multinacional,

que tiene como clientes a muchas de

las principales empresas del IBEX-35

y del listado Fortune 500”.

30% de ahorro y un mercado creciente

Pero si por algo resultan beneficio-

sos este tipo de servicios es por su

capacidad para reducir los costes de

impresió n hasta un 30%, un aspecto

clave en el momento econó mico

actual. Tanto es así , que Océ estima

que en Españ a el mercado de los

Servicios de Gestió n de la Impresió n

se está n imponiendo gracias a la

necesidad de la profesionalizació n de

la gestió n documental en las empre-

sas.

É xito asegurado

Los servicios Océ MPS se imple-

mentan a travé s de una serie de eta-

pas muy detalladas con el objetivo de

responder eficazmente a las necesida-

des de los clientes. La primera de ellas

es la fase de evaluació n, en la que se

analiza la situació n actual junto con:

sus requerimientos de impresió n, los

escenarios y el Coste Total de

Propiedad, para terminar definiendo

un plan de trabajo. A continuació n, en

la fase de transició n, se asegura una

migració n controlada a la situació n

que se desea llegar, traduciendo la

polí tica de impresió n corporativa ele-

gida en productos ó ptimos y servicios

de implementació n. Por ú ltimo, en la

fase operativa, se definen las tareas y

los servicios diarios, poniendo é nfasis

en lograr una mejora continua.

Comercializació n por separado

En cuanto a su modelo de ventas,

Océ comercializará los servicios de

MPS dentro de la divisió n Océ

Document Printing Systems, divisió n

enfocada a la comercializació n de

soluciones para el Sector Pú blico y

Empresarial, ya sea para grandes cor-

poraciones o para empresas media-

nas o pequeñ as. Con el lanzamiento

de esta nueva oferta, Océ diversifica

su gama de servicios de valor añ adido

e incrementa, por lo tanto, su

especializació n en este segmento de

mercado.

Sostenibilidad medioambiental

Ademá s del citado ahorro de cos-

tes y de la mejora de la eficiencia, Océ

MPS ayuda a los clientes a cumplir

sus objetivos de sostenibilidad. Y es

que, al racionalizar los flujos de traba-

jo, se mejora la eficiencia energé tica

de los dispositivos y se reduce el

nú mero de impresiones innecesarias,

logrando así un importante ahorro en

el consumo de energí a y una impor-

tante disminució n de las emisiones de

CO2. Asimismo, Océ se centra en el

uso de materiales duraderos y en el

reciclado de componentes.

IMPRESIÓN DIGITAL

AC

TU

AL

Alabrent | 51

Page 54: Alabrent 309

52 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

EFI PrintMe, que acaba de cumplir

nueve años en el mercado, fue el pri-

mer* sistema de impresión cloud prin-

ting ("en la nube") que permitió a los

trabajadores móviles cargar documen-

tos en la plataforma PrintMe e impri-

mirlos de manera segura en cualquier

impresora compatible. El sistema, que

se ha extendido por todo el mundo y

con el que se han producido millones

de páginas, permite imprimir docu-

mentos fácilmente desde cualquier

lugar, ya sea como usuario invitado en

una empresa, desde una habitación

de hotel, en el aeropuerto o incluso

desde la calle con un dispositivo

móvil.

Con el lanzamiento de la nueva

generación de PrintMe, EFI mejora las

prestaciones de las impresoras com-

patibles con la "nube" PrintMe

mediante funciones avanzadas de

conversión de documentos, aplicacio-

nes únicas para teléfonos inteligentes

y un kit para que los desarrolladores

de software puedan añadir funciones

de impresión a sus aplicaciones.

Además, la aplicación PrintMe para

iPhone (disponible a principios de

noviembre) permitirá a los usuarios

imprimir tarjetas de embarque de

avión, páginas web, fotos y muchas

cosas más desde un iPhone, un

iTouch o un iPad. Por su parte, la apli-

cación para BlackBerry estará dispo-

nible en diciembre.

Mucho antes de la irrupción de los

teléfonos inteligentes y del auge actual

de los servicios basados 'en la nube',

EFI sacó al mercado una tecnología

revolucionaria de impresión móvil con

la que se han producido millones de

páginas", afirma Toby Weiss, director

general de la división Fiery y vicepre-

sidente ejecutivo de EFI.

"Ahora vamos a acercar esta tec-

nología a los profesionales que quie-

ren imprimir desde cualquier aplica-

ción, con cualquier dispositivo móvil y

en cualquier impresora, estén donde

estén. Ya no hace falta comprar una

impresora especial o esperar años a

que lleguen estas funciones porque

PrintMe ya funciona con cualquier

impresora compatible."

La tecnología PrintMe ha llamado

la atención de algunos de los socios

de fabricación más antiguos de EFI.

Xerox ha anunciado recientemente su

oferta de soluciones de impresión

móvil, entre las que se halla la plata-

forma PrintMe.

"Gracias a los años que llevamos

colaborando con EFI, podemos apro-

vechar la tecnología PrintMe para

ampliar nuestra oferta de soluciones

móviles", señala Elizabeth Fox, vice-

presidenta de la división de soluciones

profesionales de Xerox Corporation.

"La tecnología de impresión 'en la

nube' de EFI será muy útil para

muchos clientes de Xerox que cada

vez utilizan más los dispositivos móvi-

les en su día a día."

EFI nueva generación de EFI PrintMe

IMPRESIÓN

AC

TU

AL

EFI anuncia el lanzamiento de

la nueva generación Print-

Me®, la solución de impre-

sión móvil que permite a los

trabajadores imprimir desde

cualquier dispositivo conecta-

do a Internet -ordenadores

portát i les, iPhone, iPad,

BlackBerry y Google Android-

donde y cuando quieran.

Page 55: Alabrent 309

53 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

Con velocidades de escaneado de

hasta 60 ppm (80 ppm en modo hori-

zontal), el imageFORMULA DR-6030C

ofrece una amplia gama de ventajas

con respecto al modelo anterior, el

DR-5010C, sin ningún incremento en

el precio. Este nuevo escáner de pro-

ducción A3, uno de los más compac-

tos y de mayor eficiencia energética

del mercado, ofreciendo una mejor

relación precio/rendimiento.

Capaz de mejorar la productividad

en entornos con uso intensivo de

papel, el diseño de la alimentación y

salida de papel frontales, lo hacen

ideal para ubicación en el escritorio de

oficinas y sucursales remotas. Sus

mecanismos de alimentación y de

transporte de papel son muy fiables y

admiten una amplia gama de forma-

tos, incluidos los de tamaño A3, tarje-

tas plásticas y documentos de hasta 3

m de longitud.

Una ruta de papel directa seleccio-

nable también permite escanear docu-

mentos excepcionalmente gruesos,

incluidas tarjetas o documentos de

varias hojas. Además, el DR-6030C es

completamente compatible con el

escáner de pantalla fija unidad 101 de

Canon que permite manipular docu-

mentos de tamaños irregulares como

libros y pasaportes.

Sean Suematsu, Director Europeo

de Soluciones de Escaneado de

Documentos de Canon Europa

comentó “Las necesidades de nues-

tros clientes evolucionan continua-

mente y siempre trabajan bajo pre-

sión, por lo que tienen que lograr la

mayor eficiencia posible. El DR-6030C

es una solución compacta que satis-

face las necesidades de las organiza-

ciones que necesitan manipular gran-

des cantidades de información, tales

como bancos, o f ic inas de la

Administración Pública o departamen-

tos de archivo, pero también es lo

suficientemente fácil de usar para las

pequeñas oficinas que necesitan un

escáner de tamaño A3 fiable y pro-

ductivo.”

El DR-6030C incluye una amplia

gama de soluciones de software para

mejorar la calidad de la imagen.

“Mejora del texto avanzada II” destaca

el texto que aparece sobre fondos de

patrón oscuro y “Detección automáti-

ca del color” ayuda a reducir el tiempo

de clasificación anterior al escaneado

ya que distingue automáticamente los

documentos en color de los docu-

mentos en blanco y negro, reduciendo

los tamaños finales ya que guarda las

imágenes en el formato correcto.

Gracias al software integrado,

CapturePerfect 3.0, Kofax VRS y

Adobe Acrobat Standard, el DR-6030C

puede realizar una amplia gama de

tareas que permiten aprovechar al

máximo su potencial.

El imageFORMULA DR-6030C ya

está disponible en toda Europa.

Canon presenta un escáner de tamaño A3 compacto

IMPRESIÓN DIGITALA

CTU

AL

Canon Europa, anunció el lan-

zamiento al mercado del

escáner compacto de alta

velocidad y tamaño A3, ima-

geFORMULA DR-6030C para

pymes, entornos corporativos

y empresas de servicio de

escaneado.

Page 56: Alabrent 309

54 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

Su amplia gama de servicios abar-

ca desde el pedido mas sencillo de

talonarios, sobres o tarjetas hasta el

más complejo, como edición de libros

a color, encuadernados con tapa dura

y rústica, edición de diarios a color,

folletos, catálogos, revistas, calenda-

rios, estuchería, etc

MediaPrint dispone de una plega-

dora T49/x de MBO y decidió este

año confiar de nuevo en el fabricante

de máquinas plegadoras representa-

do en España por MÜLLER MARTINI.

En el paso mes de mayo se instaló y

puso en marcha con éxito una plega-

dora de bolsas automática marca

MBO, modelo B30/444 Efficiency. La

máquina está equipada con un mar-

cador Rotary R760, un mando

MS-Control, un dispositivo plegador

con cuchilla Z2, una salida de pliegos

verticales con dispositivo prensador

SBAP46ME, una salida en escama

tipo A76 y un equipo encolador

HHSC220. Esta plegadora ha sido

concebida de manera que su manejo

resulta muy fácil sin necesidad de

poseer conocimientos especiales en

cuanto al uso de ordenadores. La B30

aporta buena calidad a precios ase-

quibles y todo ello con una amplia

gama de formatos.

Con la instalación de este modelo

de máquina la empresa completa su

parque de maquinaria para impresión

digital y offset y sistemas de encua-

dernación en tapa dura y grapa, alza-

doras, troqueladoras ampliando de

este modo su oferta de productos.

Nueva plegadora B30 de MBO para MEDIAPRINT

ACABADOS

AC

TU

AL

MediaPrint Industria Gráfica

es una empresa joven, diná-

mica y en constante evolu-

ción. El servicio integral a sus

clientes, el cumplimiento de

los plazos de entrega y la cali-

dad de producción son sus

máximas preocupaciones.

Todo eso hace de Mediaprint

Industria Gráfica una de las

empresas destacadas de artes

gráficas de la provincia de

Alicante.

En la Nucia a 10 Km de Beni-

dorm (Alicante), con más de

1000m2 de superficie in-

dustrial, máquinas de última

generación y un equipo for-

mado por cerca de 30 profe-

sionales, esta empresa distri-

buye sus productos por toda

la geografía

Page 57: Alabrent 309

La T 765EA ahorra tiempo para que usted ahorre dinero:

MBO T 765 Efficiency Automatic

Ahorro gracias a tiempos de preparación más cortos.

Aumento rápido de pedidos, tiradas cada vez más pequeñas - la nueva plegadora debolsas MBO T 765 Efficiency Automatic es la respuesta perfecta a estos requerimientos.La automatización de serie precisamente en áreas en las que los tiempos de preparacióneran más largos y el excelente confort de manejo del nuevo mando MBO VARIO-Controlconsiguen que la máquina sea particularmente atractiva. La combinación de técnicamadurada y un paquete de automatización que ahorra tiempo hacen que la T 765Efficiency Automatic sea una inversión con una relación precio-rendimiento imbatible.

MÜLLER MARTINI IBÉRICA S.A.U.T. 93 480 88 00www.mullermartini.com/[email protected]

www.mbo-folder.com

Aumento rápido de pedidos, tiradas cada vez más pequeñas - la nueva plegadora debolsas MBO T 765 Efficiency Automatic es la respuesta perfecta a estos requerimientos.La automatización de serie precisamente en áreas en las que los tiempos de preparacióneran más largos y el excelente confort de manejo del nuevo mando MBO VARIO-Controlconsiguen que la máquina sea particularmente atractiva. La combinación de técnicamadurada y un paquete de automatización que ahorra tiempo hacen que la T 765Efficiency Automatic sea una inversión con una relación precio-rendimiento imbatible.

MÜLLER MARTINI IBÉRICA S.A.U.T. 93 480 88 00www.mullermartini.com/[email protected]

www.mbo-folder.com

Page 58: Alabrent 309

En esta ocasión, las jor-

nadas se centraron en dos

cuestiones relacionadas con

el futuro del sector: la

Realidad Aumentada y la pre-

sentación de un estudio pre-

dictivo de lasituación del sec-

tor gráfico en el año 2020.

El martes 16 de noviem-

bre, bajo el título «Rein-

ventando el sector de Artes

Gráficas: Realidad Aumen-

tada y otras tecnologías»,

tuvo lugar la primera jornada

de la Semana. Ignac io

Tornero Suárez, vocal de la

Junta Directiva de AGM y

presidente de la Comisión

Técnica y de Nuevas Tec-

nologías de las Asociación

ejerció de moderador e inau-

guró la sesión. Tras ello, dio

paso a la intervención de los

ponen tes de l I ns t i t u to

56 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

Como cada año, la tercera semana de noviembre acogió una de las iniciativas de

mayor alcance de las llevadas a cabo por la Asociación de Empresarios de Artes

Gráficas de Madrid-AGM, la Semana de las Artes Gráficas. Empresarios y

representantes del sector se dieron cita una vez más en las diversas actividades

que tuvieron lugar con motivo de la misma. La decimoctava convocatoria de la

Semana de las Artes Gráficas contó con dos jornadas de conferencias del ámbito

de la gestión empresarial, celebradas en la Cámara de Comercio de Madrid, y

con la celebración de la tradicional Cena-Homenaje «Gráficos 25 Años» en el

restaurante In Zalacaín de Pozuelo de Alarcón.

ACTIVIDAD INSTITUCIONAL

REP

OR

TA

JE

La jornada «Reinventando el sector de Artes Gráficas: Realidad Aumentada y otras tecnologías» contó con la presencia de más de sesenta empresas asociadas.

La 18ª Semana de las Artes Gráficas se centra en el futuro del sector

Page 59: Alabrent 309

Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

Tecnológico y Gráfico Tajamar Aurelio

Mendiguchía, director técnico, y Javier

Rodríguez- Borlado, director de I+D,

que señalaron que la tecnología de la

Realidad Aumentada es uno de los

caminos para potenciar el mundo grá-

fico. Asimismo comentaron los cam-

bios que se están produciendo en los

hábitos de consumo, los nuevos retos

del marketing, los negocios digitales,

la nueva era del mundo gráfico, la

dinamización de las empresas para

cubrir las necesidades generalizadas

por los perfiles de clientes del siglo

XXI y los negocios emergentes apoya-

dos en nuevos desarrollos tecnológi-

cos (W2P), entre otros.

Por su parte, la jornada del jueves

18 se centró en la presentación del

estudio encargado al Centro de

Predicción Económica (CEPREDE) «La

industria gráfica en 2020: análisis pre-

dictivo, dimensión, alternativas y ries-

gos». La inauguración corrió a cargo

de Pedro Cuesta, presidente de AGM,

quien dio la bienvenida a los presen-

tes. La jornada se dividió en dos

sesiones, en la primera Julián Pérez,

director general adjunto y director de

predicción de CEPREDE, desarrolló la

contextualización del escenario

macroeconómico actual y su horizonte

en 2020. A continuación, Milagros

Dones, directora del Área Sectorial de

CEPREDE, mostró la evolución de las

cifras del sector dentro del modelo

actual, el nivel de productividad de las

empresas, las posibilidades de vender

en el exterior y la necesidad de ajustar

empleos. Igualmente, comentó los

sectores de referencia y aquellos que

impactan positiva o negativamente en

el sector gráfico.

Durante su intervención final,

Pedro Cuesta destacó que «todavía

nos queda algo por decir en la

Asociación y vamos a seguir insistien-

do porque solo hay un camino, el

camino que ha emprendido la

Asociación es informar. Tenemos la

obligación de comunicar todo lo que

está pasando, y de lo que está pasan-

do tenéis una magnífica información

para tomar decisiones y las tenéis que

tomar ya. En mi modesta opinión, las

teníamos que haber tomado antes».

Cena-Homenaje «Gráficos 25 Años»

La 18ª Semana de las Artes

Gráficas culminó con la celebración

de la Cena- Homenaje «Gráficos 25

Años» el viernes 19 de noviembre,

donde se rindió tributo a aquellos

empresarios que llevan más de 25

años con su actividad empresarial. En

esta ocasión, los empresarios home-

najeados fueron:

• María Ángeles Izquierdo Alberca,

de Impresos Izquierdo. Por sus veinti-

cinco años de actividad empresarial.

• Javier Sáez López, de Gráficas

Arias Montano. Por sus veinticinco

años de actividad empresarial.

• Fernando Vázquez Iglesias, de

Gráficas Arias Montano. Por sus vein-

ticinco años de actividad empresarial.

• Miguel Ángel Vázquez Vázquez,

de Gráficas Arias Montano. Por sus

veinticinco años de actividad empre-

sarial.

El encuentro contó con la presen-

cia de cerca de 250 personas, entre

las que se encontraban empresarios

gráficos y familiares, proveedores,

representantes de asociaciones y gre-

mios de España, el presidente de

Feigraf, representantes de las institu-

ciones de editores, libreros y repró-

grafos, así como de las principales

escuelas de formación de artes gráfi-

cas de Madrid y la prensa especializa-

da del sector. Destacar también la

asistencia de Eva Piera, viceconsejera

de Economía, Comercio y Consumo

de la Comunidad de Madrid; y de

Arturo Fernández, presidente de la

Cámara de Comercio de Madrid y de

CEIM.

Como novedad en esta ocasión la

cena de gala tuvo lugar en el restau-

rante In Zalacaín, siendo el secretario

general de AGM, Jesús Alarcón, el

conductor de la misma.

Tras el cóctel de bienvenida, Pedro

Cuesta, presidente de la Asociación,

ACTIVIDAD INSTITUCIONAL

REP

OR

TA

JE

Alabrent | 57

Pedro Cuesta, presidente de AGM (tercero por la izquierda), inauguró la jornada «La industria gráfica en 2020: análisis predictivo, dimensión, alternativas y riesgos» ante los cerca de cien empresarios asistentes.

El presidente de AGM, Pedro Cuesta, destacó en su discurso en la Cena-Homenaje «Gráficos 25 Años» que es precisamente en momentos como los actuales cuando más mérito tiene dedicarse a la actividad empresarial.

Page 60: Alabrent 309

pronunció un discurso previo a la

entrega de las insignias de oro, en el

que afirmó que «llevamos 32 años

destacando la labor de pequeños y

medianos empresarios y vamos a

seguir haciéndolo por dos razones

incuestionables: primero porque es

precisamente en momentos como el

actual cuando mayor mérito tiene

dedicarse a ser empresario. Es preci-

samente ahora, aunque muy pocos lo

reconozcan, cuando más necesarios

somos para nuestro país. Y segundo,

porque esta sociedad no ha querido

reconocer que en las personas que se

dedican a la actividad empresarial se

representan valores como el esfuerzo,

el sacrificio, la iniciativa y el riesgo. Y

por qué no decirlo, con estos actos

también buscamos la cohesión y par-

ticipación de todos vosotros».

Asimismo, el presidente subrayó

que «las dificultades solo se podrán

superar si hacemos de la ética nuestra

única manera de vivir, tanto empresa-

rial como personalmente, si todos

somos solidarios, si buscamos el bien

común, si ofrecemos nuestra ayuda y

colaboración a nuestros semejantes;

solo así la paz volverá a nuestros

corazones, y el presente y el futuro

estará lleno de felicidad».

A continuación, Eva Piera, vice-

consejera de Economía, Comercio y

Consumo de la Comunidad de Madrid,

felicitó a los empresarios homenajea-

dos indicando que «en este acto se

ensalza la labor y el esfuerzo diario de

las empresas gráficas madrileñas en

su conjunto. Gracias a vuestro esfuer-

zo, la industria de artes gráficas se ha

constituido como uno de los sectores

más importantes dentro de la industria

de la Comunidad de Madrid». Del mis-

mo modo, afirmó que «el esfuerzo, el

tesón, la excelencia en la gestión

empresarial y la innovación son las

claves fundamentales para volver a la

tan deseada senda del crecimiento

económico y para poder superar entre

todos esta situación».

Por su parte, Arturo Fernández,

presidente de la Cámara de Comercio

de Madrid y de CEIM, resaltó en su

intervención que «una vez más los

empresarios tenemos ante nosotros

importantes y nuevos retos» haciendo

hincapié en la oportunidad de sacar el

máximo provecho a la situación

actual. El presidente de la Cámara y

de CEIM, tras felicitar a los empresa-

rios homenajeados, también destacó

que el tiempo ha demostrado la res-

ponsabilidad y unidad que siempre ha

caracterizado a los empresarios

madrileños y, en relación con la indus-

tria gráfica, afirmó que es un sector

sobradamente preparado para afron-

tar los cambios y seriamente compro-

metido con la innovación.

ACTIVIDAD INSTITUCIONALR

EP

OR

TA

JE

58 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

El encuentro contó con la presencia de cerca de 250 personas.

Los empresarios homenajeados en la Cena «Gráficos 25 Años» 2010 tras recibir la insignia de oro de la Asociación.

Jesús Alarcón, secretario general de AGM, actuó como maestro de ceremonias en la XXXII Cena-Homenaje «Gráficos 25 Años».

Page 61: Alabrent 309

Recinto Gran Via 21-26 Marzo 2011

www.graphispag.com&MULTIMEDIA

Coincidiendo con:

23-26 Marzo 2011

Aerolínea Oficial:

Aproveche el mayor foco de atención del sector. Únase a la gran cita de la comunicación gráfica para ser protagonista en el punto de encuentro que integra toda la industria, la innovación y los agentes del sector. Aquí tiene las mejores posibilidades para contactar a los profesionales que deciden.

Salón internacional de la Industriay Comunicación Gráfica

Page 62: Alabrent 309

60 | Alabrent Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

¿Cuáles son las expectativas previstas por la organización de Graphispag para la edición de 2011 en cuanto a participación de fabri-cantes y visitantes?

Esperamos la presencia de más de

300 expositores directos, que ocupa-

rán cerca de 25.000m2 en los pabello-

nes 2 y 3 de Gran Via. En cuanto a vi-

sitantes, prevemos superar con creces

los 50.000 profesionales, gracias tam-

b i é n a l a c o i n c i d e n c i a c o n

Sonimagfoto&Multimedia.

¿La actual situación económica puede dar lugar a una reestructura-ción de las ferias, qué tendencias se están viendo en los últimos salo-nes internacionales?

Es indudable que la crisis econó-

mica también está pasando factura al

sector ferial. Muchas empresas están

“Graphispag dará las claves para reinventar la actividad gráfica y afrontar el futuro”

ACTIVIDAD INSTITUCIONAL

AC

TU

AL

El próximo mes de marzo,

Graphispag cumple 45 años

como feria de referencia para

la industria gráfica española.

El salón de Fira de Barcelona

se celebrará en un momento

clave para tomar decisiones

de futuro que ayuden a las

empresas gráficas a posicio-

narse en el nuevo escenario

que surja con la recuperación

económica. La inversión en

tecnología, la optimización y

actualización del parque de

equipos ya instalado, la bús-

queda de nuevos mercados y

aplicaciones del producto

impreso, la colaboración entre

compañías, la especialización,

la formación, la mejora en la

gestión empresarial son algu-

nos de los temas sobre los

que Graphispag aportará res-

puestas. Miquel Heredia, pre-

sidente del Comité Orga-

nizador, nos avanza cómo se

prepara esta convocatoria que

mostrará oportunidades de

crecimiento para el sector.

Entrevista a Miquel Heredia, presidente de Graphispag 2011

Page 63: Alabrent 309

Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

frenando su presencia en los salones

para ahorrar costes. Reducen el espa-

cio de contratación, el presupuesto de

promoción, el desplazamiento de pro-

fesionales,.... Graphispag, por su

carácter industrial y su periodicidad

cuatrienal, está resistiendo mejor que

otras ferias relacionadas con sectores

de consumo, pero no se salva de los

efectos de esta coyuntura. Veremos

un Graphispag más pequeño que el

de hace 4 años, pero aun así todos

los sectores que conforman la oferta

del salón estarán muy bien represen-

tados con la participación de las prin-

cipales empresas y suministradores

de cada especialidad. La principal ten-

dencia en el ámbito ferial pasa buscar

sinergias entre eventos, orientar los

salones completamente a la demanda

y ofrecer actividades de valor añadido

tanto al expositor como al visitante.

Graphispag lo que está haciendo, con

s u a l i a n z a c o n S o n i m a g f o -

to&Multimedia, con sus encuentros

sectoriales y la implicación de diferen-

tes colectivos y asociaciones, y con

un potente programa de actividades.

¿Presentará Graphispag nove-dades con respecto a anteriores ediciones?

En esta edición, Graphispag cele-

bra su 45 aniversario como la máxima

manifestación ferial del sector gráfico

en nuestro país. Queremos vincular

esta efeméride con una necesidad

expresada por las empresas gráficas:

la reivindicación del valor de la comu-

nicación impresa en la era de Internet

y las nuevas tecnologías. En este sen-

tido, Graphispag ha invitado a 45

reconocidos diseñadores, entre ellos

varios Premios Nacionales de Diseño,

a crear una colección de carteles que

muestren a la sociedad las posibilida-

des actuales y futuras del producto

impreso. Será una exposición exce-

lente, que quiere comunicar amplia-

mente que imprimir se seguirá impri-

miendo. Otra de las novedades es el

nuevo formato de la Jornada Joven.

La reconvertimos a sesiones diarias

para acoger a los grupos de escuelas

que visiten la feria. Queremos ofrecer

a los futuros profesionales del sector

algunas pistas para conocer las últi-

mas tendencias del sector y sacar el

máximo partido a Graphispag.

¿Qué otras actividades se desa-rrollarán?

Quiero destacar especialmente la

vertiente formativa de Graphispag. El

programa de jornadas técnicas estará

centrado en presentar oportunidades

de crecimiento para las empresas grá-

ficas. Queremos que Graphispag dé

las claves para reinventar la actividad

gráfica y afrontar el futuro. En este

sentido, dos reconocidos expertos

internacionales Frank Cost, catédrati-

ACTIVIDAD INSTITUCIONAL

AC

TU

AL

Alabrent | 61

Page 64: Alabrent 309

Impreso en CreatorStar de 115 g/m2 de TORRASPAPEL

co y decano del Rochester Institut of

Technology (EE.UU.), y Laurel Brunner,

consultora de tecnología gráfica y

medioambiente (Reino Unido) explica-

rán planteamientos innovadores para

la reestructuración del sector. También

se tratarán en diferentes mesas redon-

das las posibilidades de negocio en

publicidad y edición; en el mercado

del libro; en los contenidos digitales y

libros de texto; en la impresión digital

en pequeño y gran formato; en impre-

sión de packaging; o en serigrafía. El

salón contará con otras actividades

como el Aula Digital Adobe, el

Congreso de diseñadores gráficos o

las sesiones que organiza Aido.

¿Qué panorama gráfico se espe-ra para 2011 tanto económico como estructural y tecnológico?

Ya me gustaría poder predecir ese

futuro inmediato. Esta crisis, y me ha

tocado vivir unas cuantas, está siendo

muy dura y demasiado prolongada.

Sin embargo, estoy plenamente con-

vencido que el sector gráfico sabrá

reponerse y saldrá fortalecido. Es cier-

to que en algunas especialidades existe una sobrecapacidad de pro-

ducción que no ayuda en esta difícil

coyuntura económica, que el sector

lleva años realizando un gran esfuerzo

financiero para equiparse tecnológica-

mente, y que es necesaria una rees-

tructuración. Para ello cada empresa

ha de realizar un ejercicio interno con

el fin de determinar sus puntos fuer-

tes, sus posibilidades de mejora, su

necesidad de cambiar o no. Quizás la

solución pasa por optimizar su gestión

o buscar alianzas con otras empresas

con actividades complementarias.

Creo que hay que ver el 2011 con

confianza. Será también un año muy

duro, pero clave para posicionarse y

preparar la recuperac ión. Ah í

Graphispag puede resultar de gran

ayuda.

¿Qué atractivos tiene para el visitante la celebración en las mis-mas fechas y en el mismo lugar, el recinto de Gran Vía, de Sonimagfoto & Multimedia?

Con la digitalización, el sector pro-

fesional de la fotografía y la imagen

cada vez más utiliza equipos y proce-

sos gráficos en su actividad, tanto

para el tratamiento y producción de la

imagen como para la impresión sobre

cualquier tipo de soporte. Es un sector

que comparte muchos clientes con las

empresas gráficas. Creemos que es

un verdadero acierto convocar con-

juntamente las dos ferias líderes del

mundo gráfico y de la fotografía en

nuestro país para que los expositores

y visitantes se beneficien de sinergias

comunes y puedan sacar el máximo

partido a su participación o visita. Con

esta alianza estratégica, aumenta tan-

to la oferta comercial como el poder

de convocatoria de profesionales.

¿Nos podría dar algunas de las razones por las que los profesiona-les no deben perderse Graphispag 2011?

Considero que sería un error pres-

cindir de Graphispag. Las empresas

suministradoras han de reforzar su

papel como asesores de sus clientes

y de potenciales compradores sobre

la tecnología que mejor se adapte a

sus necesidades productivas. En este

momento de cambio de ciclo, ese

intercambio de información y expe-

riencias es lo que más valoran los pro-

fesionales del sector. Graphispag será

ese punto de encuentro entre oferta y

demanda para marcar las bases del

futuro del sector.

ACTIVIDAD INSTITUCIONALA

CTU

AL

62 | Alabrent

Page 65: Alabrent 309

Aditivos de mojado y productos para sistemasde lavado.

Mantillas para impresión offset.

Tintas para impresión offset.

Equipos CTP, sistemas de pruebas de color,planchas convencionales y térmicas.

Cordelles 2008030 Barcelona

T. 93 266 14 40F. 93 266 19 70

[email protected]

DIRECTORIO DE EMPRESASSuministros para impresión offset

PETREL: Tintas de seguridad.DIMUKEN: Troquelados, numeración, estampación de hologramas,banda magnética.Kodak Versamark: Cabezales de Ink-jet de alta velocidad de 1” 2”.B. Bunch: Desbobinadores, Rebobinadores, Plegadores, AppliedOptical Technologies, Hologramas.

c/. Puerto Pozazal, 18, Oficina 12 - 28031 MADRIDTel.: 91 528 96 57 - Fax: 91 539 31 80 - Móvil: 649 094 701

E-mail: [email protected] - Página web: www.daigraf.com

S.L.

Page 66: Alabrent 309

Suministros para la manipulación de papel y cartón

Empresas de Servicios

Cauchos para impresión offset compresibles yconvencionales, con varillas para rotativas

Pol. Ind. San José de Valderas IIc/. Rayo s/n, nave 30. 28918 LEGANÉS (Madrid)

Tel. 91 610 9650/9776. Fax 91 610 0661

Fundas de mojadores de algodón y acrílicas

Papel calibrado y alzas adhesivas

Para contratar un espacio en el DIRECTORIO DE EMPRESAS,

póngase en contacto con nosotros y le informaremos.

Tel.: 938 603 162

Page 67: Alabrent 309

41a edición de los Premios Laus del Diseño Gráfico y la Comunicación Visual

Laus 2011

Cada año miles de diseñadores y directores de arte luchan por ocupar las codiciadas páginas del tradicional libro de los premios Laus.

Las inscripciones ya están abiertas.

www.laus.cat

es

Page 68: Alabrent 309

100%Compromiso2

Bobinas para Plotter y PPC

Suzano planta 220.000 árboles cada día del año, inviertiendo constantemente para mejorar nuestro planeta.

Consuma siempre productos con garantía FSC.